Biosensors, compositions, kits and uses thereof based on aptamer and crisper / cas12a system

Abstract

The present application relates to biosensors, compositions, kits comprising aptamers and CRISPR / Cas12a systems and related methods and uses thereof. The biosensors employ a multi-target tandem DNA signal amplification strategy and a branched DNA-based multi-aptamer synergistic amplification mode, with the aid of CRISPR / Cas12a systems and aptamers, to convert target analyte (such as ions, small molecules, proteins, viruses, cells, tissues, etc.) signals into detectable signals (such as electrical signals and / or optical signals) through the transcleavage activity of CRISPR / Cas12a. The biosensors, compositions, kits and related methods of the present application not only save time and cost when detecting target analytes in vitro, but also have high sensitivity and potential for high-throughput detection. The detection platform based on the present application can rapidly and accurately quantify and / or qualify analytes such as ions, small molecules, proteins and cells.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological detection, and relates to a CRISPR / Cas12a coupled aptamer detection platform. The present application specifically relates to a biosensor, a composition and a kit for converting a signal of a target analyte (such as an ion, a small molecule, a protein, a virus, a cell, a tissue, etc.) into a detectable signal by means of the binding of a CRISPR / Cas12a system and an aptamer, and a method for detecting an analyte in vitro using the same. BACKGROUND

[0002] The detection of metal ions, small molecules, nucleic acids, proteins, viruses and pathogenic bacteria is so important mainly because of its wide application in various fields such as clinical diagnosis, drug research and development, food safety and environmental monitoring.

[0003] The CRISPR / Cas system is an acquired immune defense mechanism evolved by bacteria and archaea in the process of resisting the invasion of exogenous nucleic acid by using Cas protein under the guidance of RNA. In 1978, a kind of clustered repetitive DNA sequence with unknown function was first reported, and it was not until 2001 that it was officially named Clustered Regularly Interspersed Palindromic Repeats (CRISPR). With the unremitting exploration of scientific researchers in recent years, the classification and mechanism of CRISPR system have been preliminarily analyzed and widely applied in various fields such as gene editing, DNA assembly and gene expression regulation.

[0004] According to the composition of Cas (CRISPR-associated proteins, CRISPR associated proteins) gene and the number of effector proteins, the CRISPR / Cas system is divided into 2 classes and 5 types: the 1st class CRISPR / Cas system uses multiple effector protein complexes to interfere with target genes; the 2nd class CRISPR / Cas system uses a single effector protein to resist the invasion of foreign nucleic acids, and is widely concerned due to its simplicity and high efficiency. Among them, Cas9 and Cas12a (also known as Cpf1) as a typical 2nd class CRISPR / Cas system, has been successfully applied to prokaryotic / eukaryotic cell gene editing and gene regulation field. Among them, Cas12a with double-stranded activation cutting activity can cut any single-stranded DNA indiscriminately and has the potential of signal amplification, and therefore is extended to the field of nucleic acid detection, such as the "DETECTR" (DNA endonuclease targeted CRISPR trans reporter) developed by Doudna team, "HOLMES" (an one-HOur Low-cost Multipurpose highly Efficient System) characterized by Zhao Guoping team and "SHERLOCK" (Specific High Sensitivity Enzymatic Reporter UnLOCKing) diagnostic system developed by Zhang Feng team. The nucleic acid detection system of CRISPR has the characteristics of simplicity, low cost and ultra-high sensitivity, and only for nucleic acid detection obviously limits its application.

[0005] Allosteric transcription factor is a regulatory protein evolved by microorganisms to cope with environmental changes, usually containing DNA binding domain (DBD) and effector binding domain (EBD) two parts, which can trigger allosteric effect by binding effector and then accurately regulate the transcription of target gene. When small molecule effector binds to EBD, the conformation of allosteric transcription factor changes, thereby enhancing or weakening the ability of DBD to bind DNA, and based on this, small molecule signals can be converted into easily detected DNA signals by allosteric transcription factor, which is developed into a small molecule detection biological recognition element. Therefore, in the previous work of the inventors, by combining the ssDNA cutting ability of Cas12a protein and the allosteric effect of allosteric transcription factor, a simple, rapid, high-throughput and ultra-sensitive Platform for detecting small molecules (Nat Commun 10, 3672 (2019)). However, this system has limitations in its detection range, and it is necessary to overcome this limitation and construct a biosensor with a larger detection range. In order to achieve this goal, we need to find an element that can recognize a wide range of analytes, and then couple it with CRISPR detection. Aptamers are short nucleic acid sequences that can recognize targets ranging from ions to tissues, and can be obtained by in vitro screening through the method of Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Therefore, on the basis of CaT-SMelor, the inventors coupled the CRISPR / Cas system and aptamers to construct a new generation of sensor platform that can detect a wider range of analytes, CaT-SMelor 2.0 (Sci Bull, Available online 4 September 2020). In our early research, CaT-SMelor 2.0 achieved effective detection of cocaine and alpha-fetoprotein. At the same time, other researchers have also published similar detection sensors that combine CRISPR / Cas systems and aptamers to carry out detection of Na + , Pb 2+ , ATP, exosomes, Salmonella and Acinetobacter baumannii.

[0006] RNA viruses such as SARS-CoV-2, human immunodeficiency virus (HIV), severe acute respiratory syndrome coronavirus (SARS-CoV), Middle East respiratory syndrome coronavirus (MERS-CoV), influenza A H1N1 virus (H1N1), Ebola virus (EBOV) and Zika virus (ZIKV) can rapidly evolve their genomic RNA through recombination, thereby producing virus strains that are more virulent or more resistant to treatment than the original strain. After the outbreak of the epidemic, an effective and sensitive detection method is essential for the control of the epidemic. However, the symptoms of SARS-CoV-2 patients are non-specific and cannot be used for accurate diagnosis.

[0007] Currently, there are two main methods for virus detection: nucleic acid detection and antibody detection. Nucleic acid detection is currently the gold standard for virus detection. SARS-CoV-2 has a single-stranded positive RNA genome, with a length of about 30,000 nucleotides. In the SARS-related virus genome, there are three regions with conserved sequences: (1) the RdRP gene (RNA-dependent RNA polymerase gene) in the ORF1ab region; (2) the E gene (envelope protein gene); (3) the N gene (nucleocapsid protein gene). Reverse transcription PCR (RT-PCR) can specifically amplify conserved genes for quantifying the number of viruses. This method is sensitive and reliable, but not without limitations. RT-qPCR requires well-trained personnel, complex equipment, and long operation time, thus limiting its availability in large-scale immediate diagnosis. Reported nucleic acid detection methods include RT-LAMP, RT-RPA, RAMP, RT-RAA, digital PCR (digital PCR), and sequencing. RT-LAMP uses a suitable isothermal reverse transcriptase to reverse transcribe specific sequences of viral RNA into DNA, and then combines isothermal reactions (such as LAMP), which can be used to detect RNA viruses in a single reaction. However, these reverse transcription isothermal amplification methods have some drawbacks, including low specificity, high false positive rate, and difficulty in using these techniques for effective POC diagnosis of pandemics (such as COVID-19). Digital PCR has the characteristics of low sample demand and high sensitivity, but has low throughput, complex operation, and high cost. Sequencing technology plays a very important role in the identification of viruses in the early stages of the epidemic, but this method is extremely time-consuming and requires high professional skills of the operator, and is not suitable for detection. Even if later scholars applied nanopore sequencing technology to COVID-19 detection, it had low accuracy and other technical immaturity factors, so it was not suitable for clinical detection. In addition, a nucleic acid detection method combining LAMP and CRISPR has been developed, which further reduces the detection time of the LAMP method, but this method has similar problems as all nucleic acid detection-based methods, i.e., it cannot avoid the difficulties of nucleic acid extraction and degradation during extraction. In addition to nucleic acid detection, antibody detection is also commonly used. Antibody detection is a detection method for antibodies produced in the human body after infection with a virus. This method is fast and easy to operate, but because the number of antibodies cannot reflect the true situation of viral load, the results are often lagging and cannot accurately reflect the infection situation.

[0008] Compared with antibodies, antigen detection can better reflect the actual number of viruses. However, the existing antigen detection is mostly based on the enzyme-linked immunosorbent assay method for detecting antigens, which has low sensitivity, and there are few antigen detection methods with sensitivity that can meet the requirements of clinical detection. Compared with nucleic acid detection, antigen detection can get rid of the difficulties of nucleic acid extraction and easy degradation. The genome of SARS-CoV-2 encodes 27 proteins, including RNA-dependent RNA polymerase (RdRP) and four structural proteins, namely spike surface glycoprotein (Sp), small envelope protein (Ep), matrix protein (Mp), and nucleocapsid protein (Np). These proteins provide good detection targets for the development of antigen detection. If a highly sensitive antigen detection method can be developed, it will have extraordinary significance for the control of the epidemic.

[0009] Therefore, the inventors upgraded CaT-SMelor 2.0 based on the synergistic effect of multi-target point tandem double-stranded DNA and aptamer, and constructed a sensor platform with higher detection sensitivity for analytes (such as SARS-CoV-2 N protein antigen) - CaT-SMelor 2.1 based on CaT-SMelor 2.0. SUMMARY

[0010] In a first aspect, the present application provides a biosensor for detecting a target analyte, the biosensor comprising a recognition element and a transduction element, wherein,

[0011] The recognition element comprises an aptamer complex fixed on a solid support;

[0012] The transduction element comprises an activated double-stranded DNA (dsDNA) (com-dsDNA) connected with a single-stranded complementary DNA (comDNA) and a CRISPR / Cas12a-reporting system, the CRISPR / Cas12a-reporting system comprising a CRISPR / Cas12a system and a single-stranded DNA (ssDNA) probe,

[0013] The com-dsDNA is connected with the aptamer complex through the comDNA;

[0014] The aptamer complex comprises at least two aptamers capable of specifically recognizing different epitopes of the target analyte, and a dendritic DNA,

[0015] The activated dsDNA has a dsDNA capable of being recognized and cut by the CRISPR / Cas12a system, and the ssDNA probe has a group capable of generating a detectable signal.

[0016] In some embodiments, the aptamer complex is fixed on the solid support through the dendritic DNA.

[0017] In some embodiments, the ssDNA probe is single-stranded DNA with a length of 5-20 nt and a random sequence. The ssDNA probe comprises a pair of fluorescent dyes (e.g., a quencher / fluorophore pair). In some embodiments, the ssDNA probe is modified with a fluorescent group and a quenching group at both ends, respectively.

[0018] In preferred embodiments, the activating dsDNA can have multiple target sites that can be recognized and cleaved by the CRISPR / Cas12a system.

[0019] The analyte can be selected from metal ions, organic dyes, organic small molecules, amino acids, nucleosides and nucleotides, RNA, biological cofactors (e.g., CoA, NMN, FAD, porphyrin, vitamin B12), aminoglycosides, oligosaccharides, polysaccharides, antibiotics (e.g., viomycin, streptomycin, tetracycline, vasopressin), peptides, enzymes, growth factors, transcription factors, antibodies, gene regulatory factors, cell adhesion molecules, viruses, cells, or viral / bacterial components, etc. The analyte is preferably selected from one or more of metal ions, inorganic small molecules, organic small molecules, nucleic acids, proteins, viruses, cells, and the like.

[0020] In a second aspect, the present application provides a kit for detecting a target analyte, the kit comprising the biosensor of the first aspect. In some embodiments, the kit further comprises a detection element for detecting the detectable signal generated by the biosensor.

[0021] In a third aspect, the present application provides a method for detecting a target analyte in a sample, the method comprising: contacting the sample with the biosensor of the first aspect to generate a detectable signal; and measuring the generated detectable signal, thereby detecting the target analyte in the sample.

[0022] In a fourth aspect, the present application provides a composition for detecting a target analyte, the composition comprising a recognition reagent and a transduction reagent, wherein,

[0023] The recognition reagent comprises an aptamer complex immobilized on a solid support;

[0024] The transduction reagent comprises an activating double-stranded DNA (dsDNA) (com-dsDNA) linked to a single-stranded complementary DNA (comDNA) and a CRISPR / Cas12a-reporting system, the CRISPR / Cas12a-reporting system comprising a CRISPR / Cas12a system and a ssDNA probe,

[0025] The com-dsDNA is connected to the aptamer complex through a comDNA;

[0026] The aptamer complex comprises at least two aptamers capable of specifically recognizing different epitopes of the target analyte, and a dendritic DNA,

[0027] The activation dsDNA has a dsDNA capable of being recognized and cut by the CRISPR / Cas12a system, and the ssDNA probe has a group capable of generating a detectable signal.

[0028] In some embodiments, the aptamer complex is immobilized on a solid support through a dendritic DNA.

[0029] In some embodiments, the ssDNA probe comprises a fluorescent dye pair (e.g., a quencher / fluorophore pair).

[0030] In preferred embodiments, the activation dsDNA can have multiple target sites capable of being recognized and cut by the CRISPR / Cas12a system.

[0031] In a fifth aspect, the present application provides a kit for detecting a target analyte, the kit comprising the composition of the fifth aspect.

[0032] In a sixth aspect, the present application provides a method for detecting a target analyte, the method comprising contacting a sample to be tested with the composition of the fifth aspect to generate a detectable signal; and measuring the generated detectable signal, thereby detecting the target analyte.

[0033] In a seventh aspect, the present application provides use of the biosensor of the first aspect, the composition of the fourth aspect, and the kit of the second aspect or the fifth aspect in detecting a target analyte.

[0034] Advantages

[0035] The present application is based on the combination of aptamer and CRISPR / Cas12a-reporter system for detecting target analyte, and further combines the synergistic effect of at least two aptamers capable of specifically binding to the target analyte and multi-target tandem activation of dsDNA, so as to enable high-sensitivity detection of the presence and / or content of the target analyte in the sample. Specifically, after the improved biosensor of the present application is contacted with the analyte, any one of the at least two aptamers captures the target analyte, which exposes other binding epitopes capable of being bound by other aptamers on the dendritic DNA to the vicinity of the corresponding aptamer, thereby promoting the binding of multiple aptamers to the analyte; the binding of the at least two aptamers to the analyte enables the release of more activated DNA than a single aptamer sensor. Further, the present application also adopts multi-target tandem activation of dsDNA, when the multi-target tandem activation of dsDNA is released, as an activator, it forms multiple ternary complexes with Cas12a protein and corresponding gRNA in the CRISPR / Cas12a system, thereby greatly increasing the trans-ssDNA cleavage activity of the CRISPR / Cas12a ternary complex, so that the ssDNA probe is cut and a detectable signal is generated. By measuring the generated detectable signal, the high-sensitivity detection of the presence and / or content of the target analyte is realized. BRIEF DESCRIPTION OF DRAWINGS

[0036] Figure 1 For the embodiments according to the present application, the flowchart of the process of detecting target analyte by the biosensor of the present application is shown.

[0037] Figure 2 For illustration, the detection of nucleocapsid protein antigen by the biosensor based on single A48 aptamer in Example 6.1 is shown. Figure 2 a: schematic diagram of the principle of the biosensor based on single aptamer A48. Figure 2 b: change of fluorescence intensity curve under different concentrations of nucleocapsid protein. Figure 2 c: relationship between nucleocapsid protein concentration and reaction rate.

[0038] Figure 3 For illustration, the detection of nucleocapsid protein antigen by the biosensor based on multi-target tandem activation DNA in Example 6.2 is shown. Figure 3 a: schematic diagram of the detection principle of the multi-target tandem sensor. Figure 3 b: comparison diagram of fluorescence curve slope corresponding to different target numbers. Figure 3 c: linear relationship between the concentration of activator dsDNA01 and dsDNA10 and the reaction rate of CRISPR / Cas12a trans-cleavage activity. Figure 3d: The fluorescence intensity curve changes under different concentrations of nucleocapsid protein detected by multi-target point serial sensor. Figure 3 e: The relationship between the concentration of nucleocapsid protein and the reaction rate detected by the two sensors before and after upgrading.

