A method for evaluating the growth of exogenous microorganisms in soil

The problem of the inability to quantitatively evaluate the growth of exogenous microorganisms in the prior art is solved by labeling exogenous microorganisms through H218O and combining ultra-high-speed density gradient centrifugation and quantitative PCR, and efficient and low-cost growth analysis is achieved.

CN115261498BActive Publication Date: 2025-08-19INST OF SOIL SCI CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210777730.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-04
Publication Date
2025-08-19
Estimated Expiration
2042-07-04

AI Technical Summary

Technical Problem

The prior art is difficult to effectively evaluate the growth of exogenous microorganisms in the soil, especially quantitative analysis, and sample processing costs are high and workloads are high.

Method used

H218O is used to label exogenous microorganisms, and the distribution proportion of different DNAs is determined by ultra-high-speed density gradient centrifugation and quantitative PCR, and the average density of exogenous microorganisms is calculated to achieve quantitative evaluation.

Benefits of technology

Quantitative evaluation of the growth of exogenous microorganisms is achieved, sample processing is simplified, cost is reduced, and analysis efficiency is improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115261498B_ABST
    Figure CN115261498B_ABST
Patent Text Reader

Abstract

The present invention proposes a method for evaluating the growth of exogenous microorganisms in soil, comprising the following steps: S1, adding exogenous microorganisms and H2 to dry soil 18 O to carry out soil culture test, collect soil samples and extract soil DNA; S2, H2 16 O and H2 18 O. Preparing a liquid culture medium for culturing exogenous microorganisms, collecting the obtained exogenous microorganisms and extracting DNA; S3. Dissolving the soil DNA obtained in S1 and the bacterial DNA sample in S2 in a cesium chloride solution and performing density gradient centrifugation to obtain the distribution ratios of different DNAs along the density gradient; S4. Determining the average density of the exogenous microbial DNA in the soil based on the obtained distribution ratios of the different DNAs to achieve a quantitative evaluation of the growth degree of the exogenous microorganisms; the present invention performs quantitative PCR analysis on unique gene fragments of exogenous microorganisms, which can eliminate the interference of other microorganisms in the soil and perform highly specific analysis of the exogenous microorganisms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of environmental microbiology, and in particular to a method for evaluating the growth of exogenous microorganisms in soil. Background Art

[0002] Soil is the foundation of life, and agriculture is the material basis of human survival. However, soil pollution is a serious problem in my country and around the world. Bioaugmentation has become an effective means of in-situ remediation of contaminated soil. Bioaugmentation involves introducing exogenous microorganisms with a specific ability to treat target pollutants into the target soil, leveraging their metabolic reactions to perform remediation. The ability of these exogenous microorganisms to grow and reproduce normally is crucial to the success of bioaugmentation. However, there is currently no clear method to characterize whether the added exogenous microorganisms can survive and reproduce long-term in the treated soil.

[0003] Adding functional microbial agents to the soil to degrade pollutants in the soil or promote plant growth is a very promising means of soil improvement. However, after exogenous microorganisms enter the soil, they face problems such as environmental inadaptability and competition from indigenous microorganisms, and are often difficult to survive. In order to develop efficient microbial agents suitable for soil, it is necessary to evaluate the growth potential of exogenous microorganisms in the soil in advance. All life requires water for growth. The vast majority of oxygen atoms in water molecules in nature are 16 O, natural abundance is more than 99%, while heavy isotopes 18 The natural abundance of O is only about 0.2%. Adding 18 O water, so that microorganisms can only take in 18 O, which enables the DNA of actively growing microorganisms to be 18 O mark, density increases.

[0004] At present, oxygen-18 ( 18 O) Isotope labeling method has become an important technology for evaluating soil microbial growth. In the existing method, for a specific soil sample, it is necessary to set up 18 O water and 16 O water treatment, soil DNA was extracted after cultivation, and after cesium chloride density gradient centrifugation, the distribution of microbial 16S rRNA gene quantity along the cesium chloride density gradient was determined by quantitative PCR and other methods. 18 O Water treatment group and 16 The distribution of the O treatment group was used to determine whether the microorganisms were 18 O mark and its approximate extent to qualitatively characterize the growth of microorganisms.

