Compositions comprising nucleic acid oligomers

By mixing nucleic acid oligomers with alkylammonium salts, water-soluble organic solvents, and additives to form a reverse-phase chromatography composition, the stability problem of thiophosphate bonded nucleic acid oligomers was solved, achieving an efficient manufacturing method and a stable nucleic acid oligomer composition.

CN115397831BActive Publication Date: 2026-02-24SUMITOMO CHEM CO LTD
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
CN202180028331.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-04-14
Filing Date
2021-03-31
Publication Date
2026-02-24
Estimated Expiration
2041-03-31

AI Technical Summary

Technical Problem

During the manufacturing process, the stability problem of nucleic acid oligomers with thiophosphate bonds has not been effectively solved.

Method used

By mixing nucleic acid oligomers with alkyl ammonium salts, water-soluble organic solvents, water, and specific additives to form a reverse-phase chromatography composition, nucleic acid oligomers with thiophosphate bonds can be stabilized and efficiently manufactured.

Benefits of technology

Stable compositions of nucleic acid oligomers containing thiophosphate bonds and efficient manufacturing methods thereof are provided, which improve the stability and manufacturing efficiency of nucleic acid oligomers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115397831B_ABST
    Figure CN115397831B_ABST
Patent Text Reader

Abstract

The present invention provides a stable composition comprising a nucleic acid oligomer having a phosphorothioate bond, a production method thereof, and an efficient production method of the aforementioned nucleic acid oligomer from the composition. The present invention provides a composition comprising an additive, the aforementioned additive comprising a nucleic acid oligomer having a phosphorothioate bond represented by formula (1) (in the formula, the symbols are the same as defined in the specification), an alkylammonium salt, a water-soluble organic solvent, water, and at least one compound described in the specification.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This patent application asserts priority and interests under the Paris Convention based on Japanese Patent Application No. 2020-072234 (filed on April 14, 2020), the entire contents of which are incorporated herein by reference.

[0002] This invention relates to compositions comprising nucleic acid oligomers. The invention further relates in detail to compositions comprising nucleic acid oligomers containing thiophosphates. Background Technology

[0003] In recent years, interest in the application of nucleic acid oligomers in the medical field has been growing. Examples include antisense nucleic acids, aptamers, ribozymes, and siRNAs, which induce RNA interference (RNAi) and are collectively known as nucleic acid drugs.

[0004] Nucleic acid oligomers are known to be synthesized using solid-phase synthesis, and nucleic acid oligomers with thiophosphate bonds are also known as useful compounds synthesized by solid-phase synthesis (Patent Document 1).

[0005] Existing technical documents

[0006] Patent documents

[0007] Patent Document 1: International Publication No. 2017 / 068377 Summary of the Invention

[0008] The problem that the invention aims to solve

[0009] The stability of nucleic acid oligomers containing thiophosphate bonds during their manufacturing process is a concern. The object of this invention is to provide stable compositions comprising nucleic acid oligomers containing thiophosphate bonds, methods for manufacturing the same, and efficient methods for manufacturing the aforementioned nucleic acid oligomers from the compositions.

[0010] Methods for solving problems

[0011] To achieve the aforementioned objectives, the inventors of this application conducted repeated and meticulous research, and as a result discovered that a composition obtained by mixing a nucleic acid oligomer with an alkylammonium salt, a water-soluble organic solvent, water, and a certain additive can be stabilized. The aforementioned nucleic acid oligomer is obtained by reverse-phase chromatography treatment of a crude product of a nucleic acid oligomer containing thiophosphate bonds generated using the phosphorous acid method in solid-phase synthesis. Therefore, this invention provides the composition, a method for manufacturing the same, and an efficient method for manufacturing nucleic acid oligomers from the composition.

[0012] This invention includes, but is not limited to, the following methods.

[0013] Item 1. A composition, wherein the aforementioned composition comprises:

[0014] The nucleic acid oligomer having a thiophosphate bond shown in formula (1), an alkylammonium salt, a water-soluble organic solvent, water, and an additive, wherein the additive is an additive comprising at least one compound selected from the group consisting of compounds represented by formula (3) or (4) below.

[0015] [Chemical Formula 1]

[0016]

[0017] In equation (1),

[0018] B C Each independently represents the same or different nucleic acid bases.

[0019] R can be the same or different from each other, each independently representing a hydrogen atom, a fluorine atom, or an OQ group.

[0020] Q can be the same or different from each other, each independently representing a hydrogen atom, methyl, 2-methoxyethyl, methylene bonded to the carbon atom at the 4' position of ribose, ethylene bonded to the carbon atom at the 4' position of ribose, or ethionyl group bonded to the carbon atom at the 4' position of ribose.

[0021] X may be the same or different from each other, each independently representing an oxygen atom or a sulfur atom.

[0022] Y represents a protecting group for a hydrogen atom or a hydroxyl group.

[0023] G represents ammonium ion, alkylammonium ion, alkali metal ion, hydrogen ion, or hydroxyalkylammonium ion.

[0024] n is an integer that satisfies equation (2).

[0025] 15≤n (2);

[0026] The compound represented by formula (3):

[0027] R a (R c )CH-L-CH(R d )R b (3)

[0028] In equation (3),

[0029] L represents -S- or -SS-.

[0030] R a and R b They may be the same or different from each other, each independently representing a hydrogen atom, or may be chosen from the following Z... 1 and Z 2At least one group in the group consists of C1-6 alkyl groups that are substituted with other groups.

[0031] Z 1 :-CH(NHR 1 COR 2

[0032] Z 2 :-COR 2

[0033] Z 1 and Z 2 middle,

[0034] R 1 This indicates a hydrogen atom, a protecting group of an amino group, or a C(O)-R group. 11 base,

[0035] R 11 The term refers to a C1-6 alkyl group that can be substituted with at least one group selected from the group consisting of amino and carboxyl groups, or a phenyl group that can be substituted with at least one group selected from the group consisting of amino and carboxyl groups.

[0036] R 2 This indicates a C1-6 alkylimino group that can be substituted with a protected carboxyl group, or -OR 20 base, R 20 Protecting groups that represent hydrogen atoms or carboxyl groups.

[0037] R c and R d They may be the same or different from each other, each independently representing a hydrogen atom or a C1-6 alkyl group;

[0038] The compound shown in formula (4):

[0039] [Chemical Formula 2]

[0040]

[0041] In equation (4),

[0042] L has the same meaning as mentioned above.

[0043] R e and R f They may be identical or different from each other, each independently representing a hydrogen atom, a C1-6 alkoxy-carbonyl group, a carboxyl group, or a C1-6 alkyl group that can be substituted by a C1-6 alkoxy-carbonyl group or a carboxyl group, where X, L, and the carbon atoms they are bonded to form a five- or six-membered ring structure, and...

[0044] X represents any group selected from CH2, CH2CH2, (CH3)CHCH2, (CH3CH2)CHCH2, CH2CH2CH2, (CH3)CHCH2CH2, CH2(CH3)CHCH2, CH=N, (CH3)C=N, CH2NH, (CH3)CHNH, (CH3)2CNH, (COOH)CHNH, CH2OCH2, CH2NHCH2, and CH2COCH2.