[0039] Figure 4 The detection of nucleocapsid protein antigen by the sensor based on the synergistic activation of DNA by double aptamers and multi-target point serial activation is shown. Figure 4 a: The detection principle diagram of the synergistic sensor. Figure 4 b: The fluorescence intensity curve changes under different concentrations of nucleocapsid protein detected by the synergistic sensor. Figure 4 c: The relationship between the concentration of nucleocapsid protein and the reaction rate detected by the sensor after upgrading again, and the comparison with the detection results of the previous two sensors.

[0040] Figure 5 The SARS-CoV-2 nucleocapsid protein antigen sample detection analysis diagram according to the embodiment of the present application is shown. (a) The standard curve of detecting SARS-CoV-2 nucleocapsid protein antigen by CaT-SMelor 2.1. (b) The content detection result of SARS-CoV-2 nucleocapsid protein antigen in the sample. DETAILED DESCRIPTION

[0041] The specific embodiments of the present application are described in detail below. It should be understood that the specific embodiments described herein are merely intended to illustrate and explain the present application, and are not intended to limit the present application. The endpoints of the ranges and any values disclosed herein are not limited to the precise values stated. The endpoints of the ranges and the values stated are to be understood as approximations. For numeric ranges, the endpoints of the various ranges, the endpoints of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numeric ranges, which should be considered as specifically disclosed herein.

[0042] The present application activates the transcleavage activity of CRISPR / Cas12a by amplifying dsDNA through multi-target point serial activation, and improves the detection sensitivity of the analyte through the synergistic effect of multi-aptamer.

[0043] Therefore, the present application provides a composition for detecting a target analyte, which comprises a recognition reagent and a transduction reagent, wherein,

[0044] The recognition reagent comprises an aptamer complex fixed on a solid phase carrier;

[0045] The transduction reagent comprises an activated double-stranded DNA (dsDNA) linked to a single-stranded complementary DNA (comDNA) (com-dsDNA) and a CRISPR / Cas12a-reporter system comprising a CRISPR / Cas12a system and a ssDNA probe,

[0046] wherein the com-dsDNA is linked to the aptamer complex via the comDNA;

[0047] wherein the aptamer complex comprises at least two aptamers capable of specifically recognizing different epitopes of the target analyte, and a branched DNA,

[0048] wherein the activated dsDNA has a dsDNA capable of being recognized and cleaved by the CRISPR / Cas12a system, and the ssDNA probe has a group capable of generating a detectable signal.

[0049] Without wishing to be bound by any theory, since aptamers have higher affinity for target analytes than comDNA, when the recognition reagent comprising aptamers is contacted with the target analyte, the aptamers bind to the target analyte and dissociate from the comDNA, thereby releasing the com-dsDNA; the recognition reagent of the present application comprises at least two aptamers, when one of the aptamers captures the target analyte, it is beneficial for the binding of the other aptamers to the analyte, thereby producing a synergistic effect, thereby further increasing the free form of com-dsDNA; the released free form of com-dsDNA acts as an activator to form a ternary complex with the Cas12a protein and the corresponding gRNA in the CRISPR / Cas12a system, thereby activating the trans-ssDNA cleavage activity of the CRISPR / Cas12a protein, so that the ssDNA probe is cleaved and a detectable signal is generated; by measuring the generated detectable signal, the presence and / or content of the target analyte can be detected.

[0050] The present application further employs multi-target serially activated dsDNA, thereby further increasing the trans-ssDNA cleavage activity of the CRISPR / Cas12a ternary complex.

[0051] In an embodiment of the present application, the composition of the present application is in the form of a biosensor.

[0052] Biosensors are generally considered to be a class of devices that analyze biological materials (such as tissues, microbial cells, viruses, organelles, cell receptors, enzymes, antibodies, nucleic acids, etc.) or biological-derived materials or biological-mimetic materials, which are closely combined or linked with physical-chemical sensors or sensing microsystems (which can be optical, electrochemical, thermal, piezoelectric, or magnetic) to generate intermittent or continuous signals (optical signals, electrical signals, etc.), the intensity of which is in a corresponding relationship (for example, linear relationship) with the concentration of the analyzed substance, thereby performing the function of analysis. In the field, biosensors have a general definition, and are generally composed of two parts: a recognition element (also referred to as a molecular recognition element) and a transduction element (also referred to as a transducer). In this document, the term "biosensor" refers to a device or apparatus that contains a recognition element and a transduction element, also referred to as a "biosensing platform". Without being bound by theory, the biosensor described in this document can include an amplification element that further improves the detection sensitivity and / or a detection element that directly performs the detection. In addition, the biosensor described in this document is not limited to a specific form, and any form that contains the recognition element and the transduction element described below is included in the scope of the term "biosensor" in this document.

[0053] Recognition reagent

[0054] In the present application, the recognition reagent contains an aptamer complex immobilized on a solid support.

[0055] In the present application, the aptamer complex contains at least two aptamers capable of specifically binding to a target analyte, and the at least two aptamers are immobilized on a solid support by dendritic DNA.

[0056] The term "aptamer" as used herein has its art-recognized meaning and refers to a short synthetic single-stranded oligonucleotide that is capable of specifically binding to a variety of molecular targets, such as small molecules, proteins, nucleic acids, and even viruses, cells, and tissues. Such single-stranded oligonucleotide molecules can form secondary and tertiary structures that are capable of specifically binding to targets and are essentially chemical equivalents of antibodies. Aptamers are highly specific, relatively small in size, and non-immunogenic. In addition to high specificity, aptamers have very high affinity for their target substances. Typically, aptamers generated against proteins have affinities in the picomolar to low nanomolar range. Aptamers are chemically synthesized, rather than biologically expressed, providing a significant cost advantage. Aptamers are typically selected from a process known as SELEX (systematic evolution of ligands by exponential enrichment) (Ellington et al., Nature. 1990, 346(6287): 818-822; Tuerk et al., Science. 1990, 249(4968): 505-510; Ni et al., Curr Med Chem. 2011, 18(27): 4206-14; incorporated by reference in their entireties). Methods of generating aptamers to any given target are well known in the art. The generation of aptamers is well known in the art. See, e.g., U.S. Patent 5,475,096.

[0057] Aptamers can be formed from deoxynucleotides, which can be natural, non-natural, or modified nucleic acids. Peptide nucleic acids (PNAs) can also be used, which include a polyamide backbone and nucleoside bases (e.g., available from Biosearch, Inc., Bedford, MA). Aptamers can be 15-100 bp in length, more preferably 20-60 bp, and most preferably 20-38 bp. Aptamers can be further selected by in vitro selection, directed evolution, or other methods known to those skilled in the art.

[0058] In the present invention, the aptamer complex comprises at least two aptamers that are capable of specifically binding to different epitopes of an analyte. In specific embodiments, such as in the detection of biological macromolecules, e.g., proteins, the aptamer complex comprises 2-10, preferably 2-5, and most preferably 2-3 aptamers. In specific embodiments for the detection of small molecules (e.g., ions, small organic molecules, etc.), 2 aptamers are most preferred. In specific embodiments for the detection of cells and tissues, 5-10 aptamers are most preferred.

[0059] The screening method of aptamers for different epitopes of the same target analyte can be based on screening methods known in the art, such as the method described in Liyun Zhang et al., Discovery of the Sandwich type COVID-19 Nucleocapsid Protein DNA Aptamers, Chemical Communications 56(70), July 2020.

[0060] In the context of the present application, the term "dendrimer DNA" is a DNA molecule with a dendrimer-like structure formed by annealing three or more single-stranded DNAs together, wherein the single-stranded DNAs used to compose the dendrimer are partially complementary to each other, including but not limited to Y-type dendrimer DNA (dendrimer DNA composed of three single-stranded DNAs, in the shape of Y), X-type dendrimer DNA (dendrimer DNA composed of four single-stranded DNAs, in the shape of X), T-type dendrimer DNA (dendrimer in the shape of T by changing the length of one of the three single-stranded DNAs and the complementary region), and dendrimer DNA with more branches. Methods for assembling such dendrimer DNA are found in, for example, Um, S. et al., Dendrimer-like DNA-based fluorescence nanobarcodes. Nat Protoc 1, 995-1000 (2006).

[0061] Taking Y-type dendrimer DNA composed of three single-stranded DNAs as an example, three single-stranded DNAs, Y1-ssDNA, Y2-ssDNA and Y3-ssDNA, are prepared, wherein Y1-ssDNA is partially complementary to Y2-ssDNA, Y2-ssDNA is partially complementary to Y3-ssDNA, and Y3-ssDNA is partially complementary to Y1-ssDNA. After annealing, Y1-ssDNA, Y2-ssDNA and Y3-ssDNA, which are complementary to each other and expose three sticky ends, can be obtained. Y-type dendrimer DNA with blunt ends can also be prepared. In dendrimer DNA, the length of each branch can be adjusted according to actual needs.

[0062] In embodiments of the present application, one of the branches of the dendrimer DNA is used to be connected to a solid support, and the remaining branches are used to be connected to each aptamer that specifically binds to different epitopes of the target analyte. For example, for Y-type dendrimer DNA or T-type dendrimer DNA, it can be connected to two different aptamers; for X-type dendrimer DNA, it can be connected to three different aptamers.

[0063] In the present application, the oligonucleotide sequence of the aptamer can be directly or indirectly, covalently or non-covalently combined with the dendrimer DNA. In some embodiments, the aptamer is connected to the dendrimer DNA by complementary binding.

[0064] In preferred embodiments, the aptamer is connected to the dendron DNA via a linker. The linker can be adjusted in length as desired to make it easier to adjust the distance between the binding portion of the aptamer and the dendron DNA.

[0065] In preferred embodiments, the aptamer further comprises an additional base sequence at its 3' end and / or 5' end in addition to the binding portion that binds to the target analyte.

[0066] In some embodiments, the additional base sequence is used to provide a spacer between the binding portion of the aptamer that binds to the target analyte and the branch of the linker or dendron DNA to which the aptamer is connected, in order to make the binding of the aptamer to the target analyte better. The additional base sequence can be a sequence of 1-12 bases. In one example, the additional base sequence can be a sequence of 1-8 bases, 2-7 bases, 3-6 bases, 4-5 bases. For example, the additional base sequence can be polyA or polyT, preferably 6-12 bases in length.

[0067] In embodiments where the aptamer is connected to the linker or dendron DNA via complementary binding, the additional base sequence can be used for the function of complementary connection to the linker or dendron DNA, i.e. the additional base sequence comprises a nucleotide sequence that is at least partially complementary to the branch of the linker or dendron DNA. For example, the aptamer comprises an additional base sequence at its 3' end and / or 5' end, which has at least 50% or more (e.g. 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or even 100%) complementarity to the nucleotide sequence of the sticky end of the branch of the linker or dendron DNA. In preferred embodiments, there can be 18-50 bases, preferably 25-30 bases in the additional base sequence that are at least partially complementary to the nucleotide sequence of the branch of the linker or dendron DNA. In preferred embodiments of the present application, the additional base sequence can comprise a spacer and a nucleotide sequence for complementary binding to the branch of the dendron DNA.

[0068] In the present application, the distance between aptamers is one of the key factors that enable synergistic action. If the distance between two or more different aptamers is close, competitive binding rather than synergistic action can occur between the aptamers. If the distance between aptamers is far, after one aptamer captures an analyte, other aptamers cannot well promote the binding of the analyte molecule due to the spatial distance. In this case, the synergistic promotion of the binding of the analyte by multiple aptamers can be achieved by adjusting the length of the branches of the dendritic DNA, or the additional base sequence at the 3' end and / or 5' end of the aptamer, according to the size of the target analyte to be measured, etc. For example, the distance of the aptamer to the center intersection of the dendritic DNA can be adjusted or extended to enable synergistic action between different aptamers on the branches, typically 30-200 bases.

[0069] For example, taking a protein analyte with a molecular weight size of about 50 kDa as an example, the length of the binding portion of the aptamer to the center intersection of the dendritic DNA is preferably about 90-100 bases. That is, the length of the spacer region in the aptamer and the branches of the dendritic DNA is about 90-100 bases. Taking the N protein (46.6 kDa) of the novel coronavirus SARS-CoV-2 as an example, the length of the binding portion of the aptamer to the center intersection of the dendritic DNA is preferably 90 bases. In a more specific embodiment, when the branch length of the Y-shaped dendritic DNA is 18 bases, the linker and / or the spacer region can be about 72 bases in total.

[0070] In some embodiments, the branch length in the dendritic DNA can be 15-50 bases, preferably 18-25, 18-20 bases.

[0071] In the present application, the aptamer complex is immobilized on a solid support to facilitate separation from the released free com-dsDNA. In the present application, any solid phase carrier that can be suitable for the immobilization of DNA and does not react with other components of the recognition reagent and transducer reagent of the present application can be used. Examples of solid phase carriers include, but are not limited to, nitrocellulose membranes or nylon membranes, affinity column chromatography matrix, magnetic beads, gold nanoparticles, gold nanorods, well plates, microfluidic devices, test paper, silver nanoparticles, solid fillers, microcrystalline cellulose, or commercially available nucleic acid immobilization media, etc. In a preferred embodiment, the solid phase carrier can be a magnetic bead.

[0072] The skilled person in the art usually immobilizes the elements that need to be immobilized on a carrier by immobilization techniques, such as adsorption, covalent bonding, physical entrapment, and cross-linking, etc. methods commonly used in the art. The immobilization can be covalent or non-covalent linkage, including but not limited to biotin-streptavidin affinity fixation, thiol-nanogold fixation, DNA complementary pairing fixation, DNA enzyme fixation, chemical modification fixation.

[0073] In some preferred embodiments, the aptamer complex can be immobilized on the magnetic beads through one or two branches of the branched DNA. In some preferred embodiments, the branches of the branched DNA can be immobilized on the solid phase carrier by indirect means, for example, through the biotin-streptavidin system. For example, the end of the branch of the branched DNA is combined with biotin, and the branched DNA combined with biotin is further attached to the magnetic beads combined with streptavidin.

[0074] Table 1 lists a variety of effector molecules and their aptamers. The skilled person in the art can understand that the aptamers used in the present application are not limited to those listed. In addition, one or more bases of the listed aptamer DNA sequences can be replaced, deleted, or added with one or more bases, so as to change the binding strength of the aptamer DNA sequence and the effector molecule.

[0075] Table 1: Exemplary molecular analytes and aptamer sequences that interact with them

[0076]

[0077]

[0078]

[0079] Transduction reagent

[0080] The transduction reagent comprises an activated double-stranded DNA (dsDNA) (com-dsDNA) connected with a single-stranded complementary DNA (comDNA) and a CRISPR / Cas12a-reporter system.

[0081] In the present application, the term "comDNA" refers to a single-stranded oligonucleotide sequence that can be complementarily combined with the aptamer in the aptamer complex, and can be separated from the aptamer after the aptamer binds to the target analyte. That is, the affinity of the aptamer to the analyte is higher than the binding affinity of the aptamer to the comDNA. Therefore, the comDNA can be complementarily combined with the aptamer complex, thereby forming a branched DNA-aptamer-comDNA-activated dsDNA complex.

[0082] In some embodiments of the present application, the comDNA can have a length of 5-20 bases, preferably 7-15 bases, more preferably 8-13 bases. Since the noise in the present application mainly comes from the non-covalent binding between the aptamer and the comDNA, and there is a possibility of falling off, therefore, by increasing the length of the binding sequence to enhance the binding force between the aptamer and the comDNA, or by multiple washing to reduce the amount of background binding, both of which can effectively reduce the noise. In addition, under certain noise conditions, increasing the specific binding of the target molecule to the aptamer makes it easier for the comDNA to fall off due to the conformational change of the aptamer, which can improve the signal strength. The selection of such comDNA can be screened by a person skilled in the art based on the specific aptamer used, for example, by referring to the method described in Structure-Switching Signaling Aptamers, J. AM. CHEM. SOC. 2003, 125, 4771-4778.

[0083] In some embodiments of the present application, the sequence of the comDNA partially complementary to the aptamer has an annealing temperature of 35-45°C, preferably about 40°C, for example, the sequence of the comDNA partially complementary to the aptamer is a nucleotide sequence of about 7-18 bp, preferably about 11-14 bp, when the GC content is 55%. A person skilled in the art can screen or modify a plurality of comDNA to select a comDNA with the highest signal-to-noise ratio.

