A new broad-spectrum antibacterial gene and its application

Abstract

The present invention provides a novel broad-spectrum antibacterial gene and its application. The gene is named Xa46 gene, which can enhance the antibacterial ability of Gramineae plants, and can be used in combination with one or more other antibacterial genes (such as Xa21) to obtain polymer plant materials, thereby further increasing the antibacterial spectrum of plants.

Description

Technical Field

[0001] The present invention belongs to the field of botany and molecular biology; more specifically, the present invention relates to a novel antibacterial gene and application thereof, wherein the gene has a broad-spectrum antibacterial property against bacterial blight. Background Art

[0002] With the rapid increase of world population, the improvement of urbanization level and the expansion of industrial construction land, the arable land area and agricultural population are decreasing. How to use limited resources to achieve high grain yield as much as possible is the focus of this field. Reducing crop diseases and pests and promoting good and healthy growth of crops is also an important aspect.

[0003] Cereals are important crops, and how to grow more crops on limited arable land has always been the focus of agricultural workers. In particular, rice (Oryza sativa), a grass plant, is the staple food of nearly half of the world's population. However, in addition to abiotic stresses such as drought and floods, rice planting and growth are also subject to bacterial blight caused by the Gram-negative bacterium Xanthomonas oryzae pv.oryzae (Xoo), which is one of the most serious bacterial diseases in rice cultivation worldwide, seriously affecting rice production, especially in Asia such as China, Japan, and India. In China, the area south of the Yangtze River is a high-incidence area for bacterial blight, and it also occurs in many other provinces and regions. Breeding practice has proved that researching and cultivating resistant rice varieties is the most economical, effective and environmentally friendly means of preventing and controlling bacterial blight, and the discovery of antibacterial genes is the basis and key to the success of antibacterial breeding.

[0004] At present, 45 bacterial blight resistance genes have been identified and reported and have been internationally registered, of which 15 have been cloned, including Xa1, Xa3 / Xa26, Xa4, xa5, Xa7, Xa10, xa13, Xa21, Xa23, xa25, Xa27, xa41, Xa2 / Xa31, Xa14 and Xa45; among them, Xa2 / Xa31, Xa14 and Xa45 are the latest reported alleles of Xa1. Among the existing antibacterial genes, about 66% are dominant antibacterial genes, and recessive antibacterial genes include xa5, xa8, xa13, xa15, xa19, xa20, xa24, xa25, xa28, xa32, xa33, xa34, xa41, xa42, xa42, etc. About 33% of the above antibacterial genes are distributed on chromosome 11. The recessive gene is xa41, and the dominant genes include Xa3 / Xa26, Xa4, Xa10, Xa21, Xa22, Xa23, Xa30, Xa32, Xa35, Xa36, Xa39, Xa40, and Xa43.

[0005] The resistance genes described above encode different types of proteins, which can be divided into the following categories according to their structures and functions: (1) Antimicrobial genes encoding NBS-LRR protein receptors: Xa1 is the earliest reported NLR gene, which specifically mediates resistance to Japanese Race I subspecies (T7174) and is induced to express by bacterial blight infection and damage. Currently, Xa2 / Xa31, Xa14, and Xa45 have recently been reported as homologous genes of Xa1, which also encode NLR proteins; (2) Antimicrobial genes encoding MtN3 / saliva family proteins, also known as SWEET proteins, such as xa13, xa25, xa41, etc., which produce antibacterial properties due to promoter mutations that escape the target of TAL effector; (3) Receptor kinase RLK type resistance genes: Xa21, Xa3 / Xa26, Xa4, etc.; (4) Executor genes: Xa7, Xa10, Xa23, and Xa27, which are a type of TAL-related genes. Effector-related R genes have dominant mutations in their promoter regions, making it impossible for pathogens to induce their expression, thereby producing antibacterial properties; (5) Other types of genes: xa5.

[0006] Although some bacterial blight resistance genes have been identified, given the prevalence of bacterial blight, there is still a need for further research and development of new resistance genes in this field. Summary of the invention

[0007] The purpose of the present invention is to provide a broad-spectrum antibacterial gene and its application.

[0008] In a first aspect of the present invention, a method for enhancing the antibacterial ability of Gramineae plants is provided, comprising: introducing Xa46 gene into the plant and expressing Xa46 protein having antibacterial activity.

[0009] In a preferred embodiment, the introduction of the Xa46 gene into the plant comprises: introducing the Xa46 gene or an expression construct (including an expression vector) containing the gene into the plant; or performing a gain-of-function mutation on the Xa46 gene to express a Xa46 protein with antibacterial activity.

[0010] In another preferred embodiment, the expression construct or vector includes the promoter of the Xa46 gene, preferably the promoter is 500 to 3500bp before its ATG (such as 1000, 1500, 2000, 2500, 3000bp, etc.), preferably 2953bp before its ATG; a polynucleotide that can hybridize with the above-mentioned polynucleotide sequence under stringent conditions and has the function of promoting the expression of the target gene; or, a polynucleotide that has more than 80% (preferably more than 90%, more preferably more than 95%, most preferably more than 98%) identity with the polynucleotide sequence shown above and has the function of promoting the expression of the target gene.

[0011] In another preferred example, the plant further comprises other antibacterial genes, which express antibacterial proteins with antibacterial activity; preferably, the plant comprising other antibacterial genes is: other antibacterial genes exist endogenously, and other antibacterial genes are introduced exogenously; wherein the other antibacterial genes include antibacterial genes selected from (but not limited to): Xa1~Xa45; preferably include antibacterial genes selected from (but not limited to): Xa21, Xa1, Xa3 / Xa26, Xa4, xa5, Xa7, Xa10, xa13, Xa23, xa25, Xa27, xa41, Xa2, Xa14, Xa31, Xa45, xa8, xa15, xa19, xa20, etc.; more preferably, the other antibacterial gene is Xa21.

[0012] In another preferred embodiment, the method further comprises: hybridizing the plant introduced with the Xa46 gene with the plant containing the other antibacterial genes (expressing active antibacterial proteins) to obtain offspring plants (such as polymerized plant material Xa46 / Xa21) that can express active Xa46 protein and other active antibacterial proteins.

[0013] In another preferred embodiment, the method further comprises: further hybridizing or selfing the progeny plants to obtain progeny plants that can express active Xa46 protein and other active antibacterial proteins.

[0014] In another aspect of the present invention, a use of a Xa46 gene or a protein encoded thereby is provided for: enhancing the antibacterial ability of gramineous plants; or for preparing a preparation for enhancing the antibacterial ability of gramineous plants.

[0015] In a preferred example, the Poaceae plant is a plant introduced with other antibacterial genes or other antibacterial genes are upregulated and express other antibacterial proteins with antibacterial activity; preferably, the plant containing the other antibacterial genes is: other antibacterial genes exist endogenously and other antibacterial genes are introduced exogenously; wherein the other antibacterial genes include antibacterial genes selected from (but not limited to): Xa1~Xa45; preferably include antibacterial genes selected from (but not limited to): Xa1~Xa45; preferably include antibacterial genes selected from (but not limited to): Xa21, Xa1, Xa3 / Xa26, Xa4, xa5, Xa7, Xa10, xa13, Xa23, xa25, Xa27, xa41, Xa2, Xa14, Xa31, Xa45, xa8, xa15, xa19, xa20, etc.; more preferably Xa21.

[0016] In another preferred embodiment, the Xa46 protein comprises: (a) a polypeptide having an amino acid sequence as shown in SEQ ID NO:2; (b) a polypeptide derived from (a) which is formed by replacing, deleting or adding one or more (such as 1-20; preferably 1-10; more preferably 1-5) amino acid residues of the amino acid sequence as shown in SEQ ID NO:2 and has the function of the polypeptide of (a); (c) a polypeptide having an amino acid sequence that is more than 80% (preferably more than 85%; more preferably more than 90%; more preferably more than 95%; such as more than 98% or more than 99%) identical to the amino acid sequence defined in (a) and has the function of the polypeptide of (a); or (d) a fragment of SEQ ID NO:2 having the function of the polypeptide of (a); preferably comprising a fragment containing a region selected from the group consisting of a CC domain, an NBS domain, an LRR 3 domain, an N-terminal truncation of the CC domain retaining only the NBS and LRR, or a C-terminal truncation of the LRR retaining only the CC and NBS.

[0017] In another preferred example, the plant includes the following group or the Xa46 (including its homologs) is from the following group: rice, wheat, millet, foxtail millet, corn, sorghum, millet, barley, rye, oats, and Brachypodium distichum.

[0018] In another preferred embodiment, the bacteria include: Xanthomonas oryzae pv.oryzae.

[0019] In another preferred embodiment, the antibacterial ability includes resistance to bacterial blight pathogen.

[0020] In another aspect of the present invention, there is provided a use of a plant Xa46 gene or a protein encoded thereby as a molecular marker for identifying the antibacterial ability of Gramineae plants.

[0021] In another aspect of the present invention, a method for identifying traits of Poaceae plants is provided, the method comprising: identifying the sequence of Xa46 gene or the protein encoded by it in the test plant, if the Xa46 gene encodes Xa46 protein with antibacterial activity and no variation resulting in loss of antibacterial activity occurs, then the plant is a plant with antibacterial ability; preferably, the variation resulting in loss of antibacterial activity comprises: gene frameshift or premature protein termination; more preferably, comprising identifying whether the base at position 673 of the nucleotide sequence shown in SEQ ID NO:1 is deleted in the Xa46 gene sequence of the test plant, if the deletion occurs, then the plant is a plant without antibacterial ability, if the deletion occurs and there is no deletion in other sequences, then the plant is a plant with antibacterial ability.

[0022] In a preferred embodiment, the nucleic acid sequence is identified by sequencing, PCR amplification, restriction enzyme analysis, probe method, hybridization method, chip method, allele polymorphism analysis method, etc.