[0045] Item 2. The composition as described in item 1 above, wherein,

[0046] R 1 This indicates a hydrogen atom, a protecting group of an amino group, or a C(O)-R group. 11 base,

[0047] R 11 It represents a C1-6 alkyl group that can be substituted with at least one group selected from the group consisting of amino and carboxyl groups, and,

[0048] X represents any group selected from CH2, CH2CH2, (CH3)CHCH2, (CH3CH2)CHCH2, CH2CH2CH2, (CH3)CHCH2CH2, CH2(CH3)CHCH2, CH=N, (CH3)C=N, CH2NH, (CH3)CHNH, (COOH)CHNH, CH2OCH2, and CH2COCH2.

[0049] Item 3. The composition as described in item 1 or 2 above, wherein,

[0050] R 1 Represents hydrogen atom, benzoyl group, 4-methoxybenzoyl group, formyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, phenylacetyl group, phenoxyacetyl group, 4-tert-butylphenoxyacetyl group, 4-isopropylphenoxyacetyl group, benzyloxycarbonyl group, 9-fluorenylmethyloxycarbonyl group, or C(O)-R 11 base,

[0051] R 11 It refers to a C1-6 alkyl group that can be substituted by at least one group selected from the group consisting of amino and carboxyl groups.

[0052] R 2 This indicates a C1-6 alkylimino group that can be substituted with a carboxyl group protected by methyl, benzyl, allyl, or tert-butyl groups, or -OR 20 base, R 20 This represents a hydrogen atom, methyl, benzyl, allyl, or tert-butyl, and...

[0053] X represents any group selected from CH2, CH2CH2, (CH3)CHCH2, (CH3CH2)CHCH2, CH2CH2CH2, (CH3)CHCH2CH2, CH2(CH3)CHCH2, CH=N, (CH3)C=N, CH2NH, (COOH)CHNH, CH2OCH2, and CH2COCH2.

[0054] Item 4. The composition as described in any one of items 1 to 3 above, wherein,

[0055] R e and R f They may be the same or different from each other, each independently representing a hydrogen atom, a carboxyl group, or a C1-6 alkyl group, and,

[0056] X represents any group selected from CH2, (CH3)C=N, CH2NH, CH2OCH2, and CH2COCH2.

[0057] Item 5. The composition as described in any one of items 1 to 4 above, wherein,

[0058] R 1 Represents hydrogen atom, benzoyl group, formyl group, acetyl group, benzyloxycarbonyl group and 9-fluorenylmethyloxycarbonyl group, or C(O)-R 11 base,

[0059] R 11 It represents a C1-6 alkyl group that can be substituted with at least one group selected from the group consisting of amino and carboxyl groups, and,

[0060] R 2 This indicates a C1-6 alkylimino group that can be substituted with a carboxyl group that can be protected by a methyl group, or -OR 20 base, R 20 It represents a hydrogen atom or a methyl group.

[0061] Item 6. The composition as described in any one of items 1 to 5 above, wherein the additive is at least one compound selected from the group consisting of:

[0062] α-Lipoic acid,

[0063] Methionine,

[0064] N-formylmethionine,

[0065] N-acetylated methionine,

[0066] N-benzoylmethionine,

[0067] N-Benzyloxycarbonyl-methionine,

[0068] N-Fmoc-methionine,

[0069] Methionine methyl ester hydrochloride,

[0070] Dibutyl sulfide,

[0071] Dihexyl sulfide

[0072] Thiazolidine-2-carboxylic acid,

[0073] 2-Isobutyl-4,5-dimethyl-3-thiazoline (mixture of isomers)

[0074] 4-Thiocyclohexanone,

[0075] 1,4-Thiaxane, and

[0076] Oxidized glutathione.

[0077] Item 7. The composition as described in any one of items 1 to 6 above, wherein the aforementioned additive is at least one compound selected from the group consisting of lipoic acid, oxidized glutathione and methionine.

[0078] Item 8. The composition as described in any one of items 1 to 7 above, wherein the aforementioned alkylammonium salt is at least one alkylammonium salt selected from the group consisting of monoalkylammonium salts and dialkylammonium salts.

[0079] Item 9. The composition as described in any one of items 1 to 8 above, wherein the aforementioned water-soluble organic solvent is a water-soluble organic solvent selected from the group consisting of alcohol-based water-soluble organic solvents and nitrile-based water-soluble organic solvents.

[0080] Item 10. The composition as described in any one of items 1 to 9 above, wherein in the aforementioned formula (1), R independently represents a hydroxyl or a methoxyl group.

[0081] Item 11. The composition as described in any one of items 1 to 9 above, wherein R in the aforementioned formula (1) is a hydroxyl group.

[0082] Item 12. A method for manufacturing nucleic acid oligomers, comprising mixing the composition described in any one of items 1 to 11 above with an organic solvent having at least one oxygen atom in the C1-C4 group, and separating the precipitated nucleic acid oligomers.

[0083] Item 13. A method for manufacturing the composition according to any one of items 1 to 12 above, comprising mixing a column eluent containing a nucleic acid oligomer of formula (1), an alkylammonium salt, a water-soluble organic solvent and water with an additive, wherein the aforementioned nucleic acid oligomer is obtained by reverse-phase column chromatography of a crude product of a nucleic acid oligomer of formula (1) synthesized by solid-phase synthesis.

[0084] The effects of the invention

[0085] This invention provides a stable composition comprising a nucleic acid oligomer having a thiophosphate bond, and an efficient method for manufacturing the aforementioned nucleic acid oligomer using the composition. Attached Figure Description

[0086] [ Figure 1 ] Figure 1 A diagram illustrating an example of synthesizing nucleic acid oligomers using the phosphoramide method. Detailed Implementation

[0087] The composition is described in that it comprises a nucleic acid oligomer having a thiophosphate bond as shown in formula (1), an alkylammonium salt, a water-soluble organic solvent, water, and an additive, wherein the additive is at least one compound selected from the group consisting of compounds having a disulfide bond and compounds having a thioether bond.

[0088] In the aforementioned equation (1), B C The nucleic acid base represented (hereinafter also referred to as "base") can be a natural or non-natural nucleic acid base. Examples of modified analogs of natural or non-natural nucleic acid bases can be shown as non-natural nucleic acid bases. Typical examples of nucleic acid bases include purine and pyrimidine compounds, such as those disclosed in U.S. Patent No. 3,687,808, "Concise Encyclopedia Of Polymer Science and Engineering," pp. 858-859, edited by Kroschwitz JI, John Wiley & Sons, 1990, and Englisch et al., Angewandte Chemie, International Edition, 1991, Vol. 30, p. 613.

[0089] Specifically, examples include purine bases such as adenine, isoguanine, xanthine, hypoxanthine, and guanine; and pyrimidine bases such as cytosine, uracil, and thymine.