[0084] In some embodiments, the comDNA is complementary to 8-16 bp at one end of the aptamer.

[0085] In some embodiments, the aptamer further comprises an additional base sequence for complementary binding to the comDNA. That is, the comDNA can be complementary to only the binding portion of the aptamer, or can be complementary to the binding portion of the aptamer and the additional base sequence of the aptamer. In one example, the additional base sequence for complementary binding to the comDNA in the aptamer can be a sequence of 5-18 bases, 6-18 bases, 6-14 bases, 6-12 bases, 6-11 bases, 10-16 bases, 11-14 bases. For example, the additional base sequence can preferably comprise polyA or polyT, preferably 6-12 bases in length.

[0086] In some embodiments, the additional base sequence for complementary binding to the comDNA in the aptamer can comprise a sequence selected from the group consisting of a sequence having a G+C content of about 55% and an annealing temperature of about 40°C with 5-10 bases closest to one end of the binding portion of the aptamer.

[0087] For activated double-stranded DNA (dsDNA) linked with single-stranded complementary DNA (comDNA), one skilled in the art knows how to prepare and obtain single-stranded DNA at one end of double-stranded DNA. For example, such comDNA can be easily linked with activated double-stranded DNA or directly obtained com-dsDNA by using techniques such as amplification inhibitors, enzyme digestion, hybridization, long-chain primer synthesis, etc. In a specific embodiment, a long single-stranded nucleic acid and a short single-stranded nucleic acid are synthesized and annealed to obtain; or, using modified primer PCR, in which the forward primer has a C3 spacer modification and the reverse primer does not have the modification, and then PCR amplification is obtained, for example, see the method described in Huan Xu et al., An ultraportable and versatile point-of-care DNA testing platform, Science Advances 22 Apr 2020: Vol. 6, no. 17, eaaz7445; or, after denaturing gel electrophoresis, the target single-stranded sequence is recovered from the gel and then annealed to obtain.

[0088] In some embodiments, the comDNA comprises a base sequence at its 3' end and / or 5' end for complementary connection with activated dsDNA, which can be a sequence of 15-50 bases, for example, a sequence of 15-35 bases, 20-35 bases, 25-35 bases, or 30-35 bases.

[0089] For CRISPR / Cas12a-reporter system, the relevant reports have been made in the art. For example, the system and method described in detail in WO2019 / 104058, which is incorporated herein by reference in its entirety.

[0090] Such CRISPR / Cas12a-reporter systems mainly utilize the following principle: upon activation by detecting the target DNA, a V-type CRISPR / Cas protein (e.g., Cas12 protein, such as Cpf1 (Cas12a) and C2c1 (Cas12b)) will promiscuously cleave non-targeted single-stranded DNA (ssDNA). Upon activation of a V-type CRISPR / Cas effector protein (e.g., Cas12 protein, such as Cas12a, Cas12b, Cas12c, Cas12d, Cas12e) by a guide RNA (also known as gRNA) (which occurs when the sample contains the target DNA hybridized to the guide RNA, i.e., the sample contains the targeted DNA), the protein becomes a nuclease that promiscuously cleaves ssDNA (i.e., non-target ssDNA, i.e., ssDNA to which the guide sequence of the guide RNA does not hybridize). Thus, when the targeted DNA (double-stranded or single-stranded) is present in the sample, cleavage of ssDNA in the sample is induced, which can be detected using any convenient detection method (e.g., using a labeled single-strand detector DNA).

[0091] In this context, mainly the CRISPR / Cas12a system is utilized, which only requires crRNA guide and does not require tracrRNA. When the effector protein Cas12a in the CRISPR / Cas12a system cleaves the DNA double strand (dsDNA, which contains the sequence complementary to the crRNA is recognized by the crRNA) of the specific sequence targeted and is thus activated by the double-stranded DNA of the specific sequence (as the activating dsDNA herein), it forms a CRISPR / Cas / dsDNA ternary complex with the gRNA and the activating dsDNA, and can cleave any single-stranded DNA (ssDNA).

[0092] In some cases, such ssDNA that can be used for detection contains a pair of fluorescent dyes (e.g., a quencher / fluorophore pair). The preparation of such ssDNA probes, as well as the detection method, can be selected by those skilled in the art based on the needs and can be commercially available.

[0093] Since the CRISPR / Cas12a system in the present application is mainly used as a reporter system, there is no restriction on the design of the activating dsDNA and the gRNA, as long as it can be recognized and cleaved by the CRISPR / Cas12a system. As for the design of the activating dsDNA and the corresponding gRNA, online tools can be used for design or known or commonly known activating dsDNA and corresponding gRNA can be used.

[0094] In the present application, "probe", "DNA probe" or "ssDNA probe" are used interchangeably, which has any nucleotide sequence capable of being cleaved by CRISPR / Cas12a system. For example, the length of ssDNA in the ssDNA probe can be about 5-25 bp, preferably about 20 bp.

[0095] In a preferred embodiment of the present application, the activating dsDNA has multiple recognition and cleavage target sites in tandem, for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more target sites. In order to make more effective use of the activating dsDNA, the protospacer adjacent motif (PAM) is arranged at an interval of at least about 50 bp (e.g., at least 60 bp, at least 70 bp, at least 80 bp or more). For the activating dsDNA with multiple target sites in tandem, the PAM and the protospacer sequence therein can be the same or different, which is not particularly limited herein. Therefore, in a preferred embodiment of the present application, the length of the activating dsDNA is preferably 500-2000 bp, more preferably 500-3000 bp, most preferably 600-700 bp.

[0096] In some embodiments, the length of PAM is preferably 4 bp. The PAM sequence is not limited to the PAM present in the natural system. It is known in the art to select a few candidate sequences by random or directional mutation of the action site sequence, and to verify the binding ability of PAM to CRISPR / Cas12a in combination with computer simulation.

[0097] In some embodiments, the activating dsDNA further comprises a single-stranded portion complementary to the comDNA portion, and the length of the single-stranded portion is preferably 16-60 bp, for example, 15-50 bp, 15-35 bp, 18-35 bp, 20-35 bp, 18-30 bp, 19-21 bp, 20-25 bp, 25-35 bp or 30-35 bp.

[0098] In some embodiments of the present application, the site on the comDNA for connecting with the aptamer and the site for connecting with the activating dsDNA can be preferably separated by several nucleotides, for example, can be separated by 6-15 bp.

[0099] In some embodiments, the comDNA-activating dsDNA complex can be prepared by obtaining single-stranded comDNA, two single strands of the activating dsDNA separately, and then annealing them together, one of the single strands of the activating dsDNA having a sequence complementary to the comDNA. For example, oligonucleotides comDNA-F, dsDNA-F, and dsDNA-R are mixed in a ratio of 1:1:1 in 1x PBS buffer, and then the DNA solution is incubated at 95 °C for 5 min, and then gradually cooled (2 °C / min) to room temperature; wherein the dsDNA-R further comprises a 19-21 bp sequence complementary to comDNA-F. In some embodiments, the comDNA-activating dsDNA complex is prepared by ligating the activating dsDNA and the comDNA via a ligase. The aptamer-activating dsDNA can also be prepared by other means known in the art.

[0100] “Complementary” means that a nucleic acid (e.g., RNA, DNA) comprises a sequence of nucleotides that enables the nucleic acid to non-covalently bind (i.e., form Watson-Crick base pairs and / or G / U base pairs), “anneal” or “hybridize” to another nucleic acid in a sequence-specific, antiparallel fashion (i.e., the nucleic acid specifically binds to a complementary nucleic acid) under appropriate conditions of temperature and ionic strength of the solution, in vitro and / or in vivo. Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. Conditions suitable for hybridization between two nucleic acids depend on the length and degree of complementarity of the nucleic acids, which are well-known variables in the art. It is understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of a target nucleic acid to which it can specifically hybridize. Moreover, a polynucleotide can hybridize over one or more segments, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure, a “bulge,” etc.). A polynucleotide can comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target region within the sequence of a target nucleic acid to which it will hybridize. Accordingly, “complementary binding” in the present invention refers to binding to a target sequence having 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity.

[0101] The terms "polynucleotide" and "nucleic acid," which are used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, the terms "polynucleotide" and "nucleic acid" encompass single-stranded DNA; double-stranded DNA; multi-stranded DNA; single-stranded RNA; double-stranded RNA; multi-stranded RNA; genomic DNA; cDNA; DNA-RNA hybrids; and polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.

[0102] The term "oligonucleotide" refers to a polynucleotide of single- or double- stranded DNA (e.g., DNA, RNA, or modified nucleic acid) between 4 and 100 nucleotides. However, for the purposes of the present disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides can be isolated from genes, transcribed (in vitro and / or in vivo), or chemically synthesized.

[0103] In some embodiments, in the recognition reagent and transduction reagent, there are further included buffers, enzyme inhibitors, preservatives, antibacterial agents, additional stabilizers, etc. that are suitable for the preservation and / or reaction of the respective components therein.

[0104] Biosensor

[0105] In embodiments of the present application, the composition can be in the form of a biosensor. Thus, when in the context of a biosensor, the components relating to the recognition reagent and the transduction reagent can be referred to as "recognition elements" and "transduction elements."

[0106] Without being bound by a particular theory, other elements of the present application, such as the transducing elements or detection elements described below, can also be immobilized on a medium, which can be modified or improved by those skilled in the art as needed, and such modifications or improvements are also included in the scope of the present application. The term "medium" refers to a substance that supports and provides a reaction space for each element so as to facilitate carrying, transporting, packaging or handling. Those skilled in the art immobilize the elements that need to be immobilized on the medium usually by immobilization techniques, such as adsorption, covalent bonding, physical embedding and cross-linking, etc. The immobilization can be covalent or non-covalent linkage, including but not limited to biotin-streptavidin affinity immobilization, thiol-nanogold immobilization, DNA complementary pairing immobilization, DNA enzyme connection immobilization, chemical modification immobilization. Examples of the medium include but are not limited to nitrocellulose membrane or nylon membrane, affinity column chromatography matrix, magnetic beads, nanogold particles, nanogold rods, well plates, microfluidic devices, test papers, nanosilver, solid fillers, microcrystalline cellulose, or commercially available nucleic acid immobilization medium, etc. In a preferred embodiment, the medium is magnetic beads. In some preferred embodiments, the recognition element of the present application comprises a dendrimer DNA that can be immobilized on magnetic beads. In further preferred embodiments, the dendrimer DNA that can be immobilized on magnetic beads is biotin-labeled dendrimer DNA, which interacts with streptavidin on streptavidin-labeled magnetic beads to immobilize the dendrimer DNA on the magnetic beads.

[0107] In preferred embodiments, the biosensor according to the present application can further comprise a detection element. In the present application, the measurement of the above-mentioned detectable signal by various detection devices is well known to those skilled in the art.

[0108] Sample

[0109] In the present application, the analyte to be detected is a target molecule that can be specifically bound by an aptamer. The effector can be an ion, a small molecule, a protein, a virus, a cell, or a tissue. In general, a small molecule is characterized by a molecular weight greater than about 50 daltons but less than about 200,000 daltons (200 kD). In the present application, a small molecule can be, for example, an environmental indicator, a disease indicator, or a health indicator, including but not limited to heavy metal ions, toxins, drugs, metabolites, pollutants, or breakdown products of the above, etc. The small molecule can be present in the environment or of bacterial, fungal, plant, or animal origin, or artificially synthesized. For an effector analyte for which no corresponding aptamer exists, one skilled in the art can select it by a method of bio-panning called SELEX (Systematic Evolution of Ligands by Exponential Enrichment) (Nature. 1990, 346(6287): 818-822; Science. 1990, 249(4968): 505-510; Curr Med Chem. 2011, 18(27): 4206-14).

[0110] In the present application, the target molecule to be detected can be present in any liquid sample or a solid sample that can be converted into a liquid sample by appropriate manipulation. The sample can be an environmental sample, such as a sample of groundwater, reclaimed water, seawater, waste water, mining waste. Alternatively, the sample can be a biological sample, particularly a sample from a subject, such as one or more of the following: blood, serum, plasma, sputum, cerebrospinal fluid, urine, tears, alveolar lavage, pleural fluid, cyst fluid, tissue, saliva. The sample can also be from food, drinking water, cosmetics, or feed.

[0111] In some embodiments, the sample can be pre-processed to enrich and extract the molecule to be detected, or to remove impurities that can interfere with the detection. For example, the pre-processing can be performed by centrifugation, filtration, sonication, homogenization, heating, freezing, thawing, mechanical treatment, or a combination of various manipulation methods, and / or by adding pre-processing reagents. One skilled in the art is aware of common pre-processing methods and pre-processing reagents for a particular sample. For example, common pre-processing reagents include surfactants and detergents, salts, cell lysing agents, anticoagulants, degrading enzymes (e.g., proteases, lipases, nucleases, lipases, collagenases, cellulases, amylases, etc.), and solutions (e.g., buffers), etc.

[0112] In some embodiments, the compositions and biosensors of the present application can be used for the detection of viruses. For example, the compositions and biosensors according to the present application can be used for the detection of nucleic acids (e.g., DNA, RNA, or hybrids thereof), envelope proteins, and nucleocapsid proteins of viruses.

[0113] In some embodiments, the compositions and biosensors according to the present application can be used to detect nucleic acids (e.g., RNA), envelope proteins, and nucleocapsid proteins in human immunodeficiency virus (HIV), severe acute respiratory syndrome coronavirus (SARS-CoV), Middle East respiratory syndrome coronavirus (MERS-CoV), influenza A H1N1 virus (H1N1), Ebola virus (EBOV), Zika virus (ZIKV), and novel coronavirus (SARS-CoV-2).

[0114] In preferred embodiments, the compositions and biosensors according to the present application can be used to detect one or more of RNA-dependent RNA polymerase (RdRP) and structural proteins (including spike surface glycoprotein (Sp), small envelope protein (Ep), matrix protein (Mp), and nucleocapsid protein (Np)) in SARS-CoV-2.

[0115] Advantageously, the present application can be used to detect the nucleocapsid protein Np of SARS-CoV-2. In the art, aptamers against the nucleocapsid protein Np of SARS-CoV-2 have been reported (see Zhang L, Fang X, Liu X, Ou H, Zhang H, Wang J, Li Q, Cheng H, Zhang W, Luo Z. Discovery of sandwich type COVID-19 nucleocapsid protein DNA aptamers. Chem Commun (Camb). 2020 Sep 11;56(70):10235-10238. for specific aptamer information, see Table 1). Since the sequence of this protein is publicly available, one skilled in the art can also screen aptamers against it based on the prior art.

[0116] In some embodiments, the aptamer against the nucleocapsid protein Np of SARS-CoV-2 can be selected from the following: A48 (SEQ ID NO: 4); A58 (SEQ ID NO: 79); A15 (SEQ ID NO: 80); and A61 (SEQ ID NO: 5).

[0117] In the present application, to provide a suitable signal-to-noise ratio, the aptamer can be modified, for example, additional base sequences can be added at the 3’ end and / or 5’ end of the aptamer to adjust its equilibrium dissociation constant Kd D with the comDNA. Preferably, the binding of the aptamer to the analyte weakens its binding affinity to the comDNA (i.e., the binding of the analyte causes the comDNA to dissociate from the aptamer).

[0118] In the context of the nucleocapsid protein Np of SARS-CoV-2, the aptamer A48 and the aptamer A61 can be used. In preferred embodiments, modified aptamers derived from the aptamer A48 or the aptamer A61 can also be used.

[0119] In some embodiments, when the aptamer is the SARS-CoV-2 nucleocapsid protein aptamer A48 and A61 or their modified aptamers, the branch length of the dendritic DNA can be selected from 15-50 bases, preferably 18-25 bases.

[0120] The biosensor, composition, kit and method of the present application can be used for diagnostic or non-diagnostic purposes, or non-clinical purposes, such as for environmental pollution monitoring, food and cosmetic quality control and disease diagnosis.

[0121] Detection method

[0122] In embodiments of the present application, a method for detecting a target analyte in a sample using the biosensor of the present application or the composition of the present application. In the present application, the target analyte in the sample can be detected qualitatively or quantitatively.