[0023] In another aspect of the present invention, a plant cell, tissue or organ is provided, into which an exogenous Xa46 gene is introduced; preferably, an expression construct (including an expression vector) containing the Xa46 gene is introduced.

[0024] In another preferred embodiment, the plant cells, tissues or organs further comprise other antibacterial genes, which express antibacterial proteins with antibacterial activity; preferably, the plant cells, tissues or organs comprising other antibacterial genes are: other antibacterial genes exist endogenously, other antibacterial genes are introduced exogenously or other antibacterial genes are upregulated; wherein, the other antibacterial genes include antibacterial genes selected from (but not limited to): Xa1~Xa45; preferably include those selected from (but not limited to): Xa21, Xa1, Xa3 / Xa26, Xa4, xa5, Xa7, Xa10, xa13, Xa23, xa25, Xa27, xa41, Xa2, Xa14, Xa31, Xa45, xa8, xa15, xa19, xa20, etc.; more preferably Xa21.

[0025] In some embodiments, the plant cell, tissue or organ does not have the ability to reproduce or regenerate into a complete plant.

[0026] Other aspects of the present invention will be apparent to those skilled in the art in view of the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 , SKZ are resistant to Xanthomonas oryzae J18; (A, C) Leaf phenotypes of NIP or SKZ plants infected with different strains of Xanthomonas oryzae; (B, D) Statistics of plaque lengths on leaves of NIP plants infected with different strains of Xanthomonas oryzae.

[0028] Figure 2 , and analysis of the antibacterial phenotype of the hybrid F1 generation against the J18 strain.

[0029] Figure 3 , X Chromosomal localization of Xa46; (A) Molecular marker RM3199 on chromosome 3 is linked to the susceptible phenotype, where the templates are 1: SKZ, 2: NIP, 3: NIP×SKZ F1 generation, 4: antibacterial individual pool, 5: susceptible individual; (B) Xa46 is located between 120.4cM and 122.8cM on chromosome 3; (C) Xa46 is located in a region of approximately 117kb.

[0030] Figure 4 , the phenotype of candidate gene C1-C4 knockout mutants inoculated with J18; (A) Four candidate genes Candidate Gene 1-4 (abbreviated as C1-C4) were screened in the 65kb positioning region; (BC) The plaque length of the mutant material after C1 knockout was significantly longer than that of the control wild-type SKZ, while the inoculation phenotype of the mutant with single gene knockout of C2-C4 had no significant difference from SKZ.

[0031] Figure 5 , X The a46 knockout mutation reduces resistance to bacterial blight strain J18; (A) Schematic diagram of the mutations of mutants Xa46-KO-1 and Xa46-KO-2; (BC) The mutant plants showed obvious susceptible phenotypes two weeks after inoculation with bacterial blight strain J18; (D) The bacterial-stained leaves were collected on days 0, 7, and 14 after inoculation, and the bacterial content in the leaves was counted.

[0032] Figure 6 , X a46 restored the susceptible phenotype of NIP and TP309; (AB) The complemented plant NIP-Xa46 can resist the infection of J18 well; (C) The bacterial content in the leaves 0, 7 and 14 days after inoculation with J18; (DE) The full-length genome sequence of Xa46 was transferred into the TP309 background, which can complement the phenotype of the susceptible material TP309; (F) The bacterial content in the leaves 0, 7 and 14 days after inoculation with J18; (GI) The CDS of Xa46 also improved the antibacterial property after complementing NIP.

[0033] Figure 7 , X The full length of a46 and its CDS endow the plant with antibacterial function throughout the growth period; (AB) seedling SKZ showed strong antibacterial activity; (C) bacterial content in leaves 0, 3, 6, 9 and 12 days after inoculation with J18; (DE) length of bacterial plaques in NIP seedlings carrying Xa46 2 weeks after inoculation; (F) bacterial content in NIP seedlings carrying Xa46 at different inoculation days.

[0034] Figure 8 AB and Xa46 are expressed in multiple major organs of rice.

[0035] Fig. 9 Subcellular localization of AB and Xa46 in NIP.

[0036] Fig.10 , XThe expression of a46 is not induced by pathogens and damage; (A) Comparison of the background transcription level of NIP with SKZ; (B) Fluorescence quantitative PCR data of SKZ materials inoculated with sterile water, non-affinity race J18 and affinity race PXO99A at 0, 6, 12, 24, 48 and 72 hours.

[0037] Fig.11 , X Functional study of each domain of a46; (A) Complete CC domain at the Xa46 site in NIP (only 2 amino acid differences); (BC) Antibacterial function of different truncated forms of Xa46.

[0038] Fig.12 , X a46 / Xa21 polymerization complements the antibacterial spectrum of Xa21; (AB) Xa46 (TP309-Xa46) resistance to multiple strains; (C) TP309-Xa46 and NIP-Xa46 also show strong resistance to this type of strains; (D) For most strains, the antibacterial activity after polymerization is stronger. DETAILED DESCRIPTION

[0039] The inventors screened a large number of field planting resources and obtained a new antibacterial gene from a plant variety with specific antibacterial properties. Through gene positioning, knockout and complementation, the inventors clarified that the gene has a broad-spectrum antibacterial property against bacterial blight and named it Xa46. Furthermore, Xa46 can be polymerized with other antibacterial genes such as Xa21 gene by means of transgenic and hybridization, and the resistance spectrum of the plant material after polymerization is further expanded. The cloning and application of Xa46 are of great significance to the breeding of plant resistance varieties.

[0040] the term

[0041] As used herein, the "plant" includes plants expressing Xa46 polypeptide (protein) or plants having Xa46 gene or its homologue (homologous gene) in the genome. According to the knowledge in the art, plants expressing Xa46 polypeptide have the mechanism of action as claimed in the present invention, and can achieve the technical effect as claimed in the present invention. The present invention also includes plants whose genome contains Xa46 gene or its homologue, but which do not express active Xa46 protein. The method of the present invention means that the plants can achieve improved antibacterial properties. The plants described in the present invention can be monocots or dicots. In some preferred embodiments, the plants are crops, preferably cereal crops. In some preferred embodiments, the "cereal crops" can be grass plants; preferably, the grass plants include but are not limited to: rice, wheat, millet, foxtail millet, corn, sorghum, millet, barley, rye, oats, Brachypodium distichum, etc. Preferably, the plant is rice.

[0042] As used herein, the term "enhanced antibacterial ability" or "enhanced antibacterial ability" refers to the resistance of plants to relatively more types (species) of bacterial blight, that is, the plants are endowed with a wider antibacterial spectrum. For example, plants are conferred with broad-spectrum resistance to bacterial blight J18, T3, Japan-4, KS-3-7, JS137-1, XZ40, GZ299, GZ10, PXO79, PXO145, PXO349, PXO61, PXO71, PXO347, PXO112, PXO99A, T1, T2, LN44, AH28, YC12, YC15, YC26, LYG50, KS-1-21, YN04-5, GX4, JNXO, Oct-78 / 78-10, YN1, YN11, YN7, YN18, PXO86, LN2, JL1, LN1, LN3, etc.

[0043] As used herein, the terms "up-regulate", "enhance", "enhance", "increase", "promote", "enhance" and the like are interchangeable and should be used to mean an increase of at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10%, preferably at least 15% or 20%, more preferably 25%, 30%, 50%, 80%, 100% or more compared to a control such as a "control plant" or "control gene" or "control protein" as defined herein.

[0044] With regard to "control plants", the selection of appropriate control plants is a routine part of experimental design and may include corresponding wild-type plants or corresponding transgenic plants without the gene of interest. Control plants are generally the same plant species or even varieties that are the same as or belong to the same class as the plant to be evaluated. Control plants may also be individuals that have lost transgenic plants due to separation. Control plants as used herein refer not only to complete plants, but also to plant parts, including, for example, leaves.

[0045] As used in the present invention, the high expression or high activity refers to a statistically significant increase in expression or activity compared to the average value of the expression or activity of the same species or the same plant, such as an increase of 10%, 20%, 40%, 60%, 80%, 90% or more.

[0046] As used in the present invention, the low expression or low activity refers to a statistically significant decrease in expression or activity compared to the average value of the expression or activity of the same species or the same plant, such as a decrease of 10%, 20%, 40%, 60%, 80%, 90% or less.

[0047] As used herein, the "improved trait" refers to improved plant properties. In the present invention, the properties mainly include: antibacterial activity.

[0048] As used herein, "improvement of plant traits", "improved traits", "improved plant traits", "trait improvement" and the like are equivalent and refer to that compared with the unimproved plant (such as the wild-type plant), the traits or characteristics described in the above paragraph of the plant transformed by the technical scheme of the present invention undergo statistically significant changes, and the changes form beneficial agronomic traits.

[0049] As used herein, the "promoter" or "promoter region (domain)" refers to a nucleic acid sequence that is usually present upstream (5' end) of the target gene coding sequence and can guide the transcription of the nucleic acid sequence into mRNA. Generally, the promoter or promoter region provides recognition sites for RNA polymerase and other factors necessary for the correct initiation of transcription. In this article, the promoter or promoter region includes variants of the promoter, which are obtained by inserting or deleting regulatory regions, performing random or site-directed mutagenesis, etc.

[0050] As used herein, "exogenous" or "heterologous" refers to the relationship between two or more nucleic acid or protein sequences that are derived from different sources. For example, a promoter is exogenous to a gene of interest if the combination of the promoter and the gene of interest sequence does not normally occur in nature. A particular sequence is "exogenous" to the cell or organism into which it is inserted.

[0051] Xa46 and its antibacterial properties

[0052] In the present invention, the Xa46 encodes an NLR (nucleotide-binding leucine-rich repeat) receptor protein Xa46, which can mediate immunity to multiple bacterial blight species.