[0005] existing 18In O labeling technology, (1) the 16S rRNA gene copy number is usually used as an evaluation method. Since all microorganisms (bacteria) contain 16S rRNA genes, it is impossible to distinguish between exogenous microorganisms and indigenous microorganisms; (2) 18 O labeling treatment must also establish light isotope 16 O-labeled control, by comparison 18 O-labeled DNA and 16 The position of O-labeled DNA on the cesium chloride density gradient was confirmed 18 O's labeling effect on microorganisms. This approach is labor-intensive and costly, and difficult to implement when there are many soil samples. (3) Comparing the distribution of 16S rRNA genes along the cesium chloride density gradient can only be used for qualitative analysis and cannot achieve quantitative assessment of microbial growth. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to overcome the defects of the existing technology. The present invention proposes a method for evaluating the growth of exogenous microorganisms in soil to solve the problems raised in the above background technology.

[0007] To solve the above technical problems, the present invention adopts a technical solution: a method for evaluating the growth dynamics of exogenous microorganisms in soil, comprising the following steps:

[0008] S1. Adding exogenous microorganisms and H2 to dry soil 18 O Conduct soil culture tests, collect soil samples and extract soil DNA;

[0009] S2, H2 16 O and H2 18 O preparing a liquid culture medium for culturing exogenous microorganisms, collecting the obtained exogenous microorganisms and extracting DNA;

[0010] S3, respectively, the soil DNA obtained in S1 and the 16 O and 18 The O-labeled bacterial DNA sample was dissolved in a cesium chloride solution and subjected to ultra-high-speed density gradient centrifugation to obtain the distribution ratio of different DNA along the density gradient;

[0011] S4. Calculating the average density of exogenous microbial DNA in the soil based on the distribution ratios of the different DNAs obtained in S3, thereby achieving a quantitative evaluation of the growth degree of the exogenous microorganisms;

[0012] The exogenous microorganism is Sphingomonas wittichii DC-6, which is deposited in the Korean Agricultural Culture Collection (KACC) with a deposit number of KACC 16600.

[0013] Furthermore, in S1-S3, the obtained DNA samples were subjected to gene quantification using a quantitative PCR method. The primer sequences used in the quantitative PCR method are as follows: CndAF: CATCCAGTGCCCCTATCACG; CndAR: AATCGCAGTCGAGATGCAGG.

[0014] Furthermore,

[0015] In S1, quantitative PCR was used to quantify the DNA samples at each density level after ultracentrifugation. After weighted average calculation, the average density of DNA of exogenous microorganisms placed in the soil was obtained.

[0016] In S3, quantitative PCR was used to quantify the DNA samples at each density level after ultra-high-speed centrifugation. After weighted average calculation, the measured value was the 16 O and 18 The average density of O-labeled bacterial DNA.

[0017] Furthermore, the proportion of newly grown exogenous microbial DNA in the soil is 18 The ratio of the difference in the amount of O-labeled DNA to the total amount of exogenous microbial DNA in S1.

[0018] Furthermore, in S2, the liquid culture medium includes 10 mg / ml of tryptone, 5 mg / ml of yeast extract and 10 mg / ml of NaCl.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] (1) Quantitative PCR analysis of unique gene fragments of exogenous microorganisms is independent of the 16S rRNA gene, thus eliminating interference from other microorganisms in the soil and enabling highly specific analysis of exogenous microorganisms;

[0021] (2) 16 O and 18 The pre-labeled target microbial DNA was prepared into a DNA density standard. DNA from different soil sources was subjected to density gradient centrifugation and then compared with the density standard, thus avoiding the need to set up a density standard for each soil sample at the same time. 16 O and 18O labeling treatment doubles the sample throughput of the method;

[0022] (3) A weighted calculation method was proposed to indicate the degree of labeling of exogenous microorganisms by calculating the average density of microbial DNA, thereby achieving a quantitative assessment of microbial growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The disclosure of the present invention is illustrated with reference to the accompanying drawings. It should be understood that the drawings are for illustrative purposes only and are not intended to limit the scope of protection of the present invention. In the accompanying drawings, the same reference numerals are used to refer to the same components. Among them:

[0024] Figure 1 The relative distribution of CndA in each buoyant density layer is schematically shown. DETAILED DESCRIPTION

[0025] It is easy to understand that according to the technical solution of the present invention, without changing the essential spirit of the present invention, a person skilled in the art can propose a variety of interchangeable structural modes and implementation modes. Therefore, the following specific embodiments are merely illustrative of the technical solution of the present invention and should not be regarded as the entire invention or as a limitation or restriction of the technical solution of the present invention.