[0123] The present application provides a method for detecting a target analyte in a sample to be tested, the method comprising:

[0124] mixing and incubating the sample to be tested with an aptamer complex and a com-dsDNA, wherein the com-dsDNA is pre-complementary linked with the aptamer complex; separating the free com-dsDNA from the resulting mixture; contacting the separated free com-dsDNA with a CRISPR / Cas12a-reporter system, thereby generating a detectable signal; and determining the presence or content of the target analyte in the sample based on the generated detectable signal.

[0125] In one aspect, the present application provides a method for detecting a target analyte in a sample to be tested, the method comprising:

[0126] (1) mixing and incubating the sample to be tested with a complex consisting of an aptamer complex and a com-dsDNA;

[0127] (2) separating the free com-dsDNA from the mixture in step (1);

[0128] (3) adding a CRISPR / Cas12a protein, a gRNA and a ssDNA probe to the separated free com-dsDNA in step (2), and detecting the generated detectable signal; and

[0129] (4) analyzing the presence or content of the target analyte based on the generated signal.

[0130] The specific conditions for mixing and incubation in step (1) can be selected by those skilled in the art according to actual needs, as long as the stable existence of each component and the specific analyte in the sample to be tested can be fully combined with the aptamer, for example, the reaction is more than 8 min at room temperature, for example, 8-60 min (such as 10 min, 15 min, etc., but not limited to).

[0131] In an embodiment of the present application, the affinity of the aptamer to the target analyte is greater than its affinity to the comDNA, and when the sample to be tested is added, the com-dsDNA is separated from the aptamer to become free com-dsDNA.

[0132] In a preferred embodiment, the aptamer complex can be fixed on a solid phase carrier. For example, when the aptamer complex is a biotin-labeled aptamer complex, the solid phase carrier can be a streptavidin-labeled magnetic bead. Preferably, before adding the sample to be tested and the comDNA-activated dsDNA, the dendrimer DNA-aptamer is pre-bound to the solid phase carrier, and the aptamer complex is fixed on the solid phase carrier, which is convenient for subsequent operation. For example, commercially available solid phase carriers (such as Beaver Beads TM The streptavidin is mixed and incubated with the dendrimer DNA (such as biotin-labeled dendrimer DNA) modified to be fixed on the solid phase carrier, and the specific conditions for mixing and incubation can be selected by those skilled in the art according to actual needs, as long as the dendrimer DNA-aptamer that can be fixed on the solid phase carrier can be fully fixed on the solid phase carrier, for example, the reaction is 10-40 min at room temperature (but not limited to). Preferably, before adding the sample to be tested and the aptamer-activated dsDNA complex, the un-fixed dendrimer DNA-aptamer is removed to improve the signal-to-noise ratio.

[0133] The method for forming a dendrimer DNA-aptamer-comDNA-activated dsDNA complex by the aptamer complex and the aptamer comDNA-activated dsDNA can use any method suitable for the complementary binding of the two, and those skilled in the art can select according to the relevant information of the complementary sequence. For example, fully mixed for 30 minutes at room temperature.

[0134] The method for separating the free com-dsDNA in step (2) is well known in the art, for example including but not limited to centrifugation, sedimentation, magnetic beads, chromatography, affinity column, etc. The person skilled in the art can select the specific separation method and parameters according to the actual situation, which does not limit the present application. In the embodiment in which the dendrimer DNA is a dendrimer DNA that can be immobilized on a solid phase medium, the free com-dsDNA fragments can be separated by filtration, centrifugation or magnetic adsorption, which is simple, time-saving and cost-saving, and is economically feasible.

[0135] In step (3), the generated signal is detected by using the methods and instruments commonly used in the art to detect signals. For example, when the generated signal is a fluorescence signal, an enzyme label instrument is used to measure. It should be pointed out that when the sample or target molecule to be detected is qualitatively analyzed, the color change generated (as described above, including in the range of "absorption light signal") can not be quantitatively analyzed, but only colorimetric analysis, which is also within the scope of the present application.

[0136] In step (4), the generated signal can be analyzed based on a reference level to detect the presence or content of the target molecule. The "reference level" is used interchangeably with "reference sample" and "reference level" in the present application, which refers to a control condition. For example, in the context of qualitative detection of the target molecule (detecting the presence or absence), the reference level can be the level of a sample containing no target molecule. In the context of quantitative detection of the target molecule (detecting the content), the reference level can be the level of a sample containing a known amount of target molecule. For the determination of the presence and content of the sample containing the target molecule, the reference level is a reference value, which can normalize the sample to the appropriate standard to infer the presence, absence or content of the target molecule in the sample. In some embodiments, the reference level can be a previously determined level, for example, a predetermined amount or ratio, without the need to determine it in the same physical iteration of the detection method described herein.

[0137] In the present application, the sample and the reagent can be in the form of a solution, as long as it does not affect the binding of the dendrimer DNA-aptamer complex to the com-dsDNA / effector and the cleavage of CRISPR / Cas12a. The person skilled in the art can select or adjust it according to the actual application or demand.

[0138] In the present application, "room temperature" refers to a temperature of 10°C to 40°C, for example 25°C to 30°C.

[0139] Measuring a detectable signal

[0140] In the present application, the detection of the above-mentioned detectable signal by various detection devices is well known to those skilled in the art.

[0141] In some embodiments, the signal comprises a fluorescent signal or an absorbance signal. It is understood by those skilled in the art that in order to quantify the color change occurring in the analysis, the absorbance intensity is usually detected after excitation by light of a specific wavelength. Therefore, in the present application, the term "absorbance signal" can also refer to the color change generated (colorimetric analysis). In some embodiments, the probe can carry a label so as to generate a detectable light signal after being cleaved by CRISPR / Cas. Examples of labels include, but are not limited to, luminescent organic compounds (such as fluorescein, carotene), luminescent inorganic compounds (for example, chemical dyes), fluorophores (such as FAM fluorophore), etc.; nanoparticles and quantum dots, etc.; or chromophores, etc. The techniques for labeling nucleic acid sequences with the above-mentioned substances so as to generate a detectable light signal are well known to those skilled in the art, and can be selected and improved according to actual needs, which does not limit the present application. In some preferred embodiments, the light signal is a fluorescent signal. In further preferred embodiments, the label is a fluorophore and a quencher, which are respectively labeled at the two ends (3' end or 5' end) of the probe.

[0142] Kit

[0143] In another aspect, the present application also provides a kit for detecting a target molecule, which comprises the reagent of the present application and a detection reagent. In the present application, the detection reagent refers to a reagent for detecting the light signal generated by using the reagent of the present application. In some embodiments, the detection reagent is used for analyzing the light signal generated by the DNA probe by fluorescence analysis or absorbance analysis (including colorimetric analysis), so as to obtain a qualitative or quantitative detection result of the target molecule.

[0144] In some embodiments, the kit of the present application further comprises a delivery tool or device (such as a pipette) for detecting the target molecule by using the biosensor and / or reagent of the present application, a washing buffer, a dilution buffer, a termination buffer (for example, for terminating color development), a microtiter plate (for example, 98-well or 384-well, for performing reactions and detection), one or more containers, a data carrier (such as an instruction manual or a computer readable medium) recording the instructions for use, a standard sample (for example, a sample containing a known amount of target molecule), and combinations thereof, etc.

[0145] Embodiments of the aspects described herein can be explained by the following numbered paragraphs:

[0146] 1. A composition for detecting a target analyte, the composition comprising a recognition reagent and a transduction reagent, wherein,

[0147] The recognition reagent comprises an aptamer complex immobilized on a solid support;

[0148] The transduction reagent comprises an activated double-stranded DNA (dsDNA) linked to a single-stranded complementary DNA (comDNA) and a CRISPR / Cas12a-reporter system, the CRISPR / Cas12a-reporter system comprising a CRISPR / Cas12a system and a ssDNA probe,

[0149] Wherein the com-dsDNA is linked to the aptamer complex through the comDNA;

[0150] Wherein the aptamer complex comprises at least two aptamers capable of specifically recognizing different epitopes of the target analyte, and a branched DNA,

[0151] Wherein the activated dsDNA has a dsDNA capable of being recognized and cleaved by the CRISPR / Cas12a system, and the ssDNA probe has a group capable of generating a detectable signal.

[0152] 2. The composition of paragraph 1, wherein the at least two aptamers are immobilized on a solid support by the branched DNA.

[0153] 3. The composition of paragraph 1 or 2, wherein the aptamer complex comprises 2-10, preferably 2-5, most preferably 2-3 aptamers.

[0154] 4. The composition of any one of paragraphs 1-3, wherein the branched DNA comprises 3 or more branches, preferably 3, 4, or 5 branches.

[0155] 5. The composition of any one of paragraphs 1-4, wherein the branched DNA is selected from the group consisting of Y-type branched DNA, X-type branched DNA, and T-type branched DNA.

[0156] 6. The composition of any one of paragraphs 1-5, wherein the aptamer is directly or indirectly, covalently or non-covalently bound to the branched DNA.

[0157] 7. The composition of any one of paragraphs 1-6, wherein the aptamer is linked to the branched DNA by a linker.

[0158] 8. The composition of any one of paragraphs 1-7, wherein the aptamer comprises a binding moiety that binds to the target analyte and an additional base sequence.

[0159] 9. The composition of paragraph 8, wherein the additional base sequence is for binding to the branch of the dendrimer DNA or the linker and / or for providing a spacer region between the branch of the dendrimer DNA and the binding portion of the adaptor that binds to the target analyte.

[0160] 10. The composition of paragraph 8, wherein the additional base sequence is a sequence of 1-12 bases.

[0161] 11. The composition of any one of paragraphs 8-10, wherein the additional base sequence comprises a polyA or polyT, preferably 6-12 bases in length.

[0162] 12. The composition of paragraph 4, wherein the branch in the dendrimer DNA is 15-50 bases in length, preferably 18-25 bases in length.

[0163] 13. The composition of paragraph 1, wherein the solid phase carrier is a magnetic bead.

[0164] 14. The composition of any one of paragraphs 1-13, wherein the comDNA is 5-20 bases in length, preferably 7-15 bases in length, more preferably 8-13 bases in length.

[0165] 15. The composition of any one of paragraphs 1-14, wherein the sequence of the comDNA that is complementary to the adaptor has an annealing temperature of 35-45°C, preferably about 40°C, to the adaptor.

[0166] 16. The composition of any one of paragraphs 1-15, wherein the sequence of the comDNA that is complementary to the adaptor is about 7-18 bp, preferably about 11-14 bp, of nucleotides at a GC content of 55%.

[0167] 17. The composition of any one of paragraphs 1-16, wherein the comDNA is complementary to 8-16 bp at one end of the adaptor.

[0168] 18. The composition of paragraph 8, wherein the additional base sequence is for complementary binding to the comDNA.

[0169] 19. The composition of paragraph 18, wherein the comDNA is complementary to the binding portion of the adaptor or is complementary to the binding portion of the adaptor and the additional base sequence of the adaptor.

[0170] 20. The composition of paragraph 18 or 19, wherein the additional base sequence for complementary binding to the comDNA in the aptamer is a sequence of 5-18 bases, 6-18 bases, 6-14 bases, 6-12 bases, 6-11 bases, 10-16 bases, 11-14 bases.

[0171] 21. The composition of paragraph 18 or 19, wherein the additional base sequence for complementary binding to the comDNA in the aptamer comprises a polyA or polyT, preferably 6-12 bases in length.

[0172] 22. The composition of any one of paragraphs 1-21, wherein the comDNA comprises a base sequence for complementary ligation to the activating dsDNA at its 3’ end and / or 5’ end, which can be a sequence of 15-50 bases, for example, 15-35 bases, 20-35 bases, 25-35 bases, or 30-35 bases.

[0173] 23. The composition of any one of paragraphs 1-22, wherein the ssDNA probe comprises a pair of fluorescent emitting dyes.

[0174] 24. The composition of any one of paragraphs 1-23, wherein the activating dsDNA has multiple recognition and cleavage target sites in tandem, for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more target sites.

[0175] 25. The composition of paragraph 24, wherein the protospacer adjacent motif (PAM) is disposed at intervals of at least about 50 bp in the activating dsDNA.

[0176] 26. The composition of paragraph 24 or 25, wherein for the activating dsDNA with multiple target sites in tandem, the PAM and the protospacer sequence are the same or different.

[0177] 27. The composition of any one of paragraphs 1-26, wherein the activating dsDNA is 500-2000 bp in length, more preferably 500-3000 bp, most preferably 600-700 bp.

[0178] 28. The composition of any one of paragraphs 1-27, wherein the activating dsDNA further comprises a single-stranded portion that is complementary to the comDNA, wherein the single-stranded portion is preferably 16-60 bp in length, for example, 15-50 bp, 15-35 bp, 18-35 bp, 20-35 bp, 18-30 bp, 19-21 bp, 20-25 bp, 25-35 bp, or 30-35 bp.

[0179] 29. The composition of any of paragraphs 1-28, wherein the site on the comDNA for ligation to an aptamer and the site for ligation to an activating dsDNA are spaced 6-15 bp apart.

[0180] 30. The composition of any of paragraphs 1-29, wherein the composition is used for detection of a virus.

[0181] 31. The composition of paragraph 30, wherein the composition is used for detection of nucleic acid (e.g., DNA, RNA, or a hybrid thereof), envelope protein, and nucleocapsid protein of a virus.

[0182] 32. The composition of paragraph 30 or 31, wherein the composition is used for detection of nucleic acid (e.g., RNA), envelope protein, and nucleocapsid protein in Human Immunodeficiency Virus (HIV), Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV), Middle East Respiratory Syndrome Coronavirus (MERS-CoV), Influenza A H1N1 virus (H1N1), Ebola virus (EBOV), Zika virus (ZIKV), and Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2).

[0183] 33. The composition of any of paragraphs 30-32, wherein the composition is used for detection of one or more of RNA-dependent RNA polymerase (RdRP) and structural proteins (including Spike surface glycoprotein (Sp), Small envelope protein (Ep), Matrix protein (Mp), and Nucleocapsid protein (Np)) in SARS-CoV-2.

[0184] 34. The composition of paragraph 33, wherein the aptamer to the nucleocapsid protein Np of SARS-CoV-2 is selected from the following: A48 (SEQ ID NO: 4); A58 (SEQ ID NO: 79); A15 (SEQ ID NO: 80); and A61 (SEQ ID NO: 5), or a variant thereof.

[0185] 35. The composition of any of paragraphs 1-34, wherein the composition of the present application is in the form of a biosensor.

[0186] 36. A method of detecting a target analyte in a sample to be tested, the method comprising:

[0187] mixing and incubating the sample to be tested with the aptamer complex and the com-dsDNA, wherein the com-dsDNA is pre-complementary linked with the aptamer complex; separating the free com-dsDNA from the resulting mixture; contacting the separated free com-dsDNA with the CRISPR / Cas12a-reporter system, thereby generating a detectable signal; and determining the presence or amount of the target analyte in the sample based on the generated detectable signal.

[0188] 37. The method of paragraph 36, wherein the method comprises:

[0189] (1) mixing and incubating the sample to be tested with the complex consisting of the aptamer complex and the com-dsDNA;

[0190] (2) separating the free com-dsDNA from the mixture in step (1);

[0191] (3) adding the CRISPR / Cas12a protein, the gRNA and the ssDNA probe to the separated free com-dsDNA in step (2), and detecting the generated detectable signal; and

[0192] (4) analyzing the presence or amount of the target analyte based on the generated signal.

[0193] 38. The method of paragraph 37, wherein in step (4), the generated detectable signal is analyzed based on a reference level.

[0194] 39. A kit for detecting a target analyte, the kit comprising the composition of any one of paragraphs 1-35.

[0195] 40. Use of the composition of any one of paragraphs 1-35 and the kit of paragraph 39 in detecting a target analyte.