[0090] And, as B CThe nucleic acid bases represented may include, for example, amino derivatives such as 2-aminoadenine, 2-aminopurine, and 2,6-diaminopurine; alkyl derivatives such as 5-methyluracil, 5-methylcytosine, 7-methylguanine, 6-methylpurine, and 2-propylpurine; 5-halouracil and 5-halocytosine; 5-propynyluracil and 5-propynylcytosine; 6-azauracil, 6-azacytosine, and 6- Azathymine; 5-uracil (pseudouracil), 4-thiouracil, 5-(2-aminopropyl)uracil, 5-aminoallyluracil; 8-halogenated, amination-modified, thiolated, thioalkylated, hydroxylated and other 8-substituted purines; 5-trifluoromethylated and other 5-substituted pyrimidines; 6-azapyrimidine; N-2, N-6 and O-6 substituted purines (including 2-aminopropyladenine); dihydrouracil Pyridine; 3-Deazo-5-azacytosine; 7-Deazoadenine; N6-methyladenine, N6,N6-dimethyladenine; 5-amino-allyl-uracil; N3-methyluracil; substituted 1,2,4-triazoles; 2-hydroxypyridine; 5-nitroindole; 3-nitropyrrole; 5-methoxyuracil; uracil-5-oxyacetic acid; 5-methoxycarbonylmethyluracil; 2-thiouracil, 5-methyl 2-Thiouracil; 5-methoxycarbonylmethyl-2-thiouracil; 5-methylaminomethyl-2-thiouracil; 3-(3-amino-3-carboxypropyl)uracil; 3-methylcytosine; N4-acetylcytosine; 2-thiocytosine; N6-methyladenine; N6-isopentyladenine; 2-methylthio-N6-isopentenyladenine; N-methylguanine; O-alkylated bases, etc.

[0091] When R represents an OQ group and Q represents a methylene group bonded to a carbon atom at the 4' position of the ribose, an ethylene group bonded to a carbon atom at the 4' position of the ribose, or an ethimide group bonded to a carbon atom at the 4' position of the ribose, the structure is as shown in the structures of LNA-1, LNA-2 and LNA-3 in formula (3) below.

[0092] [Chemical Formula 3]

[0093]

[0094] (where B is in the formula) c This represents the same nucleic acid bases as described above.

[0095] As a protecting group for the hydroxyl group represented by Y, it can be used without particular limitation as long as it can function as a protecting group in the amide process. For example, known protecting groups used for amide compounds can be widely used. The protecting group for the hydroxyl group represented by Y is preferably the following group.

[0096] [Chemical Formula 4]

[0097]

[0098] (where R is in the formula) 1 R 2 and R 3 (Whether they are the same or different from each other, each independently representing hydrogen or alkoxy groups)

[0099] As an example of the aforementioned alkoxy group, a methoxy group may be cited.

[0100] The chain length of the nucleic acid oligomer in formula (1) is n≥15. As an upper limit for the chain length, n≤200 can be exemplified, for example. In the aforementioned nucleic acid oligomer, at least one of the n X atoms is a sulfur atom, or all X atoms can be sulfur atoms. For example, in the case of n=103, the number of sulfur atoms can be exemplified as 6, 12 or 20.

[0101] The nucleic acid oligomers of formula (1) can be, for example, DNA or RNA oligomers, or oligomers containing non-natural nucleic acid bases. The aforementioned nucleic acid oligomers are typically single-stranded DNA or RNA oligomers. In the aforementioned nucleic acid oligomers of formula (1), the substituent R is preferably independently hydroxyl or methoxy. As the aforementioned nucleic acid oligomers, RNA as a nucleic acid oligomer of formula (1) (with each substituent R independently being hydroxyl or methoxy) is preferred. More specifically, nucleic acid oligomers comprising both nucleotides with hydroxyl substituent R and nucleotides with methoxy substituent R are preferred.

[0102] The concentration of the nucleic acid oligomer in the aforementioned composition is typically 0.05 mg / mL to 5 mg / mL, preferably 0.05 mg / mL to 1 mg / mL, and more preferably 0.1 mg / mL to 0.5 mg / mL.

[0103] As the aforementioned alkylammonium salts, monoalkylammonium salts, dialkylammonium salts, and trialkylammonium salts are commonly used, with monoalkylammonium salts and dialkylammonium salts being preferred, and dialkylammonium salts being more preferred. The monoalkylamine forming the monoalkylammonium salt preferably has 3 to 10 carbon atoms, more preferably 4 to 6, and even more preferably hexylamine. The dialkylamine forming the dialkylammonium salt preferably has 4 to 10 carbon atoms, more preferably 5 to 9. A preferred dialkylamine is dibutylamine. The trialkylamine forming the trialkylammonium salt preferably has 6 to 12 carbon atoms, more preferably 6 to 9, and triethylamine is a specific example.

[0104] Examples of acids that form the aforementioned monoalkylammonium salts, dialkylammonium salts, and trialkylammonium salts include carbonic acid, acetic acid, formic acid, trifluoroacetic acid, and propionic acid.

[0105] The concentration of the aforementioned ammonium salt is typically 1–200 mM, preferably 5–150 mM, and more preferably 20–100 mM.

[0106] Examples of water-soluble solvents include alcohol-based organic solvents and nitrile-based organic solvents. The amount of alcohol-based organic solvent in the aforementioned composition is typically 0-20%, preferably 0-15%, and more preferably 0%-10%. The eluent fraction obtained by reversed-phase column chromatography typically contains water, a water-soluble solvent (e.g., alcohol-based organic solvent, nitrile-based organic solvent), an alkylammonium salt, and a nucleic acid oligomer of formula (1). The amount of nitrile-based organic solvent in the above eluent is typically 10-70%, preferably 20-60%, and more preferably 30-50% (all percentages above represent mass %).

[0107] The amount of water is sufficient to achieve a balance by satisfying the concentration range of the aforementioned components, typically 90% to 30%, preferably 80% to 40%, and more preferably 70% to 40%.

[0108] The additives represented by the aforementioned formula (3) will be explained below.

[0109] Z 1 In, as R 1 The protecting group of the amino group is not particularly limited, and known protecting groups can be used. Specific protecting groups include, for example, benzoyl, 4-methoxybenzoyl, formyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, benzyloxycarbonyl, and 9-fluorenylmethyloxycarbonyl (Fmoc group). Preferred protecting groups include benzoyl, formyl, benzyloxycarbonyl, and 9-fluorenylmethyloxycarbonyl.

[0110] As R 11 The C1-6 alkyl group represented may be substituted with at least one group selected from the group consisting of amino and carboxyl groups, for example (CH2)2CH(NH2)(COOH) group, and the phenyl group may be substituted with at least one group selected from the group consisting of amino and carboxyl groups, for example phenyl, aminophenyl and carboxyphenyl, etc.

[0111] Preferred R 11 Examples include C1-6 alkyl groups (e.g., (CH2)2CH(NH2)(COOH) group) that can be substituted with at least one group selected from the group consisting of amino and carboxyl groups.

[0112] Z 1 and Z 2 In the middle, as COR 2 Examples of radicals include the COOH radical and the COOR radical. 20 base, R 20The protecting group of the carboxyl group is not particularly limited, and known protecting groups can be used, such as methyl, benzyl, allyl and tert-butyl.

[0113] As R 2 The C1-6 alkylimino group represented may be substituted with a protected carboxyl group, for example, methylimino, ethylimino, propylimino, butylimino, pentylimino, and hexylimino, or groups obtained by substituting these groups with a carboxyl group that may be protected by methyl, benzyl, allyl, or tert-butyl. Preferably, the C1-6 alkylimino group may be substituted with a carboxyl group that may be protected by methyl, for example, the NHCH2CO2H group is a preferred group.