[0026] A method for evaluating the growth dynamics of exogenous microorganisms in soil comprises the following steps:

[0027] S1. Adding exogenous microorganisms and H2 to dry soil 18 O Conduct soil culture tests, collect soil samples and extract soil DNA;

[0028] S2, H2 16 O and H2 18 O preparing a liquid culture medium for culturing exogenous microorganisms, collecting the obtained exogenous microorganisms and extracting DNA;

[0029] S3, respectively, the soil DNA obtained in S1 and the 16 O and 18 The O-labeled bacterial DNA sample was dissolved in a cesium chloride solution and subjected to ultra-high-speed density gradient centrifugation to obtain the distribution ratio of different DNA along the density gradient;

[0030] S4. Calculating the average density of exogenous microbial DNA in the soil based on the distribution ratios of the different DNAs obtained in S3, thereby achieving a quantitative evaluation of the growth degree of the exogenous microorganisms;

[0031] In S1-S3, the obtained DNA samples were subjected to gene quantification using a quantitative PCR method. The primer sequences used in the quantitative PCR method are as follows: CndAF: CATCCAGTGCCCCTATCACG; CndAR: AATCGCAGTCGAGATGCAGG.

[0032] In S1, quantitative PCR was used to quantify the DNA samples at each density level after ultracentrifugation. After weighted average calculation, the average density of DNA of exogenous microorganisms placed in the soil was obtained.

[0033] In S3, quantitative PCR was used to quantify the DNA samples at each density level after ultra-high-speed centrifugation. After weighted average calculation, the measured value was the 16 O and 18 The average density of O-labeled bacterial DNA.

[0034] Let the proportion of exogenous microbial DNA in the soil be S, then Wherein, Δ is the 18 The amount of O-labeled DNA and the amount of S2 18 The difference in the amount of DNA labeled with O, A1+A2, is the total amount of DNA of exogenous microorganisms in S1.

[0035] In S2, the liquid culture medium included 10 mg / ml of tryptone, 5 mg / ml of yeast extract, and 10 mg / ml of NaCl.

[0036] The technical effects of the present application are further described below with reference to the embodiments.

[0037] Example: Determination of the growth of Sphingomonas wittichii DC-6 in soil

[0038] 1. Soil inoculation test

[0039] 1.1 Soil samples

[0040] Soil samples were collected from farmland in Lishu County, Changchun City, Jilin Province. The soil was air-dried and then ground to pass through a 2 mm sieve.

[0041] 1.2 Culture medium components

[0042] LB medium: tryptone 10 mg / ml, yeast extract 5 mg / ml, NaCl 10 mg / ml, water (H2 16 O) and dissolved to prepare LB medium.

[0043] 1.3 Preparation of inoculum

[0044] Inoculate Sphingomonas wittichii DC-6 in 50 ml 16 The cells were cultured in O-LB liquid medium at 28°C and 160 rpm for 3 days. The bacterial solution was centrifuged at 5000 rpm for 5 min, the cells were collected, washed twice with sterile water, and finally washed with 500 μl H2 18 O to prepare bacterial suspension.

[0045] 1.4 Soil cultivation

[0046] Use 4 mL ampoules to culture and set up two parallel cultures. Add 1.0 g of air-dried soil to each bottle and add 250 μL of H2 18 The resuspended bacterial suspension was placed in a 28°C constant temperature incubator and sampled after 7 days of incubation.

[0047] 1.5 Soil DNA extraction

[0048] DNA was extracted from the soil in the ampoule using the FastDNA spin kit for soil, and DNA concentration and purity were determined using a NanoDrop assay. Soil DNA is referred to as soil-DNA.