[0196] Examples

[0197] The aptamers and primers used in the following examples were chemically synthesized by Beijing Qianke Biotechnology Co., Ltd. Beaver Beads TM Streptavidin (average diameter 1 pm) was purchased from Suzhou Beaver Biomedical Engineering Co., Ltd. SARS-CoV-2 nucleocapsid protein, SARS-CoV nucleocapsid protein and SARS-CoV spike protein were purchased from Beijing Yiqiao Shenzhou Technology Co., Ltd. Human serum and other chemicals and reagents were purchased from Sigma Aldrich (Shanghai) Trading Co., Ltd. TB Green TM Premix Ex Taq TMand enzyme-free distilled water were purchased from Takara Bio Technology Co., Ltd. HiScribe T7 Quick High Yield RNA Synthesis Kit, standard Taq buffer and RNase inhibitor were purchased from New England Biolabs (Beijing) Co., Ltd. RNA Clean & Concentrator TM -5 purchased from Zymo Research. All chemicals and reagents used were of analytical purity and were used as received Prepared with a water purification system (Millipore) deionized water (18 MΩcm).

[0198] Example 1 Novel coronavirus nucleocapsid protein antigen biosensor

[0199] 1. Expression and purification of Cas12a protein

[0200] Cas12a from Lachnospiraceae bacterium ND2006 (LbCas12a) was expressed and purified according to the protocols described in previous studies (Nat. Commun. 10, 3672 (2019), Chem. Commun. 54, 4774-4777 (2018) and ACS Synth. Biol. 5, 765-773 (2016)). Briefly, E. coli BL21 (DE3) was transformed with pET28TEV-LbCas12a expression plasmid and grown overnight at 37 °C with 150 rpm shaking in Luria-Bertani (LB) medium until the exponential growth phase was reached. Protein expression was then induced with 100 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) and cells were incubated at 16 °C for 12 h. Bacterial pellets were collected by centrifugation at 5,000 x g. Cell pellets were resuspended in lysis buffer (50 mM Tris-HCl [pH 7.4], 200 mM NaCl, 2 mM dithiothreitol, 5% glycerol) supplemented with protease inhibitors (Sigma-Aldrich, Roche Diagnostics, without EDTA) and then lysed with sonication. The lysate was loaded onto a HisTrap FF chromatography column (GE Healthcare) and washed with a gradient of imidazole concentration. Peak fractions were collected and desalted by dialysis. The solution was then loaded onto a HiTrap Q HP chromatography column (GE Healthcare), peak fractions were collected, pooled and concentrated. The concentrated solution was loaded onto a HiLoad 16 / 600 Superdex 200 pg chromatography column for fast protein liquid chromatography analysis (AKTA Explorer 100; GE Healthcare). Gel filtration fractions were analyzed by SDS-PAGE and protein concentration was determined by the Bradford method. Purified product was dissolved in storage buffer (20 mM Tris-HCl [pH 7.5], 1 M NaCl, 50% glycerol) and stored at -80 °C until use.

[0201] 2. Preparation of crRNA

[0202] To prepare the templates for crRNA synthesis, 11 oligonucleotides containing T7 primer sites (SEQ ID NO: 16-SEQ ID NO: 26) were synthesized in pairs and annealed in lx Taq DNA polymerase PCR buffer (Thermo Fisher Scientific). crRNAs were then transcribed using the HiScribe TM T7 Quick High Yield RNA Synthesis Kit and purified using RNA Clean & ConcentratorTM -5 Purification. The resulting crRNA (SEQ ID NO: 58-SEQ ID NO: 67) was quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). In all experiments, RNase-free materials and conditions were used.

[0203] 3. Preparation of com-dsDNA

[0204] First, a DNA sequence synDNA (SEQ ID NO: 78) containing 10 protospacers and protospacer adjacent motifs was synthesized. Then, the C3-modified primer com-C3-F series (SEQ ID NO: 27-SEQ ID NO: 46) and dsDNA-R series (SEQ ID NO: 47-SEQ ID NO: 56) were used to amplify double-stranded DNA with different com sequences of different lengths.

[0205] 4. Construction of Y-tree DNA

[0206] The synthesized three single-stranded nucleotides Y1 (SEQ ID NO: 1), Y2 (SEQ ID NO: 2), Y3 (SEQ ID NO: 3) were annealed together to obtain Y-tree DNA. (Conditions: 95°C for 5 min, 65°C for 2 min; 65°C-1°C / Cys 5Cys; 60°C for 5 min; 60°C-0.1°C / Cys 100Cys; 50°C-1°C / Cys 30Cys; 20°C for 2 min, 16°C∞.)

[0207] 5. Detection of nucleocapsid protein antigen

[0208] (1) 10 μL of 10 mg / mL streptavidin-labeled magnetic beads were washed with 1x PBS (PBST) buffer containing Tween 20 to remove residual NaN3 protection solution.

[0209] (2) 150 μL of 1 μM Y-DNA was added to the magnetic bead solution, supplemented with 10x PBST to a final concentration of 1x PBST buffer conditions, and mixed thoroughly at room temperature for 30 min.

[0210] (3) After the reaction is completed, magnetically separate and remove the supernatant, wash the magnetic beads twice with 1x PBST buffer, add 15 μL of 10 μM synthetic nucleotide chain A48-3 (SEQ ID NO: 10) containing the sequence of aptamer A48 and the complementary sequence of the Y-DNA branch sticky end, add 15 μL of 10 μM synthetic nucleotide chain A61-3 (SEQ ID NO: 11) containing the sequence of aptamer A61 and the complementary sequence of the Y-DNA branch sticky end, supplement 10x PBST to a final concentration of 1x PBST buffer conditions, and mix thoroughly at room temperature for 30 minutes.

[0211] (4) After the reaction is completed, magnetically separate and remove the supernatant, wash the magnetic beads twice with 1x PBST buffer, add 500 μL of 0.3 μM com10-dsDNA, supplement 10x PBST to a final concentration of 1x PBST buffer conditions, and mix thoroughly at room temperature for 30 minutes.

[0212] (5) After the reaction is completed, magnetically separate and remove the supernatant, wash the magnetic beads three times with 1x PBST buffer, and aliquot 18 μL into new 0.2 mL enzyme-free centrifuge tubes.

[0213] (6) Add 2 μL of half-gradient diluted nucleocapsid protein antigen standard solution, and mix at 37°C for 20 minutes.

[0214] (7) After the reaction is completed, magnetically separate and remove the supernatant 10 μL, and add to a new centrifuge tube.

[0215] (8) Prepare the Cas12a reaction system according to the following table of component allocation:

[0216]

[0217] (9) Add the diluted supernatant containing com-dsDNA to the reporter system, and use EnSpire TM Multimode Plate Reader (PerkinElmer, Inc., USA) to detect the fluorescence signal every 1.5 minutes, with an excitation wavelength of 492 nm and an emission wavelength of 520 nm.

[0218] 6. Analysis of the performance of the biosensor

[0219] 6.1 Detection of nucleocapsid protein antigen by the sensor before upgrading

[0220] In previous studies, we constructed CaT-SMelor 2.0 sensing platform by coupling cas12a and aptamer, and realized rapid and high-sensitivity detection of analytes such as alpha-fetoprotein and cocaine. Here, to realize high-sensitivity and rapid detection of SARS-CoV-2 nucleocapsid protein antigen, we assembled A48 aptamer, magnetic beads and com-dsDNA elements into A48 biosensor according to the plug-and-play method of CaT-SMelor 2.0 sensing platform. Among them, A48 aptamer is a 58 nt single-stranded nucleotide, and the affinity constant with nucleocapsid protein antigen is 0.49±0.05nM. com-dsDNA is a double-stranded DNA containing a single-stranded sticky end, which is obtained by amplifying double-stranded DNA through a series of com-modified primers modified by C3. And the single-stranded end is complementary to the A48 aptamer to form an aptamer switch, which is called com-ssDNA; the double-stranded DNA contains the cutting target of cas12a, which is used to activate the trans-cleavage activity of CRISPR / Cas12a-crRNA complex, which is called activation dsDNA. The aptamer is anchored on the streptavidin magnetic beads through the end modification of biotin, and the activation dsDNA is indirectly anchored on the magnetic beads through the complementary pairing of the com-ssDNA with the aptamer through the sticky end part, thereby forming a magnetic bead-aptamer-com-dsDNA sensor, namely A48 biosensor.

[0221] In constructing the A48 biosensor, the signal-to-noise ratio (SNR) should be maximized, meaning the background noise should be as low as possible while the response signal is as large as possible. Sensors with a high SNR exhibit better stability and higher sensitivity. In the magnetic bead-aptamer-com-dsDNA sensor, the base sequence of the com-ssDNA in the aptamer switch assembly determines the SNR. Therefore, based on the A48 sequence, a modified sequence A48-1 (SEQ ID NO: 6) and 10 partially complementary com-ssDNA sequences (corresponding primers are SEQ ID NO: 27-SEQ ID NO: 36) were designed. As shown in Table 2, A48-1 is constructed by adding 5 bases to each end of the A48 aptamer and then connecting it to biotin via a polyA segment. The added 5 bases are designed according to the following principles for aptamers: they can form a G+C content of approximately 55% with the 5-10 bases closest to one end of the aptamer, and the annealing temperature is approximately 40℃-45℃, without forming secondary structures with the aptamer. The modification of A48-1 facilitates the design of com-ssDNA that is complementary to both the aptamer and the additionally added sequence. Aptamer switches constructed using com-ssDNA with tail-designed nucleotides are a classic switch design strategy, often exhibiting excellent signal-to-noise ratios. Two of the ten com-ssDNAs were designed using this method. Of course, designing com-ssDNA with complementary sequences only to the aptamer can also result in switches with good signal-to-noise ratios. Therefore, we designed eight additional com-ssDNAs with complementary sequences falling on the aptamer. Subsequently, we designed the ten com-ssDNAs as C3-modified primers for amplifying and activating dsDNA, as described in the method. The C3-modified sequences are shown in Table 3, from 5' to 3': com-ssDNA sequence, polyA linker sequence, C3-modified molecule, and primer for amplifying and activating dsDNA. Then, the activating DNA—dsDNA01 (SEQ ID NO: 68)—was amplified using reverse primers, yielding a series of com-dsDNA01 activating elements: com1-dsDNA01, com2-dsDNA01, com3-dsDNA01, com4-dsDNA01, com5-dsDNA01, com6-dsDNA01, com7-dsDNA01, com8-dsDNA01, com9-dsDNA01, and com10-dsDNA01. These 10 com-dsDNA01 elements were then combined with aptamers (A48-1) anchored on magnetic beads to construct 10 magnetic bead-aptamer-com-dsDNA01 complexes. Figure 2a), to verify the signal-to-noise ratio of the 10 com-ssDNA and aptamer constructed switch. By determining the content of com-dsDNA with and without the addition of nucleocapsid protein, it is found that com10-ssDNA and A48 constructed sensor have the best signal-to-noise ratio, i.e. 1.6.

[0222] Therefore, we use the A48 biosensor constructed by com10-ssDNA ( Figure 2 a), according to the method described in the method, by adding a half-gradient diluted nucleocapsid protein antigen standard solution, incubating for 20 min, separating and transferring the supernatant for detection. The detection here uses the CRISPR / Cas12a-Reporter system. In the research of Wang Jin and Doudna, we have known that the CRISPR / Cas12a-crRNA complex recognizes and binds to activate dsDNA, which can trigger the transcleavage activity of Cas12a, which can quickly cut any single-stranded DNA. This discovery is used to develop nucleic acid detection, and subsequent small molecule detection, protein detection, ion detection and pathogen detection. The signal output system used in these detection methods is the CRISPR / Cas12a-Reporter system, in which the CRISPR / Cas12a complex component refers to CRISPR / Cas12a, crRNA, dsDNA, and the reporter (probe) is a fluorescent molecule and a quencher group modified single-stranded nucleotide (SEQ ID NO: 57). The probe cannot emit light due to the quencher group, but when dsDNA is recognized and cut by the Cas12a-crRNA complex as an activator, it will trigger the transcleavage activity of cas12a, quickly cutting the probe, so that the fluorescent group and the quencher group are separated, and the light is emitted. At the same time, the higher the concentration of dsDNA, the stronger the fluorescence signal, the faster the growth of the fluorescence curve, and the slope of the fluorescence curve is positively correlated with the concentration of dsDNA. This has been confirmed in our previous research. Therefore, we can determine the concentration of dsDNA in the supernatant according to the fluorescence curve and slope of the supernatant in the CRISPR / Cas12a-Reporter system. Therefore, we use the CRISPR / Cas12a-Reporter system to detect the concentration of com-dsDNA01 released by the nucleocapsid protein driven release, that is, the size of the fluorescence curve slope, and then determine the concentration response range of the A48 biosensor when detecting the nucleocapsid protein. After detection, we found that when the concentration of nucleocapsid protein is less than 47.68 fM or greater than 195.31 pM, the slope change is not obvious, and between 47.68 fM-195.31 pM, the growth rate of fluorescence intensity increases with the increase of the concentration of nucleocapsid protein antigen Figure 2b) The slope of the fluorescence value within the first 10 minutes was calculated to show that the corresponding slope increased first, then increased again, and finally tended to be flat as the concentration of the nucleocapsid protein antigen increased logarithmically Figure 2 c) These show that the A48 sensor can respond to nucleocapsid protein in the range of 47.68 fM-195.31 pM. However, this does not meet the actual needs of antigen detection, and we still need to further improve the detection sensitivity.

[0223] 6.2 Multi-target tandem strategy to upgrade the sensor

[0224] To improve the sensitivity of detection, one of the methods we propose is to improve the signal amplification ability of the CRISPR / Cas12a-Reporter system. When there are more cleavage sites on the activated dsDNA, the output fluorescence curve slope of the same concentration of activated dsDNA is larger, that is, the same output slope requires less activated dsDNA, and the corresponding nucleocapsid protein for competitive binding of aptamer to drive away activated dsDNA is less, thereby achieving the purpose of improving sensitivity. Therefore, we extended the activation element dsDNA01 (SEQ ID NO: 68) to a long-chain dsDNA10 (SEQ ID NO: 77) containing 10 protospacers and protospacer adjacent motifs (PAM), and constructed a multi-target tandem strategy to upgrade the A48 sensor for the detection of nucleocapsid protein antigen Figure 3 a) dsDNA01 contains only one protospacer and PAM site, and can form a complex after binding with Cas12a and crRNA01, that is, to activate the trans-cleavage activity of Cas12a. In the CRISPR / Cas12a-Reporter system based on dsDNA01, as the concentration of dsDNA01 increases, the output slope response increases, and the detection interval is between 47.68 fM and 195.31 pM. We gradually extended dsDNA01, that is, designed dsDNA02, dsDNA03, dsDNA04, dsDNA05, dsDNA06, dsDNA07, dsDNA08, dsDNA09 and dsDNA10 (corresponding to 2, 3, 4, 5, 6, 7, 8, 9, 10 protospacers and PAM sites, SEQ ID NO: 69-77) containing more protospacers and PAM sites. We found that as the dsDNA lengthens, the same concentration of different length dsDNA in the CRISPR / Cas12a-Reporter system outputs a slope that increases in turn Figure 3 b), and the DNA concentration range of the standard curve slope response of dsDNA10 is smaller Figure 3c), which confirmed our assumption. Therefore, dsDNA10 with the largest output slope was selected as the activation DNA, and the magnetic bead-A48 aptamer-com10-dsDNA10 complex was constructed according to the method of constructing the sensor. The slope output under different concentrations of nucleocapsid protein was detected. After detection, it was found that the detection interval of nucleocapsid protein was increased to 5.96-381.47 fM Figure 3 d), compared with the response interval of the A48 biosensor before upgrading Figure 3 e). It can be seen that the extended dsDNA10 indeed improves the signal amplification ability of the CRISPR / Cas12a-Reporter system, and the detection sensitivity of the A48 sensor based on the multi-target tandem dsDMA10 has been significantly improved. However, the detection interval of 5.96-381.47 fM still cannot meet the needs of clinical applications, and we still need to continue our efforts.

[0225] 6.3 Upgrading the sensor in a new mode

[0226] How to further improve the sensitivity of the CRISPR / Cas12a coupled aptamer sensor platform? According to the research results of Zhang Liyun et al. (Discovery of the Sandwich type COVID-19 Nucleocapsid Protein DNA Aptamers), A48 aptamer and A61 aptamer recognize different epitopes of nucleocapsid protein antigen. Based on this, the inventors assumed whether the two could be constructed together to cooperatively detect nucleocapsid protein, that is, when one aptamer captures the freely moving nucleocapsid protein in the buffer, the other aptamer can more easily bind to the captured nucleocapsid protein. This promotion is conducive to the release of more activation dsDNA by less nucleocapsid protein, thereby improving the detection sensitivity.