[0053] As used in the present invention, unless otherwise specified, the Xa46 refers to a polypeptide having a sequence of SEQ ID NO:2 or a coding gene thereof, and also includes sequence variants having the same function as the Xa46 polypeptide. The coding gene may be a gDNA or a cDNA, and may also include a promoter. For example, the gDNA has a nucleotide sequence as shown in SEQ ID NO:3, and the cDNA has a nucleotide sequence as shown in SEQ ID NO:1. The sequence of the coding gene also includes a sequence that is degenerate with the sequence provided by the present invention.

[0054] The variant forms of the Xa46 polypeptide include (but are not limited to): deletion, insertion and / or substitution of several (usually 1-100 or 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10, and even more preferably 1-8, 1-5) amino acids, and addition or deletion of one or several (usually within 20, preferably within 10, and more preferably within 5) amino acids at the C-terminus and / or N-terminus. Any protein with high homology to the Xa46 polypeptide (such as 50% or higher, 60% or higher, 70% or higher homology to the polypeptide sequence shown in SEQ ID NO: 2; preferably 80% or higher homology; more preferably 90% or higher homology, such as 95%, 98% or 99% homology) and having the same function as the Xa46 polypeptide is also included in the present invention. Polypeptides derived from species other than rice that have a high homology to the polypeptide sequence of SEQ ID NO: 2, or that play the same or similar role in the same or similar regulatory pathways are also included in the present invention.

[0055] The present invention also provides an isolated polypeptide, which is a fragment of the Xa46 polypeptide or is formed by adding other proteins or tags at both ends. The fragments include, for example but not limited to, fragments containing regions selected from the following groups: CC domain, NBS domain, LRR 3 domain, CC domain truncated to retain only NBS and LRR N-terminal truncation, or truncated LRR to retain only CC and NBS C-terminal truncation fragments. Combined with the results of the embodiments of the present invention, those skilled in the art can anticipate or prepare suitable fragments, and these fragments and their applications are all included in the scope of the present invention.

[0056] In the present invention, the "Xa46" also includes its homologs. It should be understood that although the Xa46 obtained from a specific species of rice is preferably studied in the present invention, other polypeptides or genes obtained from other species that are highly homologous to the Xa46 (such as having a sequence identity of more than 50%, more than 60%, more particularly, more than 70%, more than 80%, more than 85%, more than 90%, more than 95%, or even more than 98%) are also within the scope of the present invention. Polypeptides derived from species other than rice that have a high homology to the polypeptide sequence of the sequence shown in SEQ ID NO: 2 and play the same or similar role in the same or similar signaling pathways are also included in the present invention.

[0057] The present invention also relates to a Xa46 cleavage form, which corresponds to an amino acid sequence of SEQ ID NO: 2 that terminates prematurely after position 227, so that the polypeptide encoded by the Xa46 cleavage form loses its function, causing a significant change in the antibacterial properties of the plant. For example, the variant naturally exists in Nipponbare.

[0058] The present invention also involves the combined use of Xa46 and Xa21 or other antibacterial genes. Therefore, it should be understood that the present invention also includes Xa21 or other antibacterial genes, their variant forms or fragments thereof. Xa21 is the first cloned rice leaf blight antibacterial gene. Although the expression of Xa21 does not change much in each growth stage, its resistance in the adult stage is stronger than that in the seedling stage, and its expression level is not induced by pathogens and damage. However, Xa21 also has certain limitations. Many North Asian strains such as Korean No. 1 subspecies J18 (DY89031) can completely overcome the antibacterial properties mediated by Xa21. The Xa46 of the present invention can form a complementary antibacterial spectrum with Xa21, so that the plant exhibits more excellent antibacterial properties.

[0059] The variant forms of the Xa21 polypeptide include (but are not limited to): deletion, insertion and / or substitution of several (usually 1-100 or 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10, and even more preferably 1-8, 1-5) amino acids, and addition or deletion of one or several (usually within 20, preferably within 10, and more preferably within 5) amino acids at the C-terminus and / or N-terminus. Any protein with high homology to the Xa21 polypeptide (such as homology of 50% or more, 60% or more, 70% or more; preferably homology of 80% or more; more preferably homology of 90% or more, such as homology of 95%, 98% or 99%) and having the same function as the Xa21 polypeptide is also included in the present invention. Polypeptides derived from species other than rice that have a high homology to the Xa21 polypeptide sequence or that play the same or similar role in the same or similar regulatory pathways are also included in the present invention.

[0060] The polynucleotide (gene) encoding the Xa46 polypeptide or Xa21 or other antibacterial genes may be a natural gene from a plant or a degenerate sequence thereof.

[0061] The present invention also relates to a vector comprising the polynucleotide, and a host cell produced by genetic engineering using the vector or the polypeptide encoding nucleic acid.

[0062] In the present invention, the polynucleotide sequence encoding the polypeptide of the present invention can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a bacterial plasmid, a bacteriophage, a yeast plasmid, a plant cell virus, a mammalian cell virus or other vectors well known in the art. In short, any plasmid and vector can be used as long as they can replicate and be stable in the host. An important feature of an expression vector is that it usually contains a replication origin, a promoter, a marker gene and a translation control element. Preferably, the expression vector can also selectively add a resistance element, a screening (selection) element or a reporter gene element, such as Bar, GUS.

[0063] When the polynucleotide is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting factors of DNA, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription.

[0064] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. Plant transformation can be carried out using methods such as Agrobacterium transformation or gene gun transformation, such as spraying method, leaf disc method, rice embryo transformation method, etc.

[0065] In addition, the present invention also includes plant cells, tissues or organs, into which exogenous Xa46 gene is introduced or the expression of Xa46 gene is upregulated; preferably, an expression construct (including expression vector) containing Xa46 gene is introduced. In a more preferred embodiment, the plant cells, tissues or organs also contain other antibacterial genes, which express antibacterial proteins with antibacterial activity. The other antibacterial genes include antibacterial genes selected from (but not limited to): Xa1~Xa45; preferably include (but not limited to): Xa21, Xa1, Xa3 / Xa26, Xa4, xa5, Xa7, Xa10, xa13, Xa23, xa25, Xa27, xa41, Xa2, Xa14, Xa31, Xa45, xa8, xa15, xa19, xa20, etc.; more preferably Xa21.

[0066] Application of Xa46 in plant improvement

[0067] Rice bacterial blight caused by Xanthomonas oryzae pv.oryzae (Xoo) seriously affects the yield of rice, a food crop, and is a very serious bacterial disease. In addition, there are many types of Xanthomonas oryzae pv.oryzae, making it difficult to prevent and control.

[0068] In an embodiment of the present invention, the inventors screened a large number of field planting resources and obtained a material SKZ (ShuangKeZao) that can specifically produce resistance to J18. Subsequently, based on molecular and genetic means of map-based cloning, gene knockout and complementation, the inventors located and cloned an Xa gene that produces specific resistance to J18 in chromosome 3 of the indica rice variety SKZ, named Xa46. Xa46 can mediate immunity to multiple bacterial blight species, especially strains in North Asia, and its antibacterial activity depends on a complete protein structure. In the J18 susceptible material japonica rice variety NIP or TP309, the recessive allele xa46 of Xa46 loses resistance due to base deletion affecting protein function. After Xa46 is knocked out, it directly affects SKZ's resistance to J18. At the same time, Xa46 can well complement the resistance of susceptible rice varieties and provide resistance to the entire growth period of the plant.

[0069] Based on the inventors' new discovery, the present invention provides a method for enhancing the antibacterial ability of Gramineae plants, the method comprising: introducing Xa46 gene into the plant, expressing Xa46 protein with antibacterial activity (excluding Xa46 protein whose encoding has lost function due to premature termination).

[0070] The present invention provides a method for making plants, especially plants that do not express active proteins due to premature protein termination, express more ideal antibacterial traits.

[0071] It should be understood that after knowing the function of Xa46, various methods well known to those skilled in the art can be used to regulate the expression or activity of Xa46. For example, various methods well known to those skilled in the art can be used to overexpress Xa46. More specifically, for example, the coding gene of Xa46 or an expression construct or vector containing the coding gene can be introduced into the plant.

[0072] In the embodiments of the present invention, in order to expand the resistance spectrum, the inventors constructed a hybrid rice material of Xa46 and Xa21. Xa21 encodes a kinase receptor protein, which can produce resistance to multiple bacterial blight species such as Philippine No. 6 PXO99A through the immune mode stimulated by PAMPs molecules, but the Xa21-mediated resistance can also be overcome by other strains, such as J18 with a defective type I secretion system. J18 is a bacterial blight species with strong pathogenicity isolated from South Korea. In addition, it can also be overcome by strains LN1, LN3, JL1, etc. isolated in northern China, and representative strains of Korean physiological No. 1 and No. 3. The inoculation test of the present invention shows that after the Xa46 and Xa21 genes are polymerized, they show strong resistance to 97.8% of the tested strains. The polymerization of Xa46 and Xa21 essentially exerts a broad-spectrum resistance coordinated by PTI and ETI (ETS-stimulated immune mode), showing good potential in rice breeding. It should be understood that, although not specifically exemplified, Xa46 of the present invention can be used in combination with one or more other antibacterial genes to further increase the antibacterial spectrum of the plant.

[0073] Therefore, the present invention also provides a combined antibacterial scheme of using Xa46 and Xa21 or other antibacterial genes in combination. For plants that endogenously express active Xa21 or other antibacterial genes but do not express active Xa46, Xa46 can be introduced therein; and for plants that endogenously express active Xa46 but do not express active Xa21 or other antibacterial genes, Xa21 or other antibacterial genes can be introduced therein, thereby making the plants have a wider antibacterial spectrum.

[0074] In summary, the present invention reveals a new bacterial blight resistance gene Xa46 encoding an NLR receptor. In addition, the polymerization of Xa46 / Xa21 provides theoretical and experimental evidence for the coordinated reconstruction of ETI and PTI signaling pathways for broad-spectrum resistance to bacterial blight pathogens for application in production practice.