[0049] 2.H2 18 O and H2 16 O-labeled Sphingomonas wittichii DC-6 bacterial DNA

[0050] 2.1 Culture medium components

[0051] LB medium: tryptone 10 mg / ml, yeast extract 5 mg / ml, NaCl 10 mg / ml, with H2 18 O or H2 16 O was dissolved and prepared 18 O-LB or 16 O-LB medium.

[0052] 2.2 Sphingomonas wittichii DC-6 culture

[0053] Sphingomonas wittichii DC-6 was inoculated into 18 O-LB or 16 The cells were cultured in O-LB medium at 28°C and 160 rpm in a shaking incubator for 3 days.

[0054] 2.3 DNA extraction from Sphingomonas wittichii DC-6

[0055] The bacteria in the two culture media were collected by centrifugation at 5000 rpm for 5 min, DNA was extracted using a bacterial genomic DNA kit, and the DNA concentration and purity were detected by NanoDrop. 18 O-LB or 16 The bacterial DNA obtained from O-LB culture medium was recorded as 18 O-DNA and 16 O-DNA.

[0056] 3. Ultracentrifugation

[0057] 3.1 Preparation of experimental drugs and reagents

[0058] (1) Agarose (Helena, cat. no. 8201–07);

[0059] (2) Cesium chloride (CsCl) (Fisher Scientific, C / 0680 / 60);

[0060] (3) Ethylenediaminetetraacetic acid (EDTA, 0.5 M and pH 8.0) (Fisher Scientific, cat. no. BPE2482-500);

[0061] (4) Ethanol (reagent grade) (Sigma-Aldrich, cat. no. R8382);

[0062] (5) Glycogen (20 mg / ml) (Roche, cat. no. 10901393001);

[0063] (6) hydrochloric acid (HCl) (Fisher Scientific, cat. no. H / 1100 / PB17);

[0064] (7) Potassium chloride (KCl) (BDH, cat. no. 101984L);

[0065] (8) Sodium chloride (NaCl) (Fisher Scientific, cat. no. S / 3160 / 65);

[0066] (9) Polyethylene glycol 6000 (VWR, cat. no. 295774B);

[0067] (10) Mineral oil (Sigma-Aldrich, cat. no. M3516-1L);

[0068] (11) Sodium hydroxide (NaOH, pellets) (Fisher Scientific, cat. no. BPE359-500);

[0069] (12) Tris (Fisher Scientific, cat. no. T / P630 / 60);

[0070] (13) Tris-HCl (1.0 M, pH = 8.0), preparation method: dissolve 121.1 g of Tris base in 800 mL of ultrapure water, adjust the pH to 8.0 with hydrochloric acid, dilute to 1000 mL with ultrapure water, and filter through a 0.2 μm filter;

[0071] (14) TE Buffer (Tris-EDTA), preparation method: prepare TE buffer (10 mM Tris-HCl (pH = 8) and 1 mM EDTA (pH = 8.0) in ultrapure water and sterilize by autoclaving;

[0072] (15) Gradient Buffer [GB buffer contains 0.1 M Tris-HCl (pH = 8.0), 0.1 M KCl, and 1.0 mM EDTA]. Preparation method: Take 50 ml of Tris-HCl (1 M), 3.75 g of KCl, and 1.0 mL of 0.5 M EDTA in 400 ml of ultrapure water. After the KCl is dissolved, add ultrapure water to make up to 500 ml. Filter with a 0.2 μm filter and sterilize.

[0073] (16) 70% ethanol: add 350 ml of pure ethanol to 150 ml of ultrapure water;

[0074] (17) Cesium chloride solution (for gradient separation of DNA with different densities): Dissolve 603.0 g of CsCl in ultrapure water to a total volume of 500 ml (heating to 30°C facilitates the dissolution of CsCl). Filter through a 0.2 μm filter. The density at room temperature (20°C) is approximately 1.88–1.89 g / ml (1,4171,482.4 g / 400 ml).

[0075] (18) Polyethylene Glycol 6000 (PEG6000) solution: Dissolve 150 g of PEG 6000 and 46.8 g of NaCl in deionized water and make up to 500 ml; sterilize. The solution is 30% PEG 6000 and 1.6 M NaCl.