[0227] Thus, a Y-tree bifunctional aptamer synergistic element was designed for the detection of nucleocapsid protein antigen. Y-tree, or Y-tree DNA, is obtained by annealing three single-stranded nucleotides Y1, Y2 and Y3 (SEQ ID NO: 1-SEQ ID NO: 3) to each other. Y1, Y2 and Y3 are partially complementary to each other, as indicated in the "Explanation" column in Table 2, where sequences of the same color are 18-base pairs that are complementary to each other. This is the core sequence of Y-tree DNA and is the basis for the construction of Y-DNA. In addition, Y1 and Y2 contain 25-base sequences for the attachment of aptamers (or aptamer connection sequences), and Y3 contains a biotin-modified molecule for anchoring magnetic beads. As described in the method, we annealed Y1, Y2 and Y3 together to obtain Y-DNA, which was then incubated with magnetic beads and bound to the magnetic beads through the biotin on Y3. The Y-DNA anchored on the magnetic beads extends outward from the attachment ends of Y1 and Y2, allowing aptamers or aptamer connection sequences to bind. The affinity of A61 aptamer for nucleocapsid protein antigen is 2.74 ± 0.08 nM. We first selected 10 comDNAs according to the method for constructing A48 sensor, and selected the comDNA with the best signal-to-noise ratio, i.e., com11. Subsequently, we attached the sequences extended from the modified aptamers of A48 and A61 to Y-DNA, and then bound com10-dsDNA10 and com11-dsDNA10 to the A48 and A61 aptamers, respectively, to construct a magnetic bead-YDNA-A48+A61-comdsDNA10 complex based on Y-tree DNA and double aptamers. When we added nucleocapsid protein, there was no increase in signal compared to the case where no analyte was added, i.e., the signal-to-noise ratio approached 1. This indicates that this complex cannot be used for the detection of nucleocapsid protein.

[0228] After analysis, we considered that A48 and A61 aptamer bind to the two ends of the nucleocapsid protein respectively, because the distance between the two is too short, which leads to the competition between A48 and A61 instead of the synergy. To verify this guess, we extended the distance between the two aptamers by two connecting sequences. The extended sequence is annealed by Y1-linkerF, Y1-linkerR and Y2-linkerF, Y2-linkerR (SEQ ID NO: 12-SEQ ID NO: 15) respectively. Among them, linkerF is 88 nt, linkerR is 38 nt, and the 38 nt of linkerR is completely complementary to the middle 38 nt of linkerF, while the 25 nt at both ends of linkerF is used to bind the hanging sequence of the tree DNA and the extended hanging sequence of the aptamer. After annealing, a double-stranded DNA with sticky ends of 25 bases at both ends is formed, which is called linker1 and linker2. Subsequently, we assembled the magnetic beads, YDNA, linker-DNA, aptamer and com-dsDNA according to the method described in the method to obtain the complex of magnetic beads-YDNA-linker-A48+A61-comdsDNA10. That is, the modified aptamer A48-3 and A61-3 are anchored on the magnetic beads through Y-DNA and connecting sequence to construct the magnetic beads-YDNA-dual aptamer complex. And com10-dsDNA10 and com11-dsDNA10 are bound to the two aptamers connected to YDNA to construct the dual aptamer synergy sensor based on A48 and A61 Figure 4 a). After adding nucleocapsid protein and detecting the signal-to-noise ratio, we found that compared with single aptamer sensor, there was a significant improvement. At the same time, when we constructed the magnetic beads-YDNA-linker-A48+A48-comdsDNA10 complex and the magnetic beads-YDNA-linker-A61+A61-comdsDNA10 complex based on the same method, we found that the signal-to-noise ratio of the two was lower than that of the single aptamer sensor, which was not suitable for the detection of nucleocapsid protein.

[0229] Subsequently, we used the A48+A61 dual aptamer synergy sensor to detect the half-diluted nucleocapsid protein antigen, and found that the increase rate of fluorescence intensity became larger with the increase of the concentration of nucleocapsid protein between 0.19-2.98 fM Figure 4 b), compared with the two sensors before optimization, the detection range moved to a smaller range, and the output range of the slope became larger Figure 4 c). Further analysis, we found that between 0.19-2.98 fM, the fluorescence intensity slope showed a linear relationship of y=194.83x-146.80, and the linear correlation coefficient R2 0.99 Figure 5 a). Therefore, the sensing platform created by the synergistic mode greatly improves the sensitivity of detection and nucleocapsid protein.

[0230] 6.4 Detection of SARS-CoV-2 nucleocapsid protein antigen

[0231] In order to realize the detection of SARS-CoV-2 nucleocapsid protein antigen, 10 samples were detected by double-blind experiment, 5 of which contained SARS-CoV-2 nucleocapsid protein antigen and 5 of which did not. According to the description in the method, 20 samples were added to the sensor by one-tenth of the addition amount, incubated, and then the supernatant was removed to the CRISPR-reporter system for incubation and detection of fluorescence values at 0, 1.5, 3, 4.5, 5, 7.5, 9 minutes. According to the fluorescence curve, the corresponding slope of each sample was calculated. As shown in Figure 6b, the slopes of samples 1 to 10 were 115, 57, 13, 10, 102, 98, 5, 13, 11, and 123, respectively. Samples 1, 2, 5, 6, and 10 were positive, and the other samples were negative. After verification, the detection accuracy was 100%. This shows that the sensor of the present application can well detect viral samples. Figure 5

[0232] Table 2 The sequences used herein and primers are shown below:

[0233]

[0234]

[0235]

[0236]

[0237] Table 3 The crRNA sequences used are shown

[0238] Name Sequence (5'-3') SEQ ID NOs: crRNA01 AAUUUCUACUGUUGUAGAUGAUGCACCAGAUACACAA 58 crRNA02 AAUUUCUACUGUUGUAGAUGGUAGACCAACUAAUGUA 59 crRNA03 AAUUUCUACUGUUGUAGAUCCUAUACCUAUAGGGUUA 60 crRNA04 AAUUUCUACUGUUGUAGAUGCUAGAACAGCAGAUACU 61 crRNA05 AAUUUCUACUGUUGUAGAUGCUACACCACAUUCACAU 62 crRNA06 AAUUUCUACUGUUGUAGAUCCUGCACCAGUAGCUGCC 63 crRNA07 AAUUUCUACUGUUGUAGAUCCAGAACCCAUAUAUCCA 64 crRNA08 AAUUUCUACUGUUGUAGAUCCAUGAACAGUACUGAAC 65 crRNA09 AAUUUCUACUGUUGUAGAUGGAUGACCCACAAUCCAC 66 crRNA10 AAUUUCUACUGUUGUAGAUGCUGAACUUGAAUAACCU 67

[0239] Table 4 The dsDNA sequences used are shown

[0240]

[0241]

[0242]

[0243] 7. Summary

[0244] ​For the detection of SARS-CoV-2, the nucleic acid detection is sensitive and accurate, but it is time-consuming and complicated. The antibody detection is fast, but it is not sensitive and lagging. The antigen detection is real and fast, but it is not sensitive. The most popular and widely used method is the nucleic acid detection, which is also called the gold standard of detection. However, the antigen detection can reflect the real situation of the sample quantity without the complicated and time-consuming extraction of the easily degradable nucleic acid. If the sensitivity problem can be solved, it will be a very powerful detection method. In our previous work, we developed a detection platform based on the coupling of aptamer and ca12a, CaT-SMelor 2.0. This platform has the characteristics of sensitivity, rapidity, efficiency, universality and plug-and-play, and can detect a wide range of analytes including proteins. The SARS-CoV-2 nucleocapsid protein antigen is within the detection range, and the responsive high-affinity aptamer has been developed, which is suitable for us to construct a sensor for detecting SARS-CoV-2 nucleocapsid protein antigen by the plug-and-play method.

[0245] Thus, we selected the A48 aptamer with the best affinity and constructed the A48-com10-dsDNA01 sensor based on the A48 aptamer according to the plug-and-play method. The detection found that the A48-com10-dsDNA01 sensor successfully realized the detection by adding the standard concentration of SARS-CoV-2 nucleocapsid protein antigen. And the nucleocapsid protein antigen was between 47.68 fM and 195.31 pM, and the output fluorescence slope increased continuously with the increase of the concentration of the nucleocapsid protein antigen. However, the detection sensitivity of the sensor was still not high, and further optimization was needed. Therefore, we used two strategies to improve the sensitivity - multi-target point series strategy and double aptamer synergy strategy. As described in the results, we improved the signal amplification ability of the CRISPR / Cas12a-Reporter system by increasing the cutting target of the activated DNA (dsDNA01 was improved to dsDNA10). With the same output slope, less activated DNA was needed, that is, less nucleocapsid protein antigen was needed. After the detection, it was found that the detection range of the A48-com10-dsDNA10 sensor for the nucleocapsid protein was 5.96-381.47 fM, which was smaller than the response range of the A48-com10-dsDNA01 sensor before upgrading. However, although the detection sensitivity was significantly improved, the detection range of 5.96-381.47 fM still could not meet the needs of clinical application. Therefore, we designed a double aptamer synergy strategy to further optimize the sensor. As shown in the results, we selected two aptamers A48 and A61 that recognized different epitopes of SARS-CoV-2 nucleocapsid protein antigen, and constructed a complex of magnetic beads-YDNA-linker-A48+A61-comdsDNA10 (Y-A48+A61-com dsDNA10 sensor) through Y tree DNA. The results showed that the sensor had a larger signal-to-noise ratio than the single aptamer sensor and the single aptamer sensor based on Y tree, and was more suitable for constructing a sensor. After detection, it was found that the SARS-CoV-2 nucleocapsid protein antigen was between 0.19 and 2.98 fM, and the output fluorescence curve slope increased with the increase of the antigen concentration, and there was a linear relationship between them (y = 122.75x-106.05), and the linear correlation coefficient R 2 >0.99. Thus, through the multi-target point series strategy and the double aptamer synergy strategy, the sensitivity of the detection of the nucleocapsid protein was greatly improved. Finally, we used the upgraded collaborative sensor to detect 10 SARS-CoV-2 nucleocapsid protein antigen samples, and as shown in the results, the virus samples and the control samples were successfully distinguished.