[0075] In the present invention, after obtaining plants with enhanced antibacterial traits, the method may also include hybridizing plants introduced with the Xa46 gene with plants containing the Xa21 gene or other antibacterial genes (expressing active Xa21 protein or other antibacterial proteins) to obtain offspring plants that can express active Xa21 protein or other antibacterial proteins and active Xa46 protein (such as polymer plant material Xa46 / Xa21); preferably, the method also includes: further hybridizing or selfing the offspring plants to obtain offspring plants that can express active Xa21 protein or other antibacterial proteins and active Xa46 protein.

[0076] Plant directed screening or targeted screening

[0077] After knowing the function of Xa46, it can be used as a molecular marker for targeted screening of plants. Based on this new discovery, it is also possible to screen for substances or potential substances that can regulate the antibacterial traits of plants by regulating this mechanism.

[0078] Therefore, the present invention provides a method for directed selection or identification of plants, the method comprising: identifying the sequence of the Xa46 gene or the protein encoded by it in the test plant, if the Xa46 gene encodes a Xa46 protein with antibacterial activity and no variation resulting in loss of antibacterial activity occurs, then the plant is a plant with antibacterial ability; preferably, the variation resulting in loss of antibacterial activity comprises: gene frameshift or premature protein termination; more preferably, comprising identifying whether the base at position 673 of the nucleotide sequence shown in SEQ ID NO:1 is deleted in the Xa46 gene sequence of the test plant, if the deletion occurs, then the plant is a plant without antibacterial ability, and if the deletion does not occur, then the plant is a plant with antibacterial ability.

[0079] For example, in a specific embodiment of the present invention, it was found through sequence analysis that in the rice variety Nipponbare, Xa46 lacked 1 bp of base at position 673, resulting in amino acid frameshift, and the protein sequence terminated prematurely at position 227. Based on this, it can be judged that the Nipponbare variety does not have antibacterial properties against bacterial blight such as J18. It should be understood that in plants of other varieties, variations in Xa46 or its homologous genes located at other positions may also occur. The activity analysis of Xa46 or its homologous genes that have undergone such variations can be performed according to the experiment of the embodiment of the present invention. If the Xa46 activity is retained, it indicates that the corresponding plant has antibacterial properties against bacterial blight such as J18; but if the Xa46 activity is lost, it indicates that the corresponding plant does not have antibacterial properties against bacterial blight such as J18 (except for the presence of other unclear antibacterial genes). This method of judging the activity of the Xa46 protein can be achieved under the guidance or example of the prior art content of the present invention.

[0080] The present invention provides a method for screening substances (potential substances) that regulate Xa46 and thus enhance plant antibacterial properties, comprising: (1) adding a candidate substance to a system that expresses Xa46; (2) detecting the system to observe the expression or activity of active Xa46 therein, and if the candidate substance upregulates (significantly upregulates) the Xa46 gene or the protein encoded by it, it indicates that the candidate substance is a regulatory substance useful for enhancing plant antibacterial properties.

[0081] Methods for screening substances acting on a protein or gene or a specific region thereof as a target are well known to those skilled in the art, and all of these methods can be used in the present invention. The candidate substances can be selected from: peptides, polymeric peptides, peptidomimetics, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, organic small molecules, inorganic small molecules, and nucleic acid sequences, etc. Depending on the type of substance to be screened, those skilled in the art will know how to select an appropriate screening method.

[0082] After large-scale screening, a class of potential substances that specifically act on Xa46 or the signal pathways it participates in and have a regulatory effect on the antibacterial traits of plants can be obtained.

[0083] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, 3rd edition, Science Press, 2002, or according to the conditions recommended by the manufacturer.

[0084] Materials and Methods

[0085] Rice materials

[0086] For the rice variety Shuangkezao (SKZ), see Wang Jianjun, Zhu Xudong, Wang Linyou, et al., Physiological and genetic analysis of rice lesion-like mutants; Journal of Plant Physiology and Molecular Biology, 2004, 30(3): 331-338.

[0087] Activation culture, inoculation method and growth curve method of Xanthomonas spp.

[0088] Take the bacterial blight pathogen (Xanthomonas oryzae pv.oryzae, Xoo) strain stored at -80℃, streak it on PSA solid culture medium for activation, and invert it at 28℃ for 72h. After a single clone colony grows, pick a single clone and put it into PSA liquid culture medium for small shaking for 2 days. Pipette 100μl of the bacterial solution cultured in PSA culture medium into PSA solid culture medium, spread it evenly with a sterilized coating rod, invert it at 28℃ for 72h, and the grown bacterial blight pathogen can be used for rice inoculation. The inoculation method is as follows: Field inoculation-leaf cutting method: scrape the grown bacterial blight pathogen on PSA culture medium with sterile water and dilute it to an OD value of 1.0. Dip the diluted bacterial solution with scissors and cut it obliquely downward at 2cm from the tip of the rice leaf (grown for about 60d). After about 14 days of inoculation, measure the length of the leaf plaque. Seedling inoculation - leaf cutting method: Use sterile water to scrape off the white leaf blight fungus grown on the PSA medium and dilute it to an OD value of 0.6. Use scissors to pick up the diluted bacterial solution and cut the tip of the rice leaf (growing for about 25-30 days) at 1 cm, obliquely downward. After about 14 days of inoculation, measure the length of the leaf spots. The growth curve of white leaf blight is carried out according to the following steps: Take rice leaves of different days of inoculation, the length includes the diseased spots, soak the surface of the leaves in 75% ethanol for 10-15s, and then immediately wash the 75% ethanol on the surface of the leaves in sterile water, gently shake off the sterile water, cut the leaves into pieces with sterile scissors, put them in a mortar burned with alcohol, and add a small amount of sterilized quartz sand (a small amount can be added for seedlings), add 1-2ml of sterile water and grind thoroughly until there is no obvious leaf tissue. After grinding, continue to add sterile water to 10ml, transfer them together to a 10ml sterile tube, shake and mix, and fully release the bacteria. The bacterial solution was diluted according to the required concentrations and applied to PSA solid culture medium containing 15 mg / L cephalexin. After growing for 2-3 days, the number of bacterial blight clones grown was counted, and the bacterial growth on each leaf was estimated. The growth curve of bacterial blight on rice was drawn based on the growth of bacterial blight at different days after inoculation.

[0089] Plasmid extraction

[0090] The plasmid was extracted using conventional methods.

[0091] Induction, transformation, screening and differentiation of callus from mature embryos of rice

[0092] Induction of mature embryo callus of rice: Weigh a certain amount of rice seeds of the required variety, hull them with a sheller, and remove the hulled seeds with obvious infection and the seeds with obvious breakage and no embryo on white paper. Soak and shake with 75% ethanol for 30-45s, remove the ethanol, rinse the seeds with sterile water and remove the residual ethanol; then prepare 30% (v / v) NaClO3 and soak the seeds with it, and shake them on a shaker at 200rpm for 30min. Remove the NaClO3 after taking it out, rinse with sterile water 5-6 times until there is no obvious yellow color. Place the seeds on sterile filter paper and dry them in the air or use filter paper to absorb the surface moisture. Finally, sow the seeds in antibiotic-free NBD medium to induce callus. After culturing at 26℃ for 10 days, remove the endosperm, plumule and radicle, etc. The obtained callus can be used for transgenic or placed on antibiotic-free NBD medium for subculture, and subculture every 2 weeks.

[0093] Preparation of Agrobacterium transformation liquid: The transformed Agrobacterium containing the target gene stored at -80℃ was placed on ice to thaw, and activated by streaking on a plate. After 2 days, a single clone of appropriate size was picked and placed in 5ml YEP / LB liquid medium with corresponding antibiotics for reactivation, and cultured overnight at 28℃, 200rpm, with shaking. 1.5ml of the overnight culture liquid was taken and transferred to 15ml AB ​​(50mg / L Kan+20mg / L Rif+100mg / L AS) liquid medium, and cultured on a shaking platform at 28℃, 200rpm until OD600=0.5 (about 4h).

[0094] Co-culture of rice callus and Agrobacterium: collect bacteria, visually or spectrophotometer to measure OD600 value of about 0.5, 5000rpm, 10min, centrifuge, collect bacteria; suspend bacteria with AAM containing 100mg / L AS to precipitate until OD600=0.5; pick out rice callus with good growth, mix the above bacterial solution with rice callus, soak and shake at 28℃ for 20min; then, suck off AAM with 5ml gun, dry callus bacterial solution with filter paper (according to the order of filter paper-callus-filter paper), and co-culture callus tissue on antibiotic-free NBD medium separated by sterile filter paper at 26℃ for 3 days. 1ml of AAM culture solution containing 100mg / L AS can be added to each dish to fully wet the sterile filter paper.

[0095] Screening of callus: Use sterile filter paper to absorb the Agrobacterium on the surface of the callus that has expired after co-culture, fully absorb it, and transfer it to the screening medium containing the corresponding screening antibiotics (such as hygromycin, etc.) to screen the resistant callus. 2-3 rounds of screening and culture at 26℃, depending on the state of the callus. Each round is about 2 weeks, and the medium needs to be replaced with different antibiotic concentrations in each round. Taking Hyg as an example of screening antibiotics, the antibiotics added to the screening medium in each round are as follows: First round of screening: NBD+100mg / L Timentin+30mg / LHyg; Second round of screening: NBD+100mg / L Timentin+40mg / L Hyg; Third round of screening: NBD+100mg / LTimentin+50mg / L Hyg. Differentiation of callus: Transfer the rice callus tissue that has been screened several times and is in good condition to the rice differentiation medium and culture it under light. Change the medium about every 2 weeks (2-3 rounds), and antibiotics can be added in small amounts until a certain size of seedlings are differentiated. Rooting of differentiated seedlings: Take out the seedlings on the differentiation medium, remove the medium as much as possible from the roots, and transfer them to the rooting medium for rooting. After the seedlings grow roots, take them out after about 3 weeks, wash off the agar medium as much as possible, and culture them in water under light conditions for one week. After DNA extraction and PCR identification of the leaves, they can be transplanted into the soil.