[0114] As an additive represented by formula (3), examples include methionine, oxidized glutathione, N-formylmethionine, N-acetyl-DL-methionine, N-benzoyl-DL-methionine, N-benzyloxycarbonyl-DL-methionine, N-Fmoc-L-methionine, L-methionine methyl ester hydrochloride, dibutyl sulfide and dihexyl sulfide.

[0115] Next, the definition of the compound represented by equation (4) will be explained.

[0116] First, R e and R f Among the groups represented, methyl, ethyl, propyl, isobutyl, n-butyl, pentyl, and hexyl can be exemplified as constituting alkoxycarbonyl and alkyl groups of C1-6.

[0117] As R e and R f The indicated group is preferably a hydrogen atom, a carboxyl group, or a C1-6 alkyl group.

[0118] As R e Or R f Specific examples of the groups represented may include carboxyl, isobutyl, (CH2)4CO2H and CO2C2H5.

[0119] Examples of X include the groups described in formula (4) as above, with preferred X being CH2, CH2CH2, (CH3)CHCH2, (CH3CH2)CHCH2, CH2CH2CH2, (CH3)CHCH2CH2, CH2(CH3)CHCH2, CH=N, (CH3)C=N, CH2NH, (CH3)CHNH, (COOH)CHNH, CH2OCH2, and CH2COCH2.

[0120] Further preferred are CH2, (CH3)C=N, CH2NH, CH2OCH2 and CH2COCH2.

[0121] Specifically, examples of compounds represented by formula (4) include α-lipoic acid, thiazoline-2-carboxylic acid, and 2-isobutyl-4,5-dimethyl-3-thiazoline (a mixture of isomers).

[0122] These additives are typically used in the form of aqueous solutions or solutions of water-soluble organic solvents.

[0123] The concentration of the aforementioned additive is typically 0.1 μM to 100 mM, preferably 1 mM to 10 mM.

[0124] Besides purchasing, the aforementioned additives can be obtained, for example, through the methods disclosed in Japanese Patent Nos. 4,476,386, 5,317,836, and "Fundamentals of modern peptide synthesis", pp. 3-24, edited by John Howl, Muriel Amblard, Jean-Alain Fehrentz, and Jean Martinez, Methods in Molecular Biology (trademark) book series, volume 298, 2005.

[0125] The compositions of the present invention are generally obtained by adding the aforementioned additives to a column eluent obtained by reverse-phase column chromatography of a crude product of a nucleic acid oligomer of formula (1) synthesized by solid-phase synthesis (using a mobile phase containing an alkylammonium salt, a water-soluble organic solvent, and water). Alternatively, the compositions of the present invention can be formulated as elution fractions of reverse-phase column chromatography using a mobile phase pre-containing the aforementioned additives.

[0126] For the elution fractions obtained using reversed-phase column chromatography, the composition is analyzed by UV absorption at a wavelength of 260 nm under chromatographic conditions typically used for the separation and analysis of nucleic acids, and the fractions are selected and collected. The purified target analyte, namely a nucleic acid oligomer containing a specified amount of phosphate thioester bonds, is obtained from the collected fractions. As an example of the aforementioned analytical method, the method described in non-patent literature (Handbook of Analysis of Oligonucleotides and Related Products, CRCPress) can be used.

[0127] Regarding the packing material for the aforementioned reversed-phase column chromatography, examples of silica or polymers that serve as hydrophobic stationary phases include those immobilized with one or more of the following: phenyl, alkyl groups having 1 to 20 carbon atoms, and cyanopropyl groups. For example, silica or polymers with a particle size of 2 μm or more, or 5 μm or more, are used as the packing material.

[0128] As the mobile phase for reversed-phase column chromatography, for example, the following mobile phases are used: a mobile phase comprising an aqueous solution of an ammonium salt at the concentration and pH described above, and a mobile phase comprising the aforementioned water-soluble organic solvent, used in a gradient of increasing concentrations. The temperature for reversed-phase column chromatography is typically 20–100°C, preferably 30–80°C, and more preferably 40–70°C. The compositions of the present invention are typically obtained in the form of eluent fractions for reversed-phase column chromatography as described above.

[0129] For the compositions of the present invention, one or more post-processing steps selected from reprecipitation steps for separating nucleic acid oligomers, liquid separation steps, ultrafiltration steps, deprotection steps, and freeze-drying steps may be applied after the preservation step. In the preservation step, the atmosphere inside the preservation container may also be replaced by using an inert gas. Examples of inert gases include nitrogen, argon, and helium.

[0130] In the reprecipitation step, contacting the stabilized solution with a poor solvent allows nucleic acid oligomers to precipitate and separate. If necessary, the precipitated nucleic acid oligomers can be collected and separated by filtration or the like after removing the liquid portion in a solid-liquid separation state. Examples of poor solvents for the reprecipitation step include C1-C4 organic solvents having at least one oxygen atom (e.g., C1-C4 alcohols, tetrahydrofuran, dioxane). Ethanol or isopropanol are preferred as such solvents.

[0131] In the separation process, at least one of the following is mixed into the stabilized solution: an acidic aqueous solution such as acetic acid, water, and saline solution. An organic solvent that does not mix with water is then added, thereby separating the solution into an aqueous layer and an organic layer. This allows the acquisition of an aqueous layer containing the desired nucleic acid oligomer.

[0132] In the ultrafiltration process, an ultrafiltration membrane can be used to separate nucleic acid oligomers present in the solution after the preservation process from low molecular weight components below the desired molecular weight.

[0133] In cases where there is a protecting group at the 5' end of a nucleic acid oligomer, in order to deprotect it, the protecting group of the nucleic acid oligomer can be deprotected by mixing an acidic aqueous solution such as acetic acid solution with the solution after the preservation process, or by dissolving an acidic substance such as acetic acid in an organic solvent.

[0134] In the freeze-drying process, the water sublimates by reducing the pressure of the aqueous solution of the frozen nucleic acid oligomer, thereby separating the nucleic acid oligomer from the water.

[0135] The synthesis of nucleic acid oligomers using the phosphoramidite method can be carried out by nucleic acid extension reactions according to known methods (e.g., the methods described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Examples of nucleic acid oligomer production using the phosphoramidite method include... Figure 1 The synthesis of RNA shown in the diagram is used as an example to illustrate the method for manufacturing nucleic acid oligomers, referring to the reaction pathways (condensation reaction, oxidation, deprotection) shown below.

[0136] In the aforementioned chemical formula representing the reaction pathway, B a Tr represents a protected nucleic acid base; X is defined as above; SP represents the portion of the inorganic porous carrier other than the nucleoside structure.

[0137] The inorganic porous carrier with nucleoside structure (Sp-Nu) and the nucleoside constituting the amide monomer (Am-1) have the same nucleic acid bases as those mentioned above or nucleic acid bases protected by protecting groups.