[0246] In summary, the upgraded CaT-SMelor 2.1 sensing platform of the present application realizes high-sensitivity detection of SARS-CoV-2 nucleocapsid protein antigen through multi-target point series design and double aptamer synergistic strategy, has simple operation, rapidness, is very suitable for high-sensitivity detection of viral antigens, and has broad application prospects in laboratory and clinical detection. SEQUENCE LISTING <110> East China University of Technology <120> Biosensor based on aptamer and CRISPR / Cas12a system, composition, kit and use thereof <130> 208043 <160> 81 <170> PatentIn version 3.5 <210> 1 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Y1 <400> 1 acgcacgtga tactgtatgt ctgataaaaa acgagtaggt acggatctga ccgctattca 60 tcggtcg 67 <210> 2 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Y2 <400> 2 gagaaggtgt gaacggttga cagataaaaa acgagaccat acgtacagcc agatccgtac 60 ctactcg 67 <210> 3 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Y3 <400> 3 aaaaaaaaaa aacgaccgat gaatagcggt gctgtacgta tggtctcg 48 <210> 4 <211> 58 <212> DNA <213> Artificial sequence <220> <223> A48 <400> 4 gctggatgtc gcttacgaca atattcctta ggggcaccgc tacattgaca catccagc 58 <210> 5 <211> 58 <212> DNA <213> Artificial sequence <220> <223> A61 <400> 5 gctggatgtt gacctttaca gatcggattc tgtggggcgt taaactgaca catccagc 58 <210> 6 <211> 80 <212> DNA <213> Artificial sequence <220> <223> A48-1 <400> 6 tactcgctgg atgtcgctta cgacaatatt ccttaggggc accgctacat tgacacatcc 60 agctcatcaa aaaaaaaaaa 80 <210> 7 <211> 80 <212> DNA <213> Artificial sequence <220> <223> A61-1 <400> 7 tactcgctgg atgttgacct ttacagatcg gattctgtgg ggcgttaaac tgacacatcc 60 agctcatcaa aaaaaaaaaa 80 <210> 8 <211> 75 <212> DNA <213> Artificial sequence <220> <223> A48-2 <400> 8 tactcgctgg atgtcgctta cgacaatatt ccttaggggc accgctacat tgacacatcc 60 agcaaaaaaa aaaaa 75 <210> 9 <211> 75 <212> DNA <213> Artificial sequence <220> <223> A61-2 <400> 9 gctggatgtt gacctttaca gatcggattc tgtggggcgt taaactgaca catccagctc 60 atcaaaaaaa aaaaa 75 <210> 10 <211> 94 <212> DNA <213> Artificial sequence <220> <223> A48-3 <400> 10 tactcgctgg atgtcgctta cgacaatatt ccttaggggc accgctacat tgacacatcc 60 agcaaaaaaa ggctacggag acgaagaatc gagg 94 <210> 11 <211> 94 <212> DNA <213> Artificial sequence <220> <223> A61-3 <400> 11 gctggatgtt gacctttaca gatcggattc tgtggggcgt taaactgaca catccagctc 60 atcaaaaaat tggaaacgga agatcgacag gtac 94 <210> 12 <211> 88 <212> DNA <213> Artificial sequence <220> <223> Y1-linkerF <400> 12 atcagacata cagtatcacg tgcgtccgga taaggcgcag cggtcggctg aattcagggt 60 tcgcctcgat tcttcgtctc cgtagcct 88 <210> 13 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Y1-linker-R <400> 13 cgaaccctga attcagccga ccgctgcgcc ttatccgg 38 <210> 14 <211> 88 <212> DNA <213> Artificial sequence <220> <223> Y2-linkerF <400> 14 atctgtcaac cgttcacacc ttctccagca cacttggaga ccgaagctta ccggactcct 60 aacgtacctg tcgatcttcc gtttccaa 88 <210> 15 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Y2-linkerR <400> 15 gttaggagtc cggtaagctt cggtctccaa gtgtgctg 38 <210> 16 <211> 22 <212> DNA <213> Artificial sequence <220> <223> T7_Promoter_F <400> 16 attaatacga ctcactatag gg 22 <210> 17 <211> 59 <212> DNA <213> Artificial sequence <220> <223> crRNA01_T7_Promoter_R <400> 17 ttgtgtatct ggtgcatcat ctacaacagt agaaattccc tatagtgagt cgtattaat 59 <210> 18 <211> 59 <212> DNA <213> Artificial sequence <220> <223> crRNA02_T7_Promoter_R <400> 18 tacattagtt ggtctaccat ctacaacagt agaaattccc tatagtgagt cgtattaat 59 <210> 19 <211> 59 <212> DNA <213> Artificial sequence <220> <223> crRNA03_T7_Promoter_R <400> 19 taaccctata ggtataggat ctacaacagt agaaattccc tatagtgagt cgtattaat 59 <210> 20 <211> 59 <212> DNA <213> Artificial sequence <220> <223> crRNA04_T7_Promoter_R <400> 20 agtatctgct gttctagcat ctacaacagt agaaattccc tatagtgagt cgtattaat 59 <210> 21 <211> 59 <212> DNA <213> Artificial sequence <220> <223> crRNA05_T7_Promoter_R <400> 21 atgtgaatgt ggtgtagcat ctacaacagt agaaattccc tatagtgagt cgtattaat 59 <210> 22 <211> 59 <212> DNA <213> Artificial sequence <220> <223> crRNA06_T7_Promoter_R <400> 22 ggcagctact ggtgcaggat ctacaacagt agaaattccc tatagtgagt cgtattaat 59 <210> 23 <211> 59 <212> DNA <213> Artificial sequence <220> <223> crRNA07_T7_Promoter_R <400> 23 tggatatatg ggttctggat ctacaacagt agaaattccc tatagtgagt cgtattaat 59 <210> 24 <211> 59 <212> DNA <213> Artificial sequence <220> <223> crRNA08_T7_Promoter_R <400> 24 gttcagtact gttcatggat ctacaacagt agaaattccc tatagtgagt cgtattaat 59 <210> 25 <211> 59 <212> DNA <213> Artificial sequence <220> <223> crRNA09_T7_Promoter_R <400> 25 gtggattgtg ggtcatccat ctacaacagt agaaattccc tatagtgagt cgtattaat 59 <210> 26 <211> 59 <212> DNA <213> Artificial sequence <220> <223> crRNA10_T7_Promoter_R <400> 26 aggttattca agttcagcat ctacaacagt agaaattccc tatagtgagt cgtattaat 59 <210> 27 <211> 38 <212> DNA <213> Artificial sequence <220> <223> com1-C3-F <400> 27 gatgagctgg ataaaaaata agttgggtaa cgccaggg 38 <210> 28 <211> 40 <212> DNA <213> Artificial sequence <220> <223> com2-C3-F <400> 28 atgtgtcaat gtagaaaaaa taagttgggt aacgccaggg 40 <210> 29 <211> 37 <212> DNA <213> Artificial sequence <220> <223> com3-C3-F <400> 29 caatgtagcg gaaaaaataa gttgggtaac gccaggg 37 <210> 30 <211> 37 <212> DNA <213> Artificial sequence <220> <223> com4-C3-F <400> 30 tgtagcggtg caaaaaataa gttgggtaac gccaggg 37 <210> 31 <211> 37 <212> DNA <213> Artificial sequence <220> <223> com5-C3-F <400> 31 tgcccctaag gaaaaaataa gttgggtaac gccaggg 37 <210> 32 <211> 39 <212> DNA <213> Artificial sequence <220> <223> com6-C3-F <400> 32 cctaaggaat attaaaaaat aagttgggta acgccaggg 39 <210> 33 <211> 38 <212> DNA <213> Artificial sequence <220> <223> com7-C3-F <400> 33 aatattgtcg taaaaaaata agttgggtaa cgccaggg 38 <210> 34 <211> 37 <212> DNA <213> Artificial sequence <220> <223> com8-C3-F <400> 34 aagcgacatc caaaaaataa gttgggtaac gccaggg 37 <210> 35 <211> 37 <212> DNA <213> Artificial sequence <220> <223> com9-C3-F <400> 35 cgacatccag c aaaaaataa gttgggtaac gccaggg 37 <210> 36 <211> 38 <212> DNA <213> Artificial sequence <220> <223> com10-C3-F <400> 36 atccagcgag taaaaaaata agttgggtaa cgccaggg 38 <210> 37 <211> 38 <212> DNA <213> Artificial sequence <220> <223> com11-C3-F <400> 37 gatgagctgg ataaaaaata agttgggtaa cgccaggg 38 <210> 38 <211> 38 <212> DNA <213> Artificial sequence <220> <223> com12-C3-F <400> 38 ggatgtgtca gtaaaaaata agttgggtaa cgccaggg 38 <210> 39 <211> 37 <212> DNA <213> Artificial sequence <220> <223> com13-C3-F <400> 39 cagtttaacg caaaaaataa gttgggtaac gccaggg 37 <210> 40 <211> 37 <212> DNA <213> Artificial sequence <220> <223> com14-C3-F <400> 40 aacgccccac aaaaaaataa gttgggtaac gccaggg 37 <210> 41 <211> 37 <212> DNA <213> Artificial sequence <220> <223> com15-C3-F <400> 41 ccacagaatc caaaaaataa gttgggtaac gccaggg 37 <210> 42 <211> 37 <212> DNA <213> Artificial sequence <220> <223> com16-C3-F <400> 42 cacagaatcc gaaaaaataa gttgggtaac gccaggg 37 <210> 43 <211> 40 <212> DNA <213> Artificial sequence <220> <223> com17-C3-F <400> 43 atccgatctg taaaaaaaaa taagttgggt aacgccaggg 40 <210> 44 <211> 39 <212> DNA <213> Artificial sequence <220> <223> com18-C3-F <400> 44 taaaggtcaa cataaaaaat aagttgggta acgccaggg 39 <210> 45 <211> 37 <212> DNA <213> Artificial sequence <220> <223> com19-C3-F <400> 45 ggtcaacatc caaaaaataa gttgggtaac gccaggg 37 <210> 46 <211> 38 <212> DNA <213> Artificial sequence <220> <223> com20-C3-F <400> 46 atccagcgag taaaaaaata agttgggtaa cgccaggg 38 <210> 47 <211> 20 <212> DNA <213> Artificial sequence <220> <223> dsDNA01-R <400> 47 accgttaaca cgatcaacag 20 <210> 48 <211> 25 <212> DNA <213> Artificial sequence <220> <223> dsDNA02-R <400> 48 tcatgtacat gatcacactg tgaac 25 <210> 49 <211> 22 <212> DNA <213> Artificial sequence <220> <223> dsDNA03-R <400> 49 tctaggtttg gatcttcctg ca 22 <210> 50 <211> 24 <212> DNA <213> Artificial sequence <220> <223> dsDNA04-R <400> 50 tagttgtcat gatcgatgtt ccaa 24 <210> 51 <211> 25 <212> DNA <213> Artificial sequence <220> <223> dsDNA05-R <400> 51 tctctcatta gatcggatgt aagag 25 <210> 52 <211> 25 <212> DNA <213> Artificial sequence <220> <223> dsDNA06-R <400> 52 ttattaagaa gatcctcaca cggac 25 <210> 53 <211> 23 <212> DNA <213> Artificial sequence <220> <223> dsDNA07-R <400> 53 tgtacagatg gatctaccga gaa 23 <210> 54 <211> 28 <212> DNA <213> Artificial sequence <220> <223> dsDNA08-R <400> 54 ttcatataca gatcagaact tgatactg 28 <210> 55 <211> 27 <212> DNA <213> Artificial sequence <220> <223> dsDNA09-R <400> 55 cgatatattg gatctacatc ggataag 27 <210> 56 <211> 25 <212> DNA <213> Artificial sequence <220> <223> dsDNA10-R <400> 56 attatcattg gcgtcctact aaatg 25 <210> 57 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reporter <400> 57 gattagcgta cgcacgttac 20 <210> 58 <211> 37 <212> RNA <213> Artificial sequence <220> <223> crRNA01 <400> 58 aauuucuacu guuguagaug augcaccaga uacacaa 37 <210> 59 <211> 37 <212> RNA <213> Artificial sequence <220> <223> crRNA02 <400> 59 aauuucuacu guuguagaug guagaccaac uaaugua 37 <210> 60 <211> 37 <212> RNA <213> Artificial sequence <220> <223> crRNA03 <400> 60 aauuucuacu guuguagauc cuauaccuau aggguua 37 <210> 61 <211> 37 <212> RNA <213> Artificial sequence <220> <223> crRNA04 <400> 61 aauuucuacu guuguagaug cuagaacagc agauacu 37 <210> 62 <211> 37 <212> RNA <213> Artificial sequence <220> <223> crRNA05 <400> 62 aauuucuacu guuguagaug cuacaccaca uucacau 37 <210> 63 <211> 37 <212> RNA <213> Artificial sequence <220> <223> crRNA06 <400> 63 aauuucuacu guuguagauc cugcaccagu agcugcc 37 <210> 64 <211> 37 <212> RNA <213> Artificial sequence <220> <223> crRNA07 <400> 64 aauuucuacu guuguagauc cagaacccau auaucca 37 <210> 65 <211> 37 <212> RNA <213> Artificial sequence <220> <223> crRNA08 <400> 65 aauuucuacu guuguagauc caugaacagu acugaac 37 <210> 66 <211> 37 <212> RNA <213> Artificial sequence <220> <223> crRNA09 <400> 66 aauuucuacu guuguagaug gaugacccac aauccac 37 <210> 67 <211> 37 <212> RNA <213> Artificial sequence <220> <223> crRNA10 <400> 67 aauuucuacu guuguagaug cugaacuuga auaaccu 37 <210> 68 <211> 135 <212> DNA <213> Artificial sequence <220> <223> dsDNA01 <400> 68 taagttgggt aacgccaggg ttttcccagt cacgacgttg taaaacgacg gccagtgccg 60 gtctcttgac gtccttatgg tttagatgca ccagatacac aatatgtcag atactctgtt 120 gatcgtgtta acggt 135 <210> 69 <211> 188 <212> DNA <213> Artificial sequence <220> <223> dsDNA02 <400> 69 taagttgggt aacgccaggg ttttcccagt cacgacgttg taaaacgacg gccagtgccg 60 gtctcttgac gtccttatgg tttagatgca ccagatacac aatatgtcag atactctgtt 120 GATC GTGT TAACGGTTAGG TAGACCAACT AATGTAATAC CAAGTTCACA GTGTGATCAT 180 GTACATGA 188 <210> 70 <211> 242 <212> DNA <213> Artificial sequence <220> <223> dsDNA03 <400> 70 TAAGTTGGGT AACGCCAGGG TTTTCCCAGT CACGACGTTG TAAAAACGAC GGCCAGTGCC G 60 GTCTCTTGAC GTCCTTATGG TTTAGATGCA CCAGATACAC AATATGTCAG ATACTCTGTT 120 GATCGTGT TAACGGTTAGG TAGACCAACT AATGTAATAC CAAGTTCACA GTGTGATCAT 180 GTACATGATT TACCTATACC TATAGGTTAA TTAAGGGTAT GCAGGAAGAT CCAAACCTA 240 GA 242 <210> 71 <211> 296 <212> DNA <213> Artificial sequence <220> <223> dsDNA04 <400> 71 TAAGTTGGGT AACGCCAGGG TTTTCCCAGT CACGACGTTG TAAAAACGAC GGCCAGTGCC G 60 GTCTCTTGAC GTCCTTATGG TTTAGATGCA CCAGATACAC AATATGTCAG ATACTCTGTT 120 gatcgtgtta acggtttagg tagaccaact aatgtaatac caagttcaca gtgtgatcat 180 gtacatgatt tacctatacc tatagggtta attaagggta tgcaggaaga tccaaaccta 240 gatttagcta gaacagcaga tacttataag aattggaaca tcgatcatga caacta 296 <210> 72 <211> 350 <212> DNA <213> Artificial sequence <220> <223> dsDNA05 <400> 72 taagttgggt aacgccaggg ttttcccagt cacgacgttg taaaacgacg gccagtgccg 60 gtctcttgac gtccttatgg tttagatgca ccagatacac aatatgtcag atactctgtt 120 gatcgtgtta acggtttagg tagaccaact aatgtaatac caagttcaca gtgtgatcat 180 gtacatgatt tacctatacc tatagggtta attaagggta tgcaggaaga tccaaaccta 240 gatttagcta gaacagcaga tacttataag aattggaaca tcgatcatga caactattta 300 gctacaccac attcacatat atgttctctt acatccgatc taatgagaga 350 <210> 73 <211> 404 <212> DNA <213> Artificial sequence <220> <223> dsDNA06 <400> 73 taagttgggt aacgccaggg ttttcccagt cacgacgttg taaaacgacg gccagtgccg 60 gtctcttgac gtccttatgg tttagatgca ccagatacac aatatgtcag atactctgtt 120 gatcgtgtta acggtttagg tagaccaact aatgtaatac caagttcaca gtgtgatcat 180 gtacatgatt tacctatacc tatagggtta attaagggta tgcaggaaga tccaaaccta 240 gatttagcta gaacagcaga tacttataag aattggaaca tcgatcatga caactattta 300 gctacaccac attcacatat atgttctctt acatccgatc taatgagaga tttacctgca 360 ccagtagctg ccaatagcag tccgtgtgag gatcttctta ataa 404 <210> 74 <211> 458 <212> DNA <213> Artificial sequence <220> <223> dsDNA07 <400> 74 taagttgggt aacgccaggg ttttcccagt cacgacgttg taaaacgacg gccagtgccg 60 gtctcttgac gtccttatgg tttagatgca ccagatacac aatatgtcag atactctgtt 120 180. gatcgtgtta acggtttagg tagaccaact aatgtaatac caagttcaca gtgtgatcat gtacatgatt tacctatacc tatagggtta attack tgcaggaaga tccaaaccta gatttagcta gaacagcaga tacttataag aattggaca tcgatcatga caactattta 360. gctacaccac attcacatat atgttctctt acatccgatc taatgagaga tttacctgca ccagtagctg ccatagcag tccgtgtgag gatcttctta ataatttacc agaacccata tatccatcat ctacattctc ggtagatcca tctgtaca 458 <210> 75 <211> 512 <212> DNA <213> Artificial sequence <220> <223> dsDNA08 <400> 75 60. taagttgggt aacgccaggg ttttcccagt cacgacgttg taaaacgacg gccagtgccg gtctcttgac gtccttatgg tttagatgca ccagatacac aatatgtcag atactctgtt 180. gatcgtgtta acggtttagg tagaccaact aatgtaatac caagttcaca gtgtgatcat gtacatgatt tacctatacc tatagggtta attack tgcaggaaga tccaaaccta tattagcta speed tacttag attgac tcgatcatga speed 300 gctacaccac attcacatat atgttctctt acatccgatc taatgagaga tttacctgca 360 ccagtagctg ccaatagcag tccgtgtgag gatcttctta ataatttacc agaacccata 420 tatccatcat ctacattctc ggtagatcca tctgtacatt taccatgaac agtactgaac 480 tcaccagtat caagttctga tctgtatatg aa 512 <210> 76 <211> 566 <212> DNA <213> Artificial Sequence <220> <223> dsDNA09 <400> 76 taagttgggt aacgccagggg tttcccagt cacgacgttg taaaacgacg gccagtgccg 60 gtctcttgac gtccttatgg tttagatgca ccagatacac atatgtcag atactctgtt 120 gatcgtgtta acggtttagg tagaccact aatgtaatac caagttcaca gtgtgatcat 180 gtacatgatt tacctatacc tatagggtta attaagggta tgcaggaaga tccaaacta 240 tattagcta speed tacttag attgac tcgatcatga speed 300 gctacaccac attcacatat atgttctctt acatccgatc taatgagaga tttacctgca 360 ccagtagctg ccaatagcag tccgtgtgag gatcttctta ataatttacc agaacccata 420 tatccatcat ctacattctc ggtagatcca tctgtacatt taccatgaac agtactgaac 480 tcaccagtat caagttctga tctgtatatg aatttaggat gacccacaat ccaccagtac 540 ttatccgatg tagatccaat atatcg 566 <210> 77 <211> 643 <212> DNA <213> Artificial sequence <220> <223> dsDNA10 <400> 77 taagttgggt aacgccaggg ttttcccagt cacgacgttg taaaacgacg gccagtgccg 60 gtctcttgac gtccttatgg tttagatgca ccagatacac aatatgtcag atactctgtt 120 gatcgtgtta acggtttagg tagaccaact aatgtaatac caagttcaca gtgtgatcat 180 gtacatgatt tacctatacc tatagggtta attaagggta tgcaggaaga tccaaaccta 240 gatttagcta gaacagcaga tacttataag aattggaaca tcgatcatga caactattta 300 gctacaccac attcacatat atgttctctt acatccgatc taatgagaga tttacctgca 360 ccagtagctg ccaatagcag tccgtgtgag gatcttctta ataatttacc agaacccata 420 tatccatcat ctacattctc ggtagatcca tctgtacatt taccatgaac agtactgaac 480 tcaccagtat caagttctga tctgtatatg aatttaggat gacccacaat ccaccagtac 540 ttatccgatg tagatccaat atatcgttta gctgaacttg aataacctac atacttatca 600 taatctgatc atgtcacaca tttagtagga cgccaatgat aat 643 <210> 78 <211> 551 <212> DNA <213> Artificial sequence <220> <223> synDNA <400> 78 ggtctcttga cgtccttatg gtttagatgc accagataca caatatgtca gatactctgt 60 tgatcgtgtt aacggtttag gtagaccaac taatgtaata ccaagttcac agtgtgatca 120 tgtacatgat ttacctatac ctatagggtt aattaagggt atgcaggaag atccaaacct 180 agatttagct agaacagcag atacttataa gaattggaac atcgatcatg acaactattt 240 agctacacca cattcacata tatgttctct tacatccgat ctaatgagag atttacctgc 300 accagtagct gccaatagca gtccgtgtga ggatcttctt aataatttac cagaacccat 360 atatccatca tctacattct cggtagatcc atctgtacat ttaccatgaa cagtactgaa 420 ctcaccagta tcaagttctg atctgtatat gaatttagga tgacccacaa tccaccagta 480 cttatccgat gtagatccaa tatatcgttt agctgaactt gaataaccta catacttatc 540 ataatctgat c 551 <210> 79 <211> 58 <212> DNA <213> Artificial sequence <220> <223> A58 <400> 79 gctggatgtc accggattgt cggacatcgg attgtctgag tcatatgaca catccagc 58 <210> 80 <211> 58 <212> DNA <213> Artificial sequence <220> <223> A15 <400> 80 gctggatgtt catgctggca aaattcctta ggggcaccgt tactttgaca catccagc 58 <210> 81 <211> 418 <212> PRT <213> Artificial sequence <220> <223> SARS-CoV-2 nucleocapsid protein sequence <400> 81 Ser Asp Asn Gly Pro Gin Asn Gin Arg Asn Ala Pro Arg lie Thr Phe 1 5 10 15 Gly Gly Pro Ser Asp Ser Thr Gly Ser Asn Gin Asn Gly Glu Arg Ser 20 25 30 Gly Ala Arg Ser Lys Gin Arg Arg Pro Gin Gly Leu Pro Asn Asn Thr 35 40 45 Ala Ser Trp Phe Thr Ala Leu Thr Gin His Gly Lys Glu Asp Leu Lys 50 55 60 Phe Pro Arg Gly Gin Gly Val Pro lie Asn Thr Asn Ser Ser Pro Asp 65 70 75 80 Asp Gin lie Gly Tyr Tyr Arg Arg Ala Thr Arg Arg lie Arg Gly Gly 85 90 95 Asp Gly Lys Met Lys Asp Leu Ser Pro Arg Trp Tyr Phe Tyr Tyr Leu 100 105 110 Gly Thr Gly Pro Glu Ala Gly Leu Pro Tyr Gly Ala Asn Lys Asp Gly 115 120 125 lie lie Trp Val Ala Thr Glu Gly Ala Leu Asn Thr Pro Lys Asp His 130 135 140 Ile Gly Thr Arg Asn Pro Ala Asn Asn Ala Ala Ile Val Leu Gin Leu 145 150 155 160 Pro Gin Gly Thr Thr Leu Pro Lys Gly Phe Tyr Ala Glu Gly Ser Arg 165 170 175 Gly Gly Ser Gin Ala Ser Ser Arg Ser Ser Ser Arg Ser Arg Asn Ser 180 185 190 Ser Arg Asn Ser Thr Pro Gly Ser Ser Arg Gly Thr Ser Pro Ala Arg 195 200 205 Met Ala Gly Asn Gly Gly Asp Ala Ala Leu Ala Leu Leu Leu Leu Asp 210 215 220 Arg Leu Asn Gin Leu Glu Ser Lys Met Ser Gly Lys Gly Gin Gin Gin 225 230 235 240 Gln Gly Gin Thr Val Thr Lys Lys Ser Ala Ala Glu Ala Ser Lys Lys 245 250 255 Pro Arg Gin Lys Arg Thr Ala Thr Lys Ala Tyr Asn Val Thr Gin Ala 260 265 270 Phe Gly Arg Arg Gly Pro Glu Gin Thr Gin Gly Asn Phe Gly Asp Gin 275 280 285 Glu Leu Ile Arg Gin Gly Thr Asp Tyr Lys His Trp Pro Gin Ile Ala 290 295 300 Gln Phe Ala Pro Ser Ala Ser Ala Phe Phe Gly Met Ser Arg Ile Gly 305 310 315 320 Met Glu Val Thr Pro Ser Gly Thr Trp Leu Thr Tyr Thr Gly Ala Ile 325 330 335 Lys Leu Asp Asp Lys Asp Pro Asn Phe Lys Asp Gln Val Ile Leu Leu 340 345 350 Asn Lys His Ile Asp Ala Tyr Lys Thr Phe Pro Pro Thr Glu Pro Lys 355 360 365 Lys Asp Lys Lys Lys Lys Ala Asp Glu Thr Gln Ala Leu Pro Gln Arg 370 375 380 Gln Lys Lys Gln Gln Thr Val Thr Leu Leu Pro Ala Ala Asp Leu Asp 385 390 395 400 Asp Phe Ser Lys Gln Leu Gln Gln Ser Met Ser Ser Ala Asp Ser Thr 405 410 415 Gln Ala