[0096] Rice genomic DNA extraction

[0097] The conventional TPS leaf simple extraction method was used to extract a small amount of rice genomic DNA.

[0098] Extraction of total RNA

[0099] Total RNA was extracted using the conventional TRIzol method.

[0100] Reverse transcription of mRNA and real-time PCR (RT-PCR)

[0101] The RNA was reverse transcribed into cDNA using an Invitrogen kit, and the expression level was calculated using a Bio-Rad fluorescent quantitative PCR instrument.

[0102] Extraction and detection of plant protein

[0103] The total plant protein was extracted using conventional methods, followed by Western-Blot protein blotting.

[0104] Rice Protoplast Transient Transformation System

[0105] (1) Rice seeds were shelled and those with obvious black and dark spots were removed. The seeds were sterilized with 75% ethanol and treated with 30% NaClO for 30 min. The residual 30% NaClO was completely washed off. The seeds were dried and sown in 1 / 2MS without antibiotics and grown at 25°C for 10-14 days.

[0106] (2) Take out the rice seedlings that have grown to a certain height, about 60-80 plants (selected according to experimental requirements), carefully cut off the roots and leaves, retain their leaf sheath tissue, and place them on ice to cool.

[0107] (3) Use a single-edged blade to cut the leaf sheath tissue into small segments less than 0.5 mm, add 30 ml of freshly prepared TVL protoplast buffer, and let it stand for 10 min.

[0108] The TVL buffer formula is as follows:

[0109]

[0110] (4) Prepare the following enzymatic hydrolysate and add an equal volume of 30 ml of the enzymatic hydrolysate to the leaf sheath fragments immersed in TVL.

[0111]

[0112] (5) Wrap the conical flask containing the leaf sheath tissue with tin foil, evacuate the flask, and allow the enzymatic hydrolysis to proceed for 4-5 hours in the dark.

[0113] (6) The following steps after enzymatic hydrolysis were performed in the dark. The enzymatically hydrolyzed protoplasts were filtered through a 40 μm filter and transferred to a 50 ml centrifuge tube.

[0114] (7) Add an equal volume of W5 solution and gently invert to mix.

[0115] (8) Let stand at 4°C overnight to allow the layers to separate. The next day, carefully remove the middle layer and transfer it to a new centrifuge tube.

[0116] (9) Add W5 solution of the same volume as the middle layer and slowly invert to mix. Preparation of W5 solution:

[0117]

[0118] (10) Centrifuge at 100g for 5 min. Carefully remove the supernatant and add about 10 ml of W5 solution to resuspend. Centrifuge at 60g for 5 min.

[0119] (11) Carefully remove the supernatant, add 5 ml of W5 solution to resuspend, protect from light, place on ice, and allow to settle naturally for about 30 min.

[0120] (12) Centrifuge at 60 g for 5 min, remove as much W5 solution as possible, and prepare MMG and PEG-Ca in advance.2+ Solution.

[0121]

[0122]

[0123] (13) According to the experimental requirements, add a certain amount of freshly prepared MMG solution, gently resuspend the cells, and observe the cell integrity and concentration under a microscope.

[0124] (14) Add plasmid to a 2 ml centrifuge tube as needed, then add about 100 μl of protoplasts and mix well. Add 110 μl of PEG-Ca 2+ The transformation solution was gently and slowly mixed, and then placed flat to allow the transformation to take about 15-20 minutes.

[0125] (15) Gently add 400 μl of W5 solution and carefully invert to mix to terminate the transformation reaction. Centrifuge at 100 g for 2 min.

[0126] (16) Carefully remove the supernatant, add 1 ml of W5 solution, resuspend, and incubate in the dark at 25-28°C overnight.

[0127] (17) Based on the cell concentration under microscopic examination, it is determined whether the cells need to be centrifuged again and W5 solution added to increase the concentration for laser confocal fluorescence observation or to be concentrated for protein extraction.

[0128] Xa46 sequence:

[0129] CDS sequence (SEQ ID NO: 1):

[0130] atggcggcggcgctggaagcattcgcggccaagctggcgaacgtcctggtggggatggcgaaggaggaggtggagacgctcctgggcgtgcccggcgcgatcgccaagctcgagacgacgctcggcgacctgagcagcatcctggccgacgccgaccggaggcgcatccacgacccgggcgtggagcggtgggtgagggagctcaaggacgccatgtacgacgccgacgacatccttgacctcttccgcgccatggagggcggagaagaccccggctcgccgccaagagctgctccggcgccgtcggcgtgctggagcgccctctgccgccgcagccctgccgctacgcgcaagatcgggaggaagatccaggagctcaaccggagggtggaggagatcgcgaagaggagctcccgctttggatttgtctcccaagtaatccactcctcctcggcccttcgtctaaccgatagacccatgtgttcttgctcgtcagaaagcagccgcaacagcaagacgggaccatccatcattcgatccgatgttgtcggcgacaagatagatcttcacacaaggaacctcgttgatctgctgattggcaacaagctggcggatggtcgcacgcgcgcaagatcgtcaggcgatgtcatcgccgtcgcgatcaccggcgct g

[0131] Protein sequence (SEQ ID NO: 2):

[0132]

[0133] Genomic sequence (SEQ ID NO: 3):

[0134] atggcggcggcgctggaagcattcgcggccaagctggcgaacgtcctggtggggatggcgaaggaggaggtggagacgctcctgggcgtgcccggcgcgatcgccaagctcgagacgacgctcggcgacctgagcagcatcctggccgacgccgaccggaggcgcatccacgacccgggcgtggagcggtgggtgagggagctcaaggacgccatgtacgacgccgacgacatccttgacctcttccgcgccatggagggcggagaagaccccggctcgccgccaagagctgctccggcgccgtcggcgtgctggagcgccctctgccgccgcagccctgccgctacgcgcaagatcgggaggaagatccaggagctcaaccggagggtggaggagatcgcgaagaggagctcccgctttggatttgtctcccaagtaatccactcctcctcggcccttcgtctaaccgatagacccatgtgttcttgctcgtcagaaagcagccgcaacagcaagacgggaccatccatcattcgatccgatgttgtcggcgacaagatagatcttcacacaaggaacctcgttgatctgctgattggcaacaagctggcggatggtcgcacgcgcgcaagatcgtcaggcgatgtcatcgccgtcgcgatcaccggcgct g

[0135] Example 1: Rice variety SKZ is resistant to Xanthomonas oryzae J18

[0136] For the rice variety Shuangkezao (SKZ), see Wang Jianjun, Zhu Xudong, Wang Linyou, et al., Physiological and genetic analysis of rice lesion-like mutants; Journal of Plant Physiology and Molecular Biology, 2004, 30(3): 331-338.

[0137] The present inventors tested the resistance of rice Xa21 material 106 (TP309 background, transformed with Xa21 gene) to different bacterial blight strains.

[0138] The results showed that Xa21 could overcome multiple bacterial blight strains, including the highly toxic Philippine strain 6 PXO99A, Japanese physiological race 1 MAFF311018, and Korean race KACC10331. However, Xa21 could not overcome the susceptibility caused by J18, showing susceptible traits ( Figure 1 A, B).

[0139] Through large-scale field seed screening of rice germplasm banks, the inventors discovered an indica rice variety SKZ that exhibits antibacterial activity specifically against J18 ( Figure 1 C, D).

[0140] Example 2: Genetic analysis of Xa46 antibacterial phenotype

[0141] By hybridizing indica rice with japonica rice, the inventors obtained the hybrid F1 of SKZ with indica rice variety 9311 and japonica rice variety NIP, and obtained the F2 offspring by self-pollination. Both hybrid F1 generations showed antibacterial activity against J18 ( Figure 2 ), indicating that the antibacterial activity of SKZ against J18 was dominant.

[0142] After the F2 generation obtained by self-pollination of the hybrid F1 generation of SKZ with NIP and 9311 was inoculated with J18, the segregation ratio of resistant plants to susceptible plants was close to 3:1 (Table 1), indicating that the antibacterial activity of SKZ against J18 may be controlled by a dominant single gene.

[0143] Table 1. Genetic analysis of SKZ's antibacterial activity against J18

[0144]

[0145] Example 3: Positioning of Xa46

[0146] The F2 population was obtained by self-pollination of the F1 generation of the cross between NIP and SKZ, and the J18 of bacterial blight pathogen was inoculated by the leaf clipping method. 426 susceptible individuals were selected according to the disease situation between 10 and 12 days after inoculation, and a small number of antibacterial individuals were selected two weeks after inoculation for positioning. 78 pairs of markers with differences between the two parents were screened out from the existing and newly synthesized SSR molecular markers of the inventors, and these 78 pairs of molecular markers were used to scan the pool of susceptible individuals (20 susceptible individuals) and the pool of antibacterial individuals (20 antibacterial individuals), and it was found that the molecular marker RM3199 on chromosome 3 was linked to the susceptible phenotype ( Figure 3 A).

[0147] Subsequently, the inventors used SSR and INDEL molecular marker Xa46 designed based on the difference in genome sequence between indica and japonica rice to locate it between 120.4 cM and 122.8 cM on chromosome 3 ( Figure 3 B).