[0076] 3.2 Instruments and Equipment:

[0077] (1) Fluorescent projector (Clare Chemical, cat. no. DR45M);

[0078] (2) 5.1-ml polyallomer ultracentrifuge tubes (Beckman, cat. no. 342412);

[0079] (3) Fixed flow rate pump High-performance liquid chromatography (HPLC) pump (Sykam, cat. no. S1000);

[0080] (4) Microcentrifuge (Eppendorf, cat. no. 5415D);

[0081] (5) 19-gauge and 23-gauge needles; 10-ml and 20-ml syringes; rubber tubing (1.5 mm diameter, 1.5 mm wall thickness);

[0082] (6) Peristaltic pump (Watson Marlow Ltd, cat. no. 101U / R);

[0083] (7) Refractometer, AR200 digital (Reichert, cat. no. 13950000);

[0084] (8) Screw cap centrifuge tube, 15 ml (Greiner Bio-One, cat. no. 188271);

[0085] (9) Syringe filter, 0.2 mm (Whatman, cat. no. 10462200);

[0086] (10) Ultra-high-speed centrifugal tube sealing instrument, Tube sealer (Beckman Coulter, cat. no. 349646);

[0087] (11) Ultracentrifuge (Beckman Coulter, cat. no. 392049);

[0088] (12) Ultracentrifuge rotor, Vti 65.2 (Beckman Coulter, cat. no. 362754);

[0089] 3.3 Specific steps

[0090] (1) Adjust the cesium chloride solution to a density of 1.85 g / ml and a refractive index of 1.4153 ± 0.0002 under standard temperature mode (nD-TC);

[0091] (2) Gradient Buffer (GB) was mixed with 5 μg of soil DNA to make up to 1.2 ml;

[0092] (3) In a 15 ml centrifuge tube, add 4.8 ml of CsCl and 1.2 ml of GB + DNA solution in sequence;

[0093] (4) Gently invert the solution upside down to mix the cesium chloride solution, GB buffer, and DNA solution thoroughly;

[0094] (5) The refractive index of the mixed solution before centrifugation was measured using a refractometer and was 1.4029 ± 0.0002;

[0095] (6) Using a 10 ml syringe, transfer the mixture from step (5) to an ultracentrifuge tube;

[0096] (7) Weigh the corresponding paired centrifuge tubes to ensure that the weights of the two centrifuge tubes are equal;

[0097] (8) Seal the pipe;

[0098] (9) Place the balanced centrifuge tubes symmetrically in pairs into the rotor;

[0099] (10) Basic parameters of ultracentrifugation: centrifugal speed (44100 rpm, approximately 177000 × g), centrifugal time 40 h, centrifugal temperature 20°C;

[0100] (11) After ultrahigh-speed centrifugation, the centrifuge fluid was separated into 13 layers;

[0101] (12) The refractive index of the gradient liquid with different buoyancy density (a total of 15 layers) was measured using a refractometer. The empirical formula for the density of the centrifuged solution was used (ρ = -75.9318 + 99.2031x - 31.2551x 2 , ρ represents the buoyancy density, x represents the refractive index) calculate the buoyancy density of each layer of liquid;

[0102] (13) Add 2 volumes of PEG6000 solution to precipitate DNA;

[0103] (14) Centrifuge at 13,000 × g for 30 min and remove the supernatant;

[0104] (15) Add 500 μl of 70% ethanol, centrifuge at 13,000 g for 10 min, and remove the supernatant;

[0105] (16) Add 30 μl of TE buffer to dissolve and obtain DNA in each buoyant density layer.

[0106] 4. Determination of the Average Buoyant Density of Sphingomonas wittichii DC-6 in Bacterial DNA and Soil DNA

[0107] 4.1 Quantitative PCR analysis

[0108] Quantitative PCR assay of CndA gene was performed. The amplification primers were:

[0109] CndAF:CATCCAGTGCCCCTATCACG

[0110] CndAR:AATCGCAGTCGAGATGCAGG

[0111] qPCR reaction conditions: pre-denaturation at 94°C for 5 min; 30 cycles of 94°C for 30 s, 55°C for 45 s, and 72°C for 20 s; and 72°C for 10 min.

[0112] By comparing with the external standard, the copy number of CndA gene in the DNA of each buoyant density layer was calculated. After normalization, the relative distribution of CndA in each buoyant density layer was plotted as follows: Figure 1 shown.