Claims

1. A composition for detecting a target analyte, the composition comprising a recognition reagent and a transduction reagent, wherein, the recognition reagent comprises an aptamer complex immobilized on a solid support; the transduction reagent comprises an activated double-stranded DNA linked to a single-stranded complementary DNA and a CRISPR / Cas12a-reporter system comprising a CRISPR / Cas12a system and a single-stranded DNA probe, wherein the activated double-stranded DNA linked to the single-stranded complementary DNA is linked to the aptamer complex via the single-stranded complementary DNA; wherein the aptamer complex comprises at least two aptamers capable of specifically recognizing different epitopes of the target analyte and a dendritic DNA, wherein the dendritic DNA comprises more than three branches, the at least two aptamers are immobilized on the solid support via the dendritic DNA, and the distance between the aptamer and the bifurcation of the dendritic DNA is 30-200 bases, wherein the activated double-stranded DNA has a double-stranded DNA capable of being recognized and cleaved by the CRISPR / Cas12a system and has at least two recognition and cleavage target sites in series, and the single-stranded DNA probe has a group capable of generating a detectable signal, wherein the sequence complementary to the aptamer in the single-stranded complementary DNA has an annealing temperature of 35-45℃ to the aptamer.

2. The composition of claim 1, wherein, The aptamer complex comprises 2-10 aptamers.

3. The composition of claim 2, wherein, The aptamer complex comprises 2-5 aptamers.

4. The composition of claim 2, wherein, The aptamer complex comprises 2-3 aptamers.

5. The composition of any one of claims 1-4, wherein, The dendritic DNA comprises 3, 4 or 5 branches.

6. The composition of any one of claims 1-4, wherein, The dendritic DNA is selected from Y-type dendritic DNA, X-type dendritic DNA, and T-type dendritic DNA.

7. The composition of any one of claims 1-4, wherein, The aptamer is directly or indirectly, covalently or non-covalently bound to the dendritic DNA.

8. The composition of any one of claims 1-4, wherein, The aptamer is linked to the dendritic DNA via a linker.

9. The composition of any one of claims 1-4, wherein, The aptamer comprises a binding moiety that binds to the target analyte and an additional base sequence.

10. The composition of claim 9, wherein, The additional base sequence is used to bind to a branch of the dendritic DNA or the linker and / or to provide a spacer region between the branch of the dendritic DNA and the binding moiety of the linked aptamer that binds to the target analyte.

11. The composition of claim 9, wherein, The additional base sequence is a sequence of 1-12 bases.

12. The composition of claim 9, wherein, The additional base sequence comprises polyA or polyT.

13. The composition of claim 12, wherein, The additional base sequence has a length of 6-12 bases.

14. The composition of claim 1, wherein, The branch in the dendritic DNA has a length of 15-50 bases.

15. The composition of claim 14, wherein, The branch in the dendritic DNA has a length of 18-25 bases.

16. The composition of claim 1, wherein, The solid support is a magnetic bead.

17. The composition of any one of claims 1-4, wherein, The single-stranded complementary DNA has a length of 5-20 bases.

18. The composition of any one of claims 1-4, wherein, The single-stranded complementary DNA has a length of 7-15 bases.

19. The composition of any one of claims 1-4, wherein, The single-stranded complementary DNA has a length of 8-13 bases.

20. The composition of any one of claims 1-4, wherein, The sequence complementary to the aptamer in the single-stranded complementary DNA has an annealing temperature of 40℃ to the aptamer.

21. The composition of any one of claims 1-4, wherein, The sequence complementary to the aptamer in the single-stranded complementary DNA is a nucleotide sequence of 7-18 bp when the GC content is 55%.

22. The composition of claim 21, wherein, The sequence of the single-stranded complementary DNA complementary to the aptamer is a nucleotide sequence of 11-14 bp when the GC content is 55%.

23. The composition of any one of claims 1-4, wherein, The single-stranded complementary DNA is complementary to 8-16 bp of one end of the aptamer.

24. The composition of claim 9, wherein, The additional base sequence is used to be complementary to the single-stranded complementary DNA.

25. The composition of claim 24, wherein, The single-stranded complementary DNA is complementary to the binding part of the aptamer, or is complementary to the binding part of the aptamer and the additional base sequence of the aptamer.

26. The composition of claim 24 or 25, wherein, The additional base sequence for being complementary to the single-stranded complementary DNA in the aptamer is a sequence of 5-18 bases.

27. The composition of claim 26, wherein, The additional base sequence for being complementary to the single-stranded complementary DNA in the aptamer is a sequence of 6-18 bases.

28. The composition of claim 26, wherein, The additional base sequence for being complementary to the single-stranded complementary DNA in the aptamer is a sequence of 6-14 bases.

29. The composition of claim 26, wherein, The additional base sequence for being complementary to the single-stranded complementary DNA in the aptamer is a sequence of 6-12 bases.

30. The composition of claim 26, wherein, The additional base sequence for being complementary to the single-stranded complementary DNA in the aptamer is a sequence of 6-11 bases.

31. The composition of claim 26, wherein, The additional base sequence for being complementary to the single-stranded complementary DNA in the aptamer is a sequence of 10-16 bases.

32. The composition of claim 26, wherein, The additional base sequence for being complementary to the single-stranded complementary DNA in the aptamer is a sequence of 11-14 bases.

33. The composition of claim 24 or 25, wherein, The additional base sequence for being complementary to the single-stranded complementary DNA in the aptamer comprises polyA or polyT, and the length of the polyA or polyT is 6-12 bases.

34. The composition of any one of claims 1-4, wherein, The single-stranded complementary DNA comprises a base sequence for being complementary to the activated double-stranded DNA at its 3' end and / or 5' end, and the length of the base sequence is 15-50 bases.

35. The composition of claim 34, wherein, The single-stranded complementary DNA comprises a base sequence for being complementary to the activated double-stranded DNA at its 3' end and / or 5' end, and the length of the base sequence is 15-35 bases.

36. The composition of claim 35, wherein, The single-stranded complementary DNA comprises a base sequence for being complementary to the activated double-stranded DNA at its 3' end and / or 5' end, and the length of the base sequence is 20-35 bases.

37. The composition of claim 35, wherein, The single-stranded complementary DNA comprises a base sequence for being complementary to the activated double-stranded DNA at its 3' end and / or 5' end, and the length of the base sequence is 30-35 bases.

38. The composition of any one of claims 1-4, wherein, The single-stranded DNA probe comprises a pair of fluorescent emitting dyes.

39. The composition of any one of claims 1-4, wherein, The activated double-stranded DNA has at least 3, 4, 5, 6, 7, 8, 9, 10 or more recognition and cleavage target sites in series.

40. The composition of claim 39, wherein, In the activated double-stranded DNA, the protospacer adjacent motif is arranged at intervals of at least 50 bp.

41. The composition of claim 40, wherein, For the activated double-stranded DNA with multiple target sites in series, the protospacer adjacent motif and the protospacer are the same or different.

42. The composition of any one of claims 1-4, wherein, The length of the activated double-stranded DNA is 500-2000 bp.

43. The composition of claim 42, wherein, The length of the activated double-stranded DNA is 500-3000 bp.

44. The composition of claim 42, wherein, The length of the activated double-stranded DNA is 600-700 bp.

45. The composition of any one of claims 1-4, wherein, The activating double-stranded DNA further comprises a single-stranded portion complementary to the single-stranded complementary DNA, wherein the length of the single-stranded portion is 16-60 bp.

46. The composition of claim 45, wherein, The activating double-stranded DNA further comprises a single-stranded portion complementary to the single-stranded complementary DNA, wherein the length of the single-stranded portion is selected from 15-50 bp.

47. The composition of claim 46, wherein, The length of the single-stranded portion is selected from 15-35 bp.

48. The composition of claim 46, wherein, The length of the single-stranded portion is selected from 18-35 bp.

49. The composition of claim 46, wherein, The length of the single-stranded portion is selected from 20-35 bp.

50. The composition of claim 46, wherein, The length of the single-stranded portion is selected from 18-30 bp.

51. The composition of claim 46, wherein, The length of the single-stranded portion is selected from 19-21 bp.

52. The composition of claim 46, wherein, The length of the single-stranded portion is selected from 20-25 bp.

53. The composition of claim 46, wherein, The length of the single-stranded portion is selected from 25-35 bp.

54. The composition of claim 46, wherein, The length of the single-stranded portion is selected from 30-25 bp.

55. The composition of any one of claims 1-4, wherein, The site on the single-stranded complementary DNA for ligation to the aptamer and the site for ligation to the activating double-stranded DNA are spaced 6-15 bp nucleotides apart.

56. The composition of any one of claims 1-4, wherein, The composition is used for detection of a virus.

57. The composition of claim 56, wherein, The composition is used for detection of nucleic acid, envelope protein, and nucleocapsid protein of a virus.

58. The composition of claim 57, wherein, The nucleic acid of the virus is selected from DNA, RNA, or a hybrid thereof.

59. The composition of any one of claims 1-4, wherein, The composition is used for detection of nucleic acid, envelope protein, and nucleocapsid protein in human immunodeficiency virus (HIV), severe acute respiratory syndrome coronavirus (SARS-CoV), Middle East respiratory syndrome coronavirus (MERS-CoV), influenza A H1N1 virus (H1N1), Ebola virus (EBOV), Zika virus (ZIKV), and novel coronavirus (SARS-CoV-2).

60. The composition of any one of claims 1-4, wherein, The composition is used for detection of one or more of RNA-dependent RNA polymerase (RdRP) and structural proteins in SARS-CoV-2.

61. The composition of claim 60, wherein, The structural proteins are selected from spike surface glycoprotein (Sp), small envelope protein (Ep), matrix protein (Mp), and nucleocapsid protein (Np).

62. The composition of claim 61, wherein, The aptamer to the nucleocapsid protein Np of the novel coronavirus is selected from the following: A48, whose nucleotide sequence is SEQ ID NO: 4; A58, whose nucleotide sequence is SEQ ID NO: 79; A15, whose nucleotide sequence is SEQ ID NO: 80; and A61, whose nucleotide sequence is SEQ ID NO: 5, or a variant thereof.

63. The composition of any one of claims 1-4, wherein, The composition is in the form of a biosensor.

64. A method of detecting a target analyte in a sample to be tested using the composition of any one of claims 1-63 for non-diagnostic purposes, the method comprising: mixing and incubating a sample to be tested with an aptamer complex and an activated double-stranded DNA linked to a single-stranded complementary DNA, wherein the activated double-stranded DNA linked to a single-stranded complementary DNA is pre-complementary linked to the aptamer complex; separating free activated double-stranded DNA linked to a single-stranded complementary DNA from the resulting mixture; contacting the separated free activated double-stranded DNA linked to a single-stranded complementary DNA with a CRISPR / Cas12a-reporter system, thereby generating a detectable signal; and determining the presence or amount of the target analyte in the sample based on the generated detectable signal.

65. The method of claim 64, wherein, The method comprises: (1) mixing and incubating a sample to be tested with a complex consisting of an aptamer complex and an activated double-stranded DNA linked to a single-stranded complementary DNA; (2) separating free activated double-stranded DNA linked to a single-stranded complementary DNA from the mixture in step (1); (3) adding a CRISPR / Cas12a protein, a gRNA and a single-stranded DNA probe to the separated free activated double-stranded DNA linked to a single-stranded complementary DNA in step (2), and detecting the generated detectable signal; and (4) analyzing the presence or amount of the target analyte based on the generated signal.

66. The method of claim 65, wherein, In step (4), the generated detectable signal is analyzed based on a reference level.

67. A kit for detecting a target analyte, the kit comprising the composition of any one of claims 1-63.

68. Use of the composition of any one of claims 1-63 in the manufacture of a kit for detecting a target analyte.

Images