[0148] Based on the published NIP and 9311 genome sequences, INDEL molecular markers were further designed and screened, and it was found that there were 1 and 3 exchange individuals at molecular markers INDEL33 and INDEL31, respectively, and Xa46 was located in an area of ​​about 117 kb ( Figure 3 C). In this region, the known genome sequences of NIP and 9311 are slightly different, so it is impossible to design molecular markers. Since the genome sequences of SKZ and 9311 are not exactly the same, the inventors used the SKZ genome as a template to perform PCR amplification and sequencing of the candidate genes annotated in the localization region. They found that there were differences in the genome sequences of SKZ and NIP. Based on these differences, they designed new CAPS molecular markers, and after expanding the localization population to 676 individuals, they narrowed the localization region to a range of about 65 kb ( Figure 3 C).

[0149] Example 4: Antibacterial function of candidate gene C1 (Xa46)

[0150] Through BAC library construction and sequencing, the inventors screened out four candidate genes Candidate Gene 1-4 (abbreviated as C1-C4) in the 65kb positioning region, encoding NLR protein, NLR protein, plasma membrane ATPase, and histidine phosphatase, respectively. The inventors compared the sequence differences between NIP and SKZ in this section. In this section, the SKZ sequence has more insertions and deletions than NIP. There is an insertion of about 1.5kb in the intron of the SKZ candidate gene C1, and there is a 5kb retrotransposon insertion in the exon sequence of C2. C3 and C4 have some single base mutation SNPs compared with NIP ( Figure 4 A).

[0151] Using the Crispr-Cas9 knockout system, the inventors knocked out four candidate genes one by one and obtained four homozygous mutant materials with single gene knockout. Subsequently, the mutants were tested by field inoculation with the bacterial blight subspecies J18. Statistics showed that the plaque length of the mutant material after C1 knockout was significantly longer than that of the control wild type SKZ, while the inoculation phenotype of the mutants with single gene knockouts of C2-C4 was not significantly different from that of SKZ ( Figure 4 B, C), therefore, the inventors preliminarily believed that C1 was the target gene, temporarily named Xa46 (t). The nucleotide sequence of its CDS is shown in SEQ ID NO: 1, the amino acid sequence of its protein is shown in SEQ ID NO: 2, and the genome sequence is shown in SEQ ID NO: 3.

[0152] Different types of Xa46 knockout genotypes obtained by the inventors all have similar inoculation phenotypes, and two of the knockout types are analyzed and explained below. The mutant Xa46-KO-1 has an extra base (+1 bp) bp in the exon (base T, located between the 21st and 22nd bp of its full-length sequence), and the mutant Xa46-KO-2 lacks 4 bases (-4 bp) in the exon ( Figure 5 A) (base AAGC, located between the 17th and 20th positions of the full-length sequence), the above two types of knockout protein sequences have changed. The mutant plants showed obvious susceptible phenotypes two weeks after inoculation with bacterial blight strain J18 ( Figure 5 B, C).

[0153] The inventors took bacterial plaque leaves on days 0, 7, and 14 after inoculation of the strain, and the growth curve obtained based on the bacterial content in the leaves showed that the bacterial growth in the mutant exceeded that of the wild type by 2-3 orders of magnitude from the 7th day, and the bacterial content increased slightly until the 14th day, but the difference in bacterial content between the mutant and the wild type continued to be maintained ( Figure 5 D).

[0154] The above data show that after the Xa46 gene was knocked out, the resistance of SKZ plants to the bacterial blight strain J18 was significantly reduced.

[0155] Example 5: Complementary genetic experiments further confirmed that Xa46 (C1) is an antibacterial functional gene

[0156] Primers were designed with reference to the genome sequence of NIP. Through PCR amplification, the inventors obtained the promoter region of Xa46 in SKZ (the sequence of 2953 bp before ATG of Xa46) and the full-length genome sequence (SEQ ID NO: 3). The Xa46 promoter itself was connected to the genome sequence of Xa46 pXa46:Xa46 to construct a binary vector pCambia1300, and the exogenous gene Xa46 was introduced into the susceptible plant NIP through Agrobacterium-mediated infection.

[0157] The inventors found that the complemented plant NIP-Xa46 could resist the infection of J18 very well, and almost no plaque extension was observed, showing strong resistance ( Figure 6 A, B). The growth curves drawn based on the bacterial content in leaves inoculated with J18 at 0, 7 and 14 days also show that ( Figure 6 C), Xa46 was significantly more resistant after being introduced into NIP. To further verify the complementary phenotype, the inventors simultaneously transferred the full-length genome sequence of Xa46 into the TP309 background using the same method, and once again complemented the phenotype of the susceptible material TP309 ( Figure 6 D, E, F). Thus, the inventors further confirmed that Xa46 is the antibacterial functional gene in SKZ material.

[0158] In addition, CDS complementation experiments confirmed that the CDS of Xa46 also has strong antibacterial function. The inventors used the cDNA reverse transcribed from the mRNA of SKZ as a template to amplify the CDS sequence of Xa46. Subsequently, the Xa46 CDS was connected with the maize ubiquitin gene promoter pUbi and the self promoter pXa46, respectively, carrying a tag containing three Flag proteins, and introduced into the NIP background respectively.

[0159] The inoculation results showed that CDS of Xa46 also improved the antibacterial activity after complementing NIP ( Figure 6 G, H, I).

[0160] Example 6: Xa46 provides resistance to plants throughout their growth period

[0161] Preparation of Xa46 knockout material in SKZ background: The mutant Xa46-KO-1 has an extra base (+1 bp) bp in the exon (T is located between the 21st and 22nd bp of its full-length sequence, and 1 base is added), and the mutant Xa46-KO-2 lacks 4 bases (-4 bp) in the exon ( Figure 5 A) (AAGC is located between the 17th and 20th positions of its full-length sequence and lacks these 4 bases).

[0162] The seedling inoculation experiment showed that the Xa46 knockout material in the SKZ background was easily infected by J18 at the seedling stage, while the seedling SKZ showed strong antibacterial activity ( Figure 7 A, B), the growth curves drawn from the bacterial content in leaves inoculated with J18 at 0, 3, 6, 9 and 12 days confirmed the above conclusions ( Figure 7 C).

[0163] In NIP seedlings carrying Xa46, whether in genome DNA (Xa46 transgenic plants established using pCambia1300) or CDS complementation form (Xa46 transgenic plants established using Pun1301), the plaque length was very short 2 weeks after inoculation, with only the edge of the plaque visible. Figure 7 D, E), the difference in bacterial content inside the leaves is more significant than that in the adult stage ( Figure 7 F), indicating that Xa46 can also play an important antibacterial role in the seedling stage.

[0164] Based on the above results, the inventors believe that the full-length Xa46 gene and its CDS can confer antibacterial function to rice, and this type of resistance is reflected in the entire growth period of rice seedlings and mature plants.

[0165] Example 7: Xa46 encodes an NLR protein that is ubiquitously expressed in all rice tissues

[0166] The gene locus of Xa46 contains a 3285bp open reading frame with a 4575bp intron in the middle. Xa46 encodes 1094 amino acids. The protein sequence predicts that the encoded product is an NLR protein, which consists of the CC domain at the N-terminus, the NBS region in the middle and the LRR domain at the C-terminus. Therefore, the Xa46 gene belongs to the NBS-LRR class of plant antibacterial genes.

[0167] To study the expression of Xa46 in various tissues of rice, the present inventors reverse transcribed RNA extracted from SKZ roots, stems, leaves, panicles, seeds and other tissues for fluorescence quantitative (qRT-PCR) analysis. The data showed that Xa46 was expressed in multiple parts, among which young leaves, mature leaves, panicles and stems had relatively high transcription levels ( Figure 8 A); At the same time, the inventors constructed a fragment of the GUS reporter gene (pXa46:GUS) driven by the Xa46 promoter onto a vector and introduced it into the NIP background by transgenic means. The results of GUS dye staining showed that the GUS reporter gene was expressed in the vegetative organs and reproductive organs of rice, including roots, stems, leaves, flowers, panicles, and seeds ( Figure 8 B), in which the leaves and stems are darkly colored and the GUS reporter gene is highly expressed; in addition, the GUS reporter gene is expressed on the surface and internal pollen grains of the young panicle.

[0168] The above results show that Xa46 is highly expressed in leaves and stems, and is also expressed in seeds, ears, pollen grains and even roots. The GUS staining results are consistent with the results of qRT-PCR identification of Xa46 expression.

[0169] Example 8: Distribution of Xa46 at the subcellular level covers the nucleus, cytoplasm, and membrane

[0170] To better understand the localization of Xa46 at the subcellular level in rice, the inventors used a rice protoplast transient transformation system to transiently express Xa46 in the NIP material background. Transformation of Xa46-GFP can observe obvious cytoplasmic localization ( Fig. 9 A). Using OsRac1 as a membrane protein marker and OsNLS as a nuclear protein marker, by co-transforming Xa46-GFP and the Marker gene, it was found that Xa46 had obvious nuclear and cell membrane localization ( Fig. 9 B).

[0171] Therefore, Xa46 is localized in multiple subcellular locations on the nuclear and plasma membranes.

[0172] Example 9: Expression of Xa46 is not induced by pathogens

[0173] Genes homologous to Xa46 also exist in the rice variety NIP, but the antibacterial functions of the corresponding gene loci in different rice backgrounds (such as NIP and SKZ) are different. In order to study whether the transcriptional expression level affects the antibacterial ability, the inventors detected the basal transcription level of the Xa46 locus in the antibacterial variety SKZ and the susceptible variety NIP.

[0174] The results showed that the background transcription level of NIP was only slightly lower than that of SKZ ( Fig.10 A), the inventors speculate that the multiple difference in the expression of the two is not enough to cause the reverse difference in antibacterial function. In addition, the SKZ material was inoculated with sterile water, non-affinity species J18 and affinity species PXO99A, and the fluorescence quantitative PCR data at 0, 6, 12, 24, 48 and 72 hours showed that ( Fig.10 B), the mRNA level of Xa46 did not fluctuate much in the three treatments within 72 h, indicating that Xa46 was not induced by pathogens.