[0138] As examples of preferred amide monomers (Am-1), in compounds represented by the following chemical formula (Am-1'), where R represents the protected hydroxyl group, specific protecting groups include those protected by tert-butyldimethylsilyl (TBDMS), bis(2-acetoxy)methyl (ACE), (triisopropylsiloxy)methyl (TOM), (2-cyanoethoxy)ethyl (CEE), (2-cyanoethoxy)methyl (CEM), p-toluenesulfonylethoxymethyl (TEM), (2-cyanoethoxy)methoxymethyl (EMM), etc., such as TBDMS amides (TBDMS RNA Amidites, trade name, ChemGenesCorporation), ACE amides, TOM amides, CEE amides, CEM amides, and TEM amides (Chakhmakhcheva). Chemistry, 2013, Vol.39, No.1, pp.1-21.), EMM amide (described in International Publication No. 2013 / 027843), etc.

[0139] [Chemical Formula 5]

[0140]

[0141] (In the formula, R represents the same group as described above, B) a (Indicates the nucleic acid bases that can be protected)

[0142] [Solid-phase synthesis of RNA]

[0143] The Tr group of an inorganic porous support (Sp-Nu) is deprotected to obtain a solid support (Am-2). Then, an amide monomer (Am-1) and the solid support (Am-2) undergo a condensation reaction to obtain a reaction product (Am-3). The reaction product (Am-3) is then oxidized to obtain a product (Am-4). The product (Am-4) is then deprotected (-Tr) to obtain a product (Am-5). Next, the amide monomer (Am-1) and the product (Am-5) undergo a further condensation reaction to extend the phosphodiester bond. Thus, a necessary series of deprotection, condensation, and oxidation reactions are repeated at the 5' hydroxyl group at the end of the extended oligonucleotide chain to achieve the desired sequence. The resulting molecule is then cleaved from the solid support, thereby producing a nucleic acid molecule with the desired sequence. This synthesis can also be performed using an automated nucleic acid synthesis apparatus employing the phosphoramidite method. RNA is used as an example here, but it can also be applied to nucleic acid compounds containing nucleotides other than ribonucleotides.

[0144] In the deprotection process of the Tr group, the protecting group at the 5' position of the hydroxyl group at the end of the RNA strand supported on the solid-phase support is deprotected. Triphenylmethyl-based protecting groups (typically DMTr groups) are used as the protecting group. Deprotection can be performed using acids. Examples of acids used for deprotection include trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0145] In the condensation process, the 5' hydroxyl group at the end of the RNA strand, which has undergone the aforementioned deprotection process, is bonded to a nucleoside phosphoramide to generate a phosphite. The aforementioned nucleoside phosphoramide is a nucleoside phosphoramide whose 5' hydroxyl group is protected by a protecting group (e.g., a DMTr group).

[0146] Furthermore, the condensation process can be carried out using an activator that activates the aforementioned nucleoside phosphoramidide. Examples of activators include 5-benzylthio-1H-tetrazazole (BTT), 1H-tetrazazole, 4,5-dicyanimidazazole (DCI), 5-ethylthio-1H-tetrazazole (ETT), N-methylbenzimidazolium trifluoromethanesulfonate (N-MeBIT), benzimidazolium trifluoromethanesulfonate (BIT), N-phenylimidazolium trifluoromethanesulfonate (N-PhIMT), imidazolium trifluoromethanesulfonate (IMT), 5-nitrobenzimidazolium trifluoromethanesulfonate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazazole (Activator-42).

[0147] After the condensation step, the unreacted 5' hydroxyl group can also be capped. Known capping solutions such as acetic anhydride-tetrahydrofuran solution and phenoxyacetic anhydride / N-methylimidazole solution can be used for this purpose.

[0148] The oxidation process is a process of oxidizing the phosphite formed by the aforementioned condensation process. The oxidation process can be carried out using an oxidizing agent. Examples of oxidizing agents include iodine, m-chloroperoxybenzoic acid, tert-butyl hydroperoxide, 2-butanone peroxide, bis(trimethylsilyl)peroxide, 1,1-dihydroperoxycyclododecane, and hydrogen peroxide.

[0149] In the case of converting the phosphite triester group to the thiophosphate triester group, the "oxidizing agent" can be, for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazolin-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazolin-3-one (POS), [(N,N-dimethylaminomethylene)amino]-3H-1,2,4-dithiazolin-3-thione (DDTT), and phenylacetyl disulfide (PADS). This oxidizing agent can be used by dilution with a suitable solvent to a concentration of 0.001 to 2 M. The solvent used in the reaction is not particularly limited as long as it does not participate in the reaction; examples include dichloromethane, acetonitrile, pyridine, or mixtures thereof in any proportion.

[0150] The oxidation process can be performed after the aforementioned capping operation, or conversely, the capping operation can be performed after the oxidation process; the order is not limited.

[0151] By returning to the deprotection step after the oxidation step and repeating the above series of steps of condensation, oxidation, and deprotection according to the nucleotide sequence of the nucleic acid oligomer to be synthesized, RNA with the desired sequence can be synthesized.

[0152] After the synthesis of nucleic acid oligomers with the desired sequence is completed, the RNA strand is cleaved and recovered from the solid-phase support using an ammonia or amine compound.

[0153] Examples of amine compounds mentioned here include methylamine, ethylamine, isopropylamine, ethylenediamine, diethylamine, and triethylamine.

[0154] The resulting nucleic acid oligomers can be exemplified by chain lengths of n ≥ 60, n ≥ 80, or n ≥ 100, and n ≤ 200. Preferably, n ≥ 60. Specifically, for example, n = 67, 100, or 120.

[0155] The deprotection process for the phosphate protecting group involves using an amine compound after the synthesis of the nucleic acid having the desired sequence to deprotect the phosphate moiety. Examples of amine compounds include, for instance, diethylamine.

[0156] In the case of a protecting group at the 2' or 3' position of the ribose, it can be removed by the methods described in International Publication No. 2006 / 022323, International Publication No. 2013 / 027843, or International Publication No. 2019 / 208571.

[0157] Example

[0158] The present invention will be further described in detail below with reference to embodiments, but the present invention is not limited thereto.

[0159] Determination methods

[0160] The measurement methods used in the following experiments are shown below.

[0161] (Method 1: Method for determining the purity of RNA)

[0162] The purity of RNA in the separated solution was determined by HPLC. The separated RNA was isolated into individual components using HPLC (wavelength 260 nm, column DNAPac™ PA200, 4.0 mm × 250 mm, 8.0 μm). The RNA purity was calculated from the peak area of ​​the main product in the total peak area of ​​the obtained chromatogram. The HPLC determination conditions are shown in Table 1 below.

[0163] [Table 1]

[0164]

[0165] [Reference Example 1]

[0166] Amide-based solid-phase synthesis of RNA

[0167] An RNA with the nucleic acid sequence I shown below was synthesized. This strand consists of 103 bases in length.

[0168] Chain I: A*U*A*ACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGU UAU CAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU*U*U*U(5'-3')(Sequence Number 1)

[0169] In the aforementioned sequence annotations, the asterisk (*) between nucleotides indicates that the phosphate bond connecting the nucleotides is a phosphate thioester.