[0113] 4.2 Calculation of average density

[0114] Using the weighted average method, calculate 18 O-DNA, 16 The average buoyancy density of O-DNA and Soil-DNA is:

[0115]

[0116] Where, is the average buoyant density; ρ i is the buoyancy density of each layer (g / ml); A i Refers to the relative abundance (%) of CndA genes in each layer.

[0117] Obtained by calculation 18 O-DNA, 16 The average density of Sphingomonas wittichii DC-6 in O-DNA and Soil-DNA were 1.7391, 1.7183, and 1.7251 g / ml, respectively.

[0118] 4.3 Calculation of soil DNA 18 O mark ratio

[0119] Calculated according to the formula:

[0120]

[0121] That is, after 7 days of cultivation, the newly grown Sphingomonas wittichii DC-6 in the soil accounted for 32.77% of the total number of Sphingomonas wittichii DC-6 in the soil.

[0122] The technical scope of the present invention is not limited to the contents of the above description. Those skilled in the art can make various deformations and modifications to the above embodiments without departing from the technical idea of the present invention, and these deformations and modifications should all fall within the protection scope of the present invention.

Claims

1. A method for evaluating the growth of exogenous microorganisms in soil, characterized in that: The steps include: S1. Adding exogenous microorganisms and H2 to dry soil 18 O Conduct soil culture tests, collect soil samples and extract soil DNA; S2, H2 16 O and H2 18 O preparing a liquid culture medium for culturing exogenous microorganisms, collecting the obtained exogenous microorganisms and extracting DNA; S3, respectively, the soil DNA obtained in S1 and the 16 O and 18 The O-labeled bacterial DNA sample was dissolved in a cesium chloride solution and subjected to ultra-high-speed density gradient centrifugation to obtain the distribution ratio of different DNA along the density gradient; S4. Calculating the average density of exogenous microbial DNA in the soil based on the distribution ratios of the different DNAs obtained in S3, thereby achieving a quantitative evaluation of the growth degree of the exogenous microorganisms; The exogenous microorganism is Sphingomonas wittichii DC-6, which is deposited in the Korean Agricultural Culture Collection (KACC) with the deposit number KACC 16600. In S1-S3, the obtained DNA samples are subjected to gene quantification using a quantitative PCR method. The quantitative PCR analysis steps are as follows: Quantitative PCR assay of CndA gene was performed, and the primer sequences were as follows: CndAF: CATCCAGTGCCCCTATCACG; CndAR: AATCGCAGTCGAGATGCAGG; qPCR reaction; The copy number of the CndA gene in the DNA of each buoyant density layer was calculated by comparing with an external standard. After normalization, the relative distribution of CndA in each buoyant density layer was obtained. The corresponding steps for calculating the average density in S4 are as follows: Using the weighted average method, calculate 18 O-DNA, 16 The average buoyancy density of O-DNA and Soil-DNA is as follows: ; Where, is the average buoyant density; ρ i is the buoyancy density of each layer; A i Refers to the relative abundance of CndA genes corresponding to each layer; Calculation of soil DNA 18 The O mark ratio is: 。 2. The method for evaluating the growth of exogenous microorganisms in soil according to claim 1, characterized in that: In S1, quantitative PCR was used to quantify the DNA samples at each density level after ultracentrifugation. After weighted average calculation, the average density of DNA of exogenous microorganisms placed in the soil was obtained. In S3, quantitative PCR was used to quantify the DNA samples at each density level after ultra-high-speed centrifugation. After weighted average calculation, the measured value was the 16 O and 18 The average density of O-labeled bacterial DNA.

3. The method for evaluating the growth of exogenous microorganisms in soil according to claim 2, characterized in that: The proportion of newly grown exogenous microbial DNA in the soil is from S2 to S3. 18 The ratio of the difference in the amount of O-labeled DNA to the total amount of exogenous microbial DNA in S1.

4. The method for evaluating the growth of exogenous microorganisms in soil according to claim 1, characterized in that: In S2, the liquid culture medium includes 10 mg / ml of tryptone, 5 mg / ml of yeast extract, and 10 mg / ml of NaCl.