[0175] The inventors detected the difference in the coding region of the Xa46 site in the susceptible material NIP and the antibacterial material SKZ, obtained the CDS sequence of the Xa46 site in the japonica rice material NIP by cDNA amplification, and compared it with the CDS sequence of the Xa46 functional site of SKZ. It was found that the Xa46 of NIP lacked 1 bp of base at the 673 site ( Fig.11A), resulting in amino acid frameshift and premature termination of the protein sequence at position 227. The inventors believe that the change in the protein sequence in NIP is the key reason for the loss of function of the Xa46 gene.

[0176] Example 10: The antibacterial function of Xa46 depends on the full-length protein

[0177] To further confirm the results of the previous example, the present inventors introduced truncated forms of each domain of Xa46 into NIP by transgenic, including three independent domains of CC, NBS, and LRR, as well as N-terminal truncated Xa46 with CC domain truncated to retain only NBS and LRR, C-terminal truncated Xa46 with LRR truncated to retain only CC and NBS, and intact CCdomain at the Xa46 site in NIP (only 2 amino acid differences, the gene sequence difference diagram is shown in FIG. Fig.11 A).

[0178] Table 1

[0179]

[0180] The above six transgenic materials were tested by J18 inoculation. Plaque statistics revealed that CC, NBS and LRR of Xa46, including the CC domain of NIP, showed some antibacterial function ( Fig.11 B, C).

[0181] Therefore, comprehensive comparison revealed that the most preferred method is to use the full-length Xa46 protein to achieve antibacterial function.

[0182] In summary, the 1bp base deletion in the Xa46 allele of NIP leads to changes in protein sequence, which is the main reason for its functional changes.

[0183] Example 11: Molecular breeding approach for polymerization of Xa46 and Xa21

[0184] Xa21 is a gene isolated from wild rice (Oryza longistaminata) with broad-spectrum resistance to bacterial blight. It has been widely used in field production. However, over the years, the resistance of Xa21 has been continuously overcome by pathogens. In order to complement the resistance spectrum of Xa21, the inventors firstly transferred Xa46 into the rice TP309 background by transgenic method, and used primers F-5'GATGGGAGAGGTTCATG-3' (SEQ ID NO: 4); R-5'-ATGTCATGTCCGTAACC-3' (SEQ ID NO: 5) to identify positive plants, with a fragment length of 982bp. Among the 82 transgenic seedlings obtained in the T0 generation, 65 were identified as positive. In addition, during the adult stage, the inventors judged the antibacterial properties of the transgenic plants by the phenotype of inoculated J18, and further clarified that Xa46 was expressed in the TP309 background; combined with molecular identification and resistance identification experiments, the homozygous transgenic T2 generation TP309-Xa46 strain was finally obtained.

[0185] Subsequently, the inventors aggregated the homozygous T2 generation TP309-Xa46 strain and rice material 106 (TP309 background, containing Xa21 gene) in the TP309 background by hybridization. The hybrid offspring material was identified by molecular identification, Xa21 was identified by primers F-5'CGATCGGTATAACAGCAAAAC-3' (SEQ ID NO: 6); R-5'-TCTGATCATGCATGTTCTGTG-3' (SEQ ID NO: 7), and the sample containing the 576bp fragment band was a positive strain. The primers for Xa46 identification were the same as above. Subsequently, the hybrid material was inoculated with PXO99A and J18 simultaneously, and the resistance after the aggregation of the two genes was verified. Finally, the inventors obtained homozygous Xa46 / Xa21 in the F3 generation.

[0186] In addition, the inventors obtained SKZ / 106 materials with two genes by hybridizing SKZ and 106 plants.

[0187] Example 12: Antibody spectrum detection of polymeric plant material Xa46 / Xa21

[0188] Xa46 is an R gene that mediates race-specific resistance. The inventors determined that Xa46 exerts its antibacterial function in an ETI immune manner. In addition to the J18 race, the inventors also detected multiple Xa46 incompatible races. In order to test the antibacterial ability of Xa46, the inventors collected a variety of domestic and foreign bacterial blight strains for field testing against TP309, TP309-Xa21, TP309-Xa46, and TP309-Xa46 / Xa21. The antibacterial statistics (plaque length) of Xa46, Xa21, and Xa21 / Xa46 inoculated with 46 bacterial blight races are shown in Table 2.

[0189] Table 2 (unit: cm)

[0190]

[0191]

[0192] Among the 46 subspecies, 34 strains (about 74%) inoculated with TP309 showed pathogenicity with a plaque length of more than 2.5 cm, of which only 3 / 34 strains had a plaque length of 2.5-5 cm. Most of the strains had a certain pathogenicity to TP309; and more than 40 strains (87.2%) inoculated with Xa46 had plaques that were smaller than the control TP309 plaques, indicating that Xa46, as an R gene, has a significant basic immune effect on bacterial blight disease.

[0193] Xa46 is particularly resistant to a variety of strains (the plaque does not exceed 1 cm), including the Yunnan strain of the YN series, the Philippine subspecies PXO86, the Liaoning strains of the LN series LN1, LN2, LN3, the Jilin strain JL1, the Korean subspecies J18, T2, YN7, YN18, YN11, YN1, etc.; especially JL1, LN1, LN3, J18 and other strains ( Fig.12 A, B).

[0194] The inventors used Xa46 seedlings from NIP and TP309 backgrounds to inoculate JL1, LN1, LN3, and J18 inoculated Xa46 seedlings. The results were similar, and TP309-Xa46 and NIP-Xa46 also showed strong resistance to this type of strain ( Fig.12 C, D).

[0195] The above data show that Xa46 can resist the infection of multiple bacterial blight species and has significant defense capabilities against most strains. Therefore, Xa46 is an antibacterial gene with important rice breeding value.

[0196] In this inoculation test, the inventors found that the results of inoculating 46 strains with the polymer material of Xa46 / Xa21 showed that, on the one hand, the polymer material complemented the resistance spectrum of Xa21 and well inhibited the infection ability of multiple Xa21 affinity subspecies, with LN1, LN3, JL1, J18 and the like being the most significant; on the other hand, it showed antibacterial phenotypes for all tested strains, among which 45 / 46 (94%) of the bacterial blight strains showed strong resistance (bacterial plaque length below 1.5 cm), and the disease resistance of the remaining 1 strain HN-Xoo-2 with extremely strong pathogenicity was also improved compared with TP309 and the single gene, that is, the resistance spectrum to bacterial blight pathogen was expanded; furthermore, for most strains, the disease resistance after polymerization was also stronger than that of the wild type. Therefore, the polymer material constructed by the present invention has achieved the effect of 1+1>2 in terms of resistance to bacterial blight and resistance spectrum to bacterial blight pathogen.