[0170] The RNA was synthesized from the 3' to the 5' side using a nucleic acid synthesizer (AKTA oligopi lot plus 100 GE Healthcare) based on the phosphoramide method. The synthesis was carried out at a scale of 63 μmol. In addition, the following reagents were used for this synthesis: uridine EMMamide (described in Example 2 of International Publication No. 2013 / 027843), cytidine EMMamide (described in Example 3 of International Publication No. 2013 / 027843), adenosine EMMamide (described in Example 4 of International Publication No. 2013 / 027843), and guanosine EMMamide (described in Example 5 of International Publication No. 2013 / 027843) were used as RNA amides, respectively. Porous glass was used as the solid-phase support, dichloroacetic acid toluene solution was used as the deprotection solution, 5-benzylthio-1H-tetrazole was used as the condensing agent, iodine solution was used as the oxidizing agent, 3-amino-1,2,4-dithiazol-5-thione was used as the sulfiding agent, and phenoxyacetic anhydride solution and N-methylimidazole solution were used as the capping solution. After nucleic acid extension, the cyanoethyl protecting group of the phosphate moiety was selectively deprotected by acting a diethylamine solution on the nucleic acid on the support. Here, EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl.

[0171] [Chemical Formula 6]

[0172]

[0173] The excision and deprotection of the solid-phase support after solid-phase synthesis were performed according to the method described in International Publication No. 2013 / 027843. Specifically, an aqueous ammonia solution and ethanol were added, and after standing for a period of time, the solid-phase support was filtered, and the solvent was removed by distillation. Then, the hydroxyl groups were deprotected using tetrabutylammonium fluoride. The obtained RNA was dissolved in distilled water for injection to achieve the desired concentration.

[0174] RNA separation and purification

[0175] Column chromatography purification was performed under the conditions specified in Table 2 below. Before purification, mobile phase A was circulated through the column at a flow rate of 4.7 mL / min for 12.5 minutes, followed by the addition of the sample. The solution was separated at a retention time of 94.2-95.8 minutes, and analyzed by HPLC. It should be noted that purity was calculated using the method described in Method 1 above. The result was a purity of 94.2%. The purified RNA solution was used to perform experiments in the following examples and comparative examples.

[0176] [Table 2]

[0177]

[0178] [Example 1]

[0179] 99 μL of the purified RNA solution obtained by reverse-phase column chromatography in Reference Example 1 was placed in a 300 mL polypropylene tubular vial (Thermo Fisher Scientific). 1 μL of an acetonitrile solution of thioctic acid was mixed as an additive solution to prepare the sample of the specified concentration. The vial containing the mixed solution was placed in a temperature-controlled incubator (Kenis Scientific) at 60 °C and allowed to stand for 8 hours. After standing, the polypropylene tubular vial was removed from the incubator and cooled to room temperature. The purity was calculated using the method described in Method 1 above. The results are shown in Table 3.

[0180] According to calculations, the composition of lipoic acid at a concentration of 3 mM (0.07%) has the following composition: water: 63.79%, acetonitrile: 34.89%, dibutylamine: 0.84%, acetic acid: 0.39% (1.23% as dibutylammonium acetate), nucleic acid concentration: 0.21 mg / mL (0.02%).

[0181] [Example 2]

[0182] As an additive solution, an aqueous solution of methionine was prepared to a concentration of 3 mM (0.05%) to replace the acetonitrile solution of lipoic acid in Example 1. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 3.

[0183] [Example 3]

[0184] As an additive solution, an aqueous solution of oxidized glutathione was added to prepare a solution with an oxidized glutathione concentration of 0.15 mM (0.01%) to replace the acetonitrile solution of lipoic acid in Example 1. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA after the experiment was determined. The results are shown in Table 3.

[0185] [Comparative Example 1]

[0186] 100 μL of the purified RNA solution obtained by reverse-phase column chromatography in Reference Example 1 was placed into a 300 mL polypropylene tubular bottle (Thermo Fisher Scientific). The tubular bottle containing the solution was then placed in an incubator (Kenis Scientific) set to 60 °C and allowed to stand for 8 hours. After standing, the polypropylene tubular bottle was removed from the incubator and cooled to room temperature. The purity was calculated using the method described in Method 1 above. The results are shown in Table 3.

[0187] [Comparative Example 2]

[0188] As additive solutions, aqueous solutions of cysteine, N-acetylcysteine ​​in acetonitrile, reduced glutathione, dithiothreitol, L-ascorbic acid, or sodium hyposulfite were used at specified concentrations instead of the acetonitrile solution of lipoic acid in Example 1. The experiments were conducted under the same conditions. The results are shown in Table 3.

[0189] [Table 3]

[0190]

[0191] 1) indicates the purity of the nucleic acid (purity of 94.2%) prepared in Reference Example 1 after standing at 60°C for 8 hours.

[0192] 2) Nucleic acid retention rate (%) = Nucleic acid purity after standing / Nucleic acid purity before standing

[0193] [Example 4] (Recovery of RNA from a purified RNA solution)

[0194] The solution prepared in Example 1, containing 3 mM lipoic acid and allowed to stand at 60°C for 8 hours, was processed as follows: 80 μL of the solution was placed in a 15 mL polypropylene centrifuge tube (Corning Corporation), and 40 μL of sodium acetate aqueous solution (3 M, pH = 5.2) and 240 μL of ethanol were added. The resulting slurry was centrifuged at 3000 g and 25°C for 10 minutes, and the supernatant was removed. Then, the process of adding 200 μL of 70% ethanol aqueous solution and centrifuging at 3000 g and 25°C for 10 minutes, followed by supernatant removal, was repeated twice to obtain RNA. The obtained RNA was dissolved in 80 μL of water, and the purity was calculated to be 85.8% using the method described in Method 1 above.

[0195] [Comparative Example 3]

[0196] The solution from Comparative Example 1, which had been allowed to stand at 60°C for 8 hours, was processed as follows: 80 μL of the solution was placed in a 15 mL polypropylene centrifuge tube (Corning Corporation), and 40 μL of sodium acetate aqueous solution (3M, pH = 5.2) and 240 μL of ethanol were added. The resulting slurry was centrifuged at 3000 g and 25°C for 10 minutes, and the supernatant was removed. Then, the process of adding 200 μL of 70% ethanol aqueous solution and centrifuging at 3000 g and 25°C for 10 minutes and removing the supernatant was repeated twice to obtain RNA. The obtained RNA was dissolved in 80 μL of water, and the purity of the RNA fraction was calculated using the method described in Method 1 above. The purity was 70.9%.

[0197] [Reference Example 2]

[0198] Amide-based solid-phase synthesis of RNA

[0199] Synthesize an RNA having the nucleic acid sequence shown as II below. This strand consists of 67 bases in length.