[0197] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application. Sequence Listing <110> Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences <120> A new broad-spectrum antibacterial gene and its application <130> 212088 <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 3285 <212> DNA <213> Rice (Oryza sativa L.) <400> 1 atggcggcgg cgctggaagc attcgcggcc aagctggcga acgtcctggt ggggatggcg 60 aaggaggagg tggagacgct cctgggcgtg cccggcgcga tcgccaagct cgagacgacg 120 ctcggcgacc tgagcagcat cctggccgac gccgaccgga ggcgcatcca cgacccgggc 180 gtggagcggt gggtgaggga gctcaaggac gccatgtacg acgccgacga catccttgac 240 ctcttccgcg ccatggaggg cggagaagac cccggctcgc cgccaagagc tgctccggcg 300 ccgtcggcgt gctggagcgc cctctgccgc cgcagccctg ccgctacgcg caagatcggg 360 aggaagatcc aggagctcaa ccggagggtg gaggagatcg cgaagaggag ctcccgcttt 420 ggatttgtct cccaagtaat ccactcctcc tcggcccttc gtctaaccga tagacccatg 480 tgttcttgct cgtcagaaag cagccgcaac agcaagacgg gaccatccat cattcgatcc 540 gatgttgtcg gcgacaagat agatcttcac acaaggaacc tcgttgatct gctgattggc 600 aacaagctgg cggatggtcg cacgcgcgca agatcgtcag gcgatgtcat cgccgtcgcg 660 atcaccggcg ctggggggat aggcaagacc acgcttgcca ggatggtctt caacgacgcc 720 gtgttggaga gccacttcga caagaaggta tggctgagcg tgaatcagga ggtcaacgag 780 gttcacctcc tgcacggcgt gatcgccgcg tttgggggaa gctaccatgg ctgcgccggg 840 gacaaggccc tgctcgagga cacgttgaag catgccgtga ggcagaagag gttcctgctg 900 gtgatggatg acgtgtggag cgatagggtg tggagcgatc tgctccgagc accgctcggt 960 gcttgtgctc ctggaagccg agtgttggtg acgacgagga acgacggagt tgctcgtggg 1020 atgagagccc agcacctcca ccgggttgag aagctggatc taggtgattc ttggtcactg 1080 ctaaagaagc aggtagttct gaacgagggc gatgaatctg agattgatgg actagaggac 1140 atcggattga agatcgtaga aagatgtgat ggcttgccac ttgcgattaa ggttgtgggt 1200 ggactcttac tgaacaaggg caaaacgaga gatgcttggg tgaacgtctc taatcacttt 1260 gcatggtcaa tgacaagaag caatgacgac atcaacaaag cggtctatct gagctacgaa 1320 gagctgcctc cgcatttgaa acagtgcttc gtgttctgct cacttttccc taaagatgaa 1380 ctgatcataa gaggagtaat agtcaggatg tggattgcac aaggttacgg acatgacata 1440 atgagatcga cgctacctga agatttggga gttgaatatt acaatgagtt ggtgtcacgg 1500 aatcttctag agccatacaa acgatcctat gatctatcag caagcacaat gcatgatgtt 1560 attcgctcct ttgctcaaca gatagttaaa gatgaaggac tacttgtcaa tgacagacaa 1620 gatgtgcatg gtattgcagg tgcttcaaag ctgcgtcact tgtctgtatc caaaactgca 1680 atagagcggg tcgctataca aaagcaagtg tcattgagga cattgttgct ctttgggaga 1740 tgtataactg agttgacgta tttcaggaac aatatctctt gcctaagagt actacattta 1800 caaggtgtag atcttgttga cctgccggac tatatatgcc atctcaagca tctaagatac 1860 ttggggcttg caaatacagg catatctgca atccctcgag gcataggaaa tctaaaattt 1920 ctacagttca ttgaccttat ggggtgtcgg aatttcatc agcttcctga cagcatcttg 1980 aagctacaga atatgaggtt tctcgacttc aggggcacga ggttaacctc aattcctcca 2040 ggtatgggaa agctagaaaa cttggtgaac atgttggggt tcccaactta tttggatgac 2100 aggggacatg cctggagcag cttggaagaa ctacggtctt tgtcgaacct aaaatggctt 2160 gatttaagag gtctagagct tgcatcttca ggctctatg ctgctacagc aatgctcaac 2220 agtaaaaagc acttgaaaat cttagacttg acatttgcca gtaggctcac cgacaacggg 2280 atgatcgaag gaaccagcaa tgtcatcgag gagcaggaac gagccgagga tgtgttgagt 2340 aatctctgtc ctccgccttg cgtagaatgt cttacggtca atggttactt tggatatcga 2400 ctaccccgat ggatgagaac aatgtcggac tttccaagct taaggcgttt ggagctgaag 2460 gactacgtat gctgcaagca gctgcctgtc ggcttgggcc agctcccttt tcttgattat 2520 atttggattg atcatgctcc atccatcgtg agcattggcc atgatctcct cttcctctcc 2580 tcctctagtg ctgatgacca gaaagtcaca actggaacaa ggatcactag gaagctgcag 2640 ctccatggtc tttctcgcgg tgatgctggt gttgcatttc cgaagctaga aacactgggt 2700 ttaaagggga tgttgggatg gagagtgtgg aactgggatc agcaaacacc agggatgccc 2760 gccttagacg ttgttaccat caccggttgt aaactacgtt atcttccgct tggacttgta 2820 caccatgcaa ccgcactaag ggtgctgaat ctcagaaatg cgccgcacct gatctccgta 2880 gagaacttcc cgtcacttgt ggagctcacg tcagctgaca acccgaagct gcagaggatc 2940 tccaacagtc caagactgcg acatatcgtc gttatcagat gcccagggct gaaggtagtg 3000 aaggatttgc aatcacttag gagcgtcatt tggaaggatt tggatgctga tgccctccca 3060 gagtacctac gagagacaga gctaaataag ctggacgtgt actgcagtct aagattgctt 3120 aaactcatat ccttgcaaga tggcagctat gagtgggaaa agatccagca cgtccagcta 3180 ctgaaggcat atgggaagag atcaacggag gataaggttg accggcacat cttctacact 3240 aaggatccgt actcgtttga agcagatatg ggcgaagatc tatga 3285 <210> 2 <211> 1094 <212> PRT <213> Oryza sativa L. <400> 2 Met Ala Ala Ala Leu Glu Ala Phe Ala Ala Lys Leu Ala Asn Val Leu 1 5 10 15 Val Gly Met Ala Lys Glu Glu Val Glu Thr Leu Leu Gly Val Pro Gly 20 25 30 Path To Path Lys Leu Glu Thr Thr Leu Gly Asp Leu Ser Ser To Leu 35 40 45 Ala Asp Ala Asp Arg Arg Arg Ile His Asp Pro Gly Val Glu Arg Trp 50 55 60 Val Arg Glu Leu Lys Asp Ala Met Tyr Asp Ala Asp Asp Ile Leu Asp 65 70 75 80 Leu Phe Arg Ala Met Glu Gly Gly Glu Asp Pro Gly Ser Pro Pro Arg 85 90 95 Ala Ala Pro Ala Pro Ser Ala Cys Trp Ser Ala Leu Cys Arg Arg Ser 100 105 110 Pro Ala Ala Thr Arg Lys Ile Gly Arg Lys Ile Gln Glu Leu Asn Arg 115 120 125 Arg Val Glu Glu Ile Ala Lys Arg Ser Ser Arg Phe Gly Phe Val Ser 130 135 140 Gln Val Ile His Ser Ser Ser Ala Leu Arg Leu Thr Asp Arg Pro Met 145 150 155 160 Cys Ser Cys Ser Ser Glu Ser Ser Arg Asn Ser Lys Thr Gly Pro Ser 165 170 175 Ile Ile Arg Ser Asp Val Val Gly Asp Lys Ile Asp Leu His Thr Arg 180 185 190 Asn Leu Val Asp Leu Leu Ile Gly Asn Lys Leu Ala Asp Gly Arg Thr 195 200 205 Arg Ala Arg Ser Ser Gly Asp Val Ile Ala Val Ala Ile Thr Gly Ala 210 215 220 Gly Gly Ile Gly Lys Thr Thr Leu Ala Arg Met Val Phe Asn Asp Ala 225 230 235 240 Val Leu Glu Ser His Phe Asp Lys Lys Val Trp Leu Ser Val Asn Gln 245 250 255 Glu Val Asn Glu Val His Leu Leu His Gly Val Ile Ala Ala Phe Gly 260 265 270 Gly Ser Tyr His Gly Cys Ala Gly Asp Lys Ala Leu Leu Glu Asp Thr 275 280 285 Leu Lys His Ala Val Arg Gln Lys Arg Phe Leu Leu Val Met Asp Asp 290 295 300 Val Trp Ser Asp Arg Val Trp Ser Asp Leu Leu Arg Ala Pro Leu Gly 305 310 315 320 Ala Cys Ala Pro Gly Ser Arg Val Leu Val Thr Thr Arg Asn Asp Gly 325 330 335 Val Ala Arg Gly Met Arg Ala Gln His Leu His Arg Val Glu Lys Leu 340 345 350 Asp Leu Gly Asp Ser Trp Ser Leu Leu Lys Lys Gln Val Val Leu Asn 355 360 365 Glu Gly Asp Glu Ser Glu Ile Asp Gly Leu Glu Asp Ile Gly Leu Lys 370 375 380 Ile Val Glu Arg Cys Asp Gly Leu Pro Leu Ala Ile Lys Val Val Gly 385 390 395 400 Gly Leu Leu Leu Asn Lys Gly Lys Thr Arg Asp Ala Trp Val Asn Val 405 410 415 Ser Asn His Phe Ala Trp Ser Met Thr Arg Ser Asn Asp Asp Ile Asn 420 425 430 Lys Ala Val Tyr Leu Ser Tyr Glu Glu Leu Pro Pro His Leu Lys Gln 435 440 445 Cys Phe Val Phe Cys Ser Leu Phe Pro Lys Asp Glu Leu Ile Ile Arg 450 455 460 Gly Val Ile Val Arg Met Trp Ile Ala Gln Gly Tyr Gly His Asp Ile 465 470 475 480 Met Arg Ser Thr Leu Pro Glu Asp Leu Gly Val Glu Tyr Tyr Asn Glu 485 490 495 Leu Val Ser Arg Asn Leu Leu Glu Pro Tyr Lys Arg Ser Tyr Asp Leu 500 505 510 Ser Ala Ser Thr Met His Asp Val Ile Arg Ser Phe Ala Gln Gln Ile 515 520 525 Val Lys Asp Glu Gly Leu Leu Val Asn Asp Arg Gln Asp Val His Gly 530 535 540 Ile Ala Gly Ala Ser Lys Leu Arg His Leu Ser Val Ser Lys Thr Ala 545 550 555 560 Ile Glu Arg Val Ala Ile Gln Lys Gln Val Ser Leu Arg Thr Leu Leu 565 570 575 Leu Phe Gly Arg Cys Ile Thr Glu Leu Thr Tyr Phe Arg Asn Asn Ile 580 585 590 Ser Cys Leu Arg Val Leu His Leu Gln Gly Val Asp Leu Val Asp Leu 595 600 605 Pro Asp Tyr Ile Cys His Leu Lys His Leu Arg Tyr Leu Gly Leu Ala 610 615 620 Asn Thr Gly Ile Ser Ala Ile Pro Arg Gly Ile Gly Asn Leu Lys Phe 625 630 635 640 Leu Gln Phe Ile Asp Leu Met Gly Cys Arg Asn Phe His Gln Leu Pro 645 650 655 Asp Ser Ile Leu Lys Leu Gln Asn Met Arg Phe Leu Asp Phe Arg Gly 660 665 670 Thr Arg Leu Thr Ser Ile Pro Pro Gly Met Gly Lys Leu Glu Asn Leu 675 680 685 Val Asn Met Leu Gly Phe Pro Thr Tyr Leu Asp Asp Arg Gly His Ala 690 695 700 Trp Ser Ser Leu Glu Glu Leu Arg Ser Leu Ser Asn Leu Lys Trp Leu 705 710 715 720 Asp Leu Arg Gly Leu Glu Leu Ala Ser Ser Gly Ser Met Ala Ala Thr 725 730 735 Ala Met Leu Asn Ser Lys Lys His Leu Lys Ile Leu Asp Leu Thr Phe 740 745 750 Ala Ser Arg Leu Thr Asp Asn Gly Met Ile Glu Gly Thr Ser Asn Val 755 760 765 Ile Glu Glu Gln Glu Arg Ala Glu Asp Val Leu Ser Asn Leu Cys Pro 770 775 780 Pro Pro Cys Val Glu Cys Leu Thr Val Asn Gly Tyr Phe Gly Tyr Arg 785 790 795 800 Leu Pro Arg Trp Met Arg Thr Met Ser