[0200] Chain II: Am*Gm*Cm*AmUmAmGmCAAGUUAmAAAUAAGGmC*U*AmG*U*C*CmGUUAUCAAmCmUmUmGmAmAmAmAmAmGmUmGGCACmCmGmAGUCGGmUmGmCm*Um*Um*U(5'-3')(Serial Number 2)

[0201] In the aforementioned sequence notation, the asterisk (*) between nucleotides indicates that the phosphate bond connecting the nucleotides is a phosphate thioester. The letters Am, Um, Cm, and Gm indicate nucleotides where the 2' hydroxyl group has been replaced with a methoxy group. This RNA was synthesized from the 3' to the 5' side using a nucleic acid synthesizer (AKTA oligopi lot plus 100, GE Healthcare) based on the phosphorusamide method. Synthesis was performed at a scale of 53 μmol. In addition, the following reagents were used for the synthesis: uridine EMM amide (described in Example 2 of International Publication No. 2013 / 027843), cytidine EMM amide (described in Example 3 of International Publication No. 2013 / 027843), adenosine EMM amide (described in Example 4 of International Publication No. 2013 / 027843), and guanosine EMM amide (described in Example 5 of International Publication No. 2013 / 027843) were used as RNA amides; and uridine 2'OMe amide, cytidine 2'OMe amide, adenosine 2'OMe amide, and guanosine 2'OMe amide of the following formulas were used, with porous glass as the solid phase support, dichloroacetic acid toluene solution as the deprotection solution, 5-benzylthio-1H-tetrazole as the condensing agent, iodine solution as the oxidizing agent, 3-amino-1,2,4-dithiazol-5-thione as the sulfiding agent, and phenoxyacetic anhydride solution and N-methylimidazole solution as the capping solution. After nucleic acid extension, the cyanoethyl protecting group of the phosphate moiety is selectively deprotected by applying a diethylamine solution to the nucleic acid on the support. Here, EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl.

[0202] [Chemical Formula 7]

[0203]

[0204] The excision and deprotection of the solid-phase support after solid-phase synthesis were performed according to the method described in International Publication No. 2013 / 027843. Specifically, an aqueous ammonia solution and ethanol were added, and after standing for a period of time, the solid-phase support was filtered, and the solvent was removed by distillation. Then, the hydroxyl groups were deprotected using tetrabutylammonium fluoride. The obtained RNA was dissolved in distilled water for injection to achieve the desired concentration.

[0205] RNA separation and purification

[0206] Column chromatography purification was performed under the conditions specified in Table 4 below. Before purification, mobile phase A was circulated through the column at a flow rate of 4.7 mL / min for 12.5 minutes, followed by the addition of the sample. The solution was separated at a retention time of 66.7-70.9 minutes, and analyzed by HPLC. It should be noted that purity was calculated using the method described in Method 1 above. The result was a purity of 94.2%. The purified RNA solution was used to perform experiments in the following examples and comparative examples.

[0207] [Table 4]

[0208]

[0209] [Example 5]

[0210] 99 μL of the purified RNA solution obtained by reverse-phase column chromatography in Reference Example 2 was placed in a 300 mL polypropylene tubular bottle (Thermo Fisher Scientific). 1 μL of an aqueous solution of L-methionine was mixed in as an additive solution to prepare a 1.5 mM L-methionine sample. The tubular bottle containing the mixed solution was placed in an incubator (Kenis Scientific) set to 60 °C and allowed to stand for 8 hours. After standing, the polypropylene tubular bottle was removed from the incubator and cooled to room temperature. The purity was calculated using the method described in Method 1 above. The results are shown in Table 5.

[0211] Based on calculations, the composition for preparing L-methionine at a concentration of 1.5 mM (0.02%) has the following composition: Water: 62.95%, Acetonitrile: 32.21%, Methanol: 3.59%, Dibutylamine: 0.82%, Acetic acid: 0.38% (1.20% as dibutylammonium acetate), Nucleic acid concentration: 0.31 mg / mL (0.03%).

[0212] [Example 6]

[0213] As an additive solution, a methanol solution of N-formyl-L-methionine was prepared to a concentration of 3 mM (0.06%) to replace the aqueous solution of L-methionine in Example 5. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0214] [Example 7]

[0215] As an additive solution, a methanol solution of N-acetyl-DL-methionine was prepared to a concentration of 3 mM (0.06%) to replace the aqueous solution of L-methionine in Example 5. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0216] [Example 8]

[0217] As an additive solution, a methanol solution of N-benzoyl-DL-methionine was prepared to a concentration of 3 mM (0.08%) to replace the aqueous solution of L-methionine in Example 5. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0218] [Example 9]

[0219] As an additive solution, a methanol solution of N-benzyloxycarbonyl-DL-methionine was prepared to a concentration of 3 mM (0.12%) to replace the aqueous solution of L-methionine in Example 5. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0220] [Example 10]

[0221] As an additive solution, a solution of N-Fmoc-L-methionine dissolved in a mixed solvent of methanol and acetonitrile (mixing ratio 50:50 (v / v)) was used to prepare a 3 mM (0.10%) N-Fmoc-L-methionine solution instead of the aqueous solution of L-methionine in Example 5. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0222] [Example 11]

[0223] As an additive solution, an aqueous solution of L-methionine methyl ester hydrochloride was prepared to a concentration of 3 mM (0.07%) to replace the aqueous solution of L-methionine in Example 5. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0224] [Example 12]

[0225] As an additive solution, an acetonitrile solution of dibutyl sulfide was prepared to a concentration of 3 mM (0.05%) to replace the aqueous solution of L-methionine in Example 5. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0226] [Example 13]

[0227] As an additive solution, an acetonitrile solution of dihexyl sulfide was used to prepare a 3 mM (0.07%) solution of dibutyl sulfide instead of the aqueous solution of L-methionine in Example 5. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0228] [Example 14]

[0229] As an additive solution, an aqueous solution of thiazolidin-2-carboxylic acid was prepared to a concentration of 3 mM (0.04%) to replace the aqueous solution of L-methionine in Example 5. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0230] [Example 15]

[0231] As an additive solution, an acetonitrile solution of 2-isobutyl-4,5-dimethyl-3-thiazoline (isomer mixture) was prepared to a concentration of 3 mM (0.06%) to replace the aqueous solution of L-methionine in Example 5. Otherwise, the experiment was performed under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0232] [Example 16]

[0233] As an additive solution, an acetonitrile solution of 4-thiocyclohexanone was prepared to a concentration of 3 mM (0.04%) to replace the aqueous solution of L-methionine in Example 5. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0234] [Example 17]

[0235] As an additive solution, an acetonitrile solution of 1,4-thiaoxane was prepared to a concentration of 3 mM (0.03%) to replace the aqueous solution of L-methionine in Example 5. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0236] [Comparative Example 4]

[0237] 100 μL of the purified RNA solution obtained by reverse-phase column chromatography in Reference Example 2 was placed into a 300 mL polypropylene tubular bottle (Thermo Fisher Scientific). The tubular bottle containing the solution was then placed in an incubator (Kenis Scientific) set to 60 °C and allowed to stand for 8 hours. After standing, the polypropylene tubular bottle was removed from the incubator and cooled to room temperature. The purity was calculated using the method described in Method 1 above. The results are shown in Table 5.

[0238] [Table 5]

[0239]

[0240] 1) indicates the purity of the nucleic acid (purity of 94.2%) prepared in Reference Example 2 after standing at 60°C for 8 hours.

[0241] 2) Nucleic acid retention rate (%) = Nucleic acid purity after standing / Nucleic acid purity before standing

[0242] [Reference Example 3]

[0243] RNA separation and purification

[0244] The RNA obtained in Reference Example 2, which underwent hydroxyl deprotection using tetrabutylammonium fluoride, was purified by column chromatography under the conditions described in Table 6 below. Before purification, mobile phase A was circulated through the column at a flow rate of 4.7 mL / min for 12.5 minutes, followed by the addition of the sample. The solution was separated at a retention time of 91.7-94.2 minutes and analyzed by HPLC. It should be noted that purity was calculated using the method described in Method 1 above. The result was a purity of 95.1%. The purified RNA solution was used to perform experiments in the following examples and comparative examples.

[0245] [Table 6]

[0246]

[0247] [Example 18]

[0248] 99 μL of the purified RNA solution obtained by reverse-phase column chromatography in Reference Example 3 was placed in a 300 mL polypropylene tubular bottle (Thermo Fisher Scientific). 1 μL of an acetonitrile solution of α-lipoic acid was mixed as an additive solution to prepare a 3 mM α-lipoic acid sample. The tubular bottle containing the mixed solution was placed in an incubator (Kenis Scientific) set to 60 °C and allowed to stand for 14 hours. After standing, the polypropylene tubular bottle was removed from the incubator and cooled to room temperature. The purity was calculated using the method described in Method 1 above. The results are shown in Table 7.

[0249] Based on calculations, the composition of α-lipoic acid at a concentration of 3.0 mM (0.07%) has the following composition: Water: 59.69%, Acetonitrile: 35.38%, Methanol: 3.84%, Hexylamine: 0.61%, Acetic acid: 0.36% (0.97% as hexylammonium acetate), Nucleic acid concentration: 0.35 mg / mL (0.04%).

[0250] [Example 19]

[0251] As an additive solution, an aqueous solution of L-methionine was prepared to a concentration of 3 mM (0.05%) to replace the acetonitrile solution of α-lipoic acid in the experiment of Example 18. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA after the experiment was determined. The results are shown in Table 7.

[0252] [Example 20]

[0253] As an additive solution, an aqueous solution of DL-methionine was prepared to a concentration of 3 mM (0.05%) to replace the acetonitrile solution of α-lipoic acid in the experiment of Example 18. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA after the experiment was determined. The results are shown in Table 7.

[0254] [Example 21]

[0255] As an additive solution, an aqueous solution of oxidized glutathione was used to prepare a solution with an oxidized glutathione concentration of 3 mM (0.01%) to replace the acetonitrile solution of α-lipoic acid in the experiment of Example 18. Otherwise, the experiment was performed under the same conditions, and the purity of the RNA after the experiment was determined. The results are shown in Table 7.

[0256] [Comparative Example 5]

[0257] 100 μL of the purified RNA solution obtained by reverse-phase column chromatography in Reference Example 3 was placed into a 300 mL polypropylene tubular bottle (Thermo Fisher Scientific). The tubular bottle containing the solution was then placed in an incubator (Kenis Scientific) set to 60 °C and allowed to stand for 14 hours. After standing, the polypropylene tubular bottle was removed from the incubator and cooled to room temperature. The purity was calculated using the method described in Method 1 above. The results are shown in Table 7.

[0258] [Comparative Example 6]

[0259] As additive solutions, acetonitrile solutions of isobutylene sulfide or acetonitrile solutions of 4-tert-butyldiphenyl sulfide were used at specified concentrations instead of the acetonitrile solution of lipoic acid in Example 18, and the experiments were conducted under the same conditions. The results are shown in Table 7.

[0260] [Table 7]

[0261]

[0262] 1) indicates the purity of the nucleic acid (purity of 95.1%) prepared in Reference Example 3 after standing at 60°C for 8 hours.

[0263] 2) Nucleic acid retention rate (%) = Nucleic acid purity after standing / Nucleic acid purity before standing. Industrial availability.

[0264] According to the present invention, a composition stabilizing a nucleic acid oligomer having thiophosphate bonds can be obtained, and thus, the composition can be manufactured efficiently.

[0265] [Sequence List Free Text]

[0266] Sequence numbers 1 and 2 in the sequence listing represent the base sequences of oligonucleotides manufactured according to the manufacturing method of the present invention.

Claims

1. A composition comprising an eluent obtained by reverse-phase chromatography of a crude product of a nucleic acid oligomer of formula (1) having thiophosphate bonds synthesized by solid-phase synthesis, and an additive, wherein the reverse-phase chromatography uses a mobile phase containing an alkylammonium salt, a water-soluble organic solvent, and water, wherein the alkylammonium salt is a monoalkylammonium salt, a dialkylammonium salt, or a trialkylammonium salt, and the acid forming the alkylammonium salt is carbonic acid, acetic acid, formic acid, trifluoroacetic acid, or propionic acid, and the additive comprises... The compound is selected from at least one compound chosen from the group consisting of methionine, N-formylmethionine, N-acetylmethionine, N-benzoylmethionine, N-benzyloxycarbonyl-methionine, N-Fmoc-methionine, methionine methyl ester hydrochloride, dibutyl sulfide, dihexyl sulfide, thiazoline-2-carboxylic acid, a mixture of isomers of 2-isobutyl-4,5-dimethyl-3-thiazoline, 4-thiocyclohexanone, 1,4-thiaoxane, and oxidized glutathione. In equation (1), B C Each independently represents the same or different nucleic acid bases. R can be the same or different from each other, each independently representing a hydrogen atom, a fluorine atom, or an OQ group. Q can be the same or different from each other, each independently representing a hydrogen atom, methyl, 2-methoxyethyl, methylene bonded to the carbon atom at the 4' position of ribose, ethylene bonded to the carbon atom at the 4' position of ribose, or ethionyl group bonded to the carbon atom at the 4' position of ribose. X may be the same or different from each other, each independently representing an oxygen atom or a sulfur atom. Y represents a protecting group for a hydrogen atom or a hydroxyl group. G represents ammonium ion, alkylammonium ion, alkali metal ion, hydrogen ion, or hydroxyalkylammonium ion. n is an integer that satisfies equation (2). 60≤n (2)。 2. The composition of claim 1, wherein, The additive is at least one compound selected from the group consisting of oxidized glutathione and methionine.

3. The composition according to claim 1 or 2, wherein, The water-soluble organic solvent is selected from the group consisting of alcohol-based water-soluble organic solvents and nitrile-based water-soluble organic solvents.

4. The composition according to claim 1 or 2, wherein, In formula (1), R independently represents either a hydroxyl group or a methoxy group.

5. The composition according to claim 1 or 2, wherein, In formula (1), R is a hydroxyl group.

6. A method for manufacturing nucleic acid oligomers, comprising mixing the composition of any one of claims 1 to 5 with an organic solvent having at least one oxygen atom in the C1-C4 group, and separating the precipitated nucleic acid oligomers.

7. A method for manufacturing the composition according to any one of claims 1 to 5, comprising mixing a column eluent containing a nucleic acid oligomer of formula (1), an alkylammonium salt, a water-soluble organic solvent and water with an additive, wherein the nucleic acid oligomer is obtained by reverse-phase column chromatography of a crude product of a nucleic acid oligomer of formula (1) synthesized by solid-phase synthesis.

Citation Information

Patent Citations

  • Hokoseibutsutaikyokyusochi

    JP1976057168A

  • Fuel control system

    JP1978017836A

  • Preparation of sweettboiled chestnut

    JP1980054881A

  • Electronic equipment and flexible printed circuit board

    JP2020072234A

  • Synthetic polynucleotides

    US3687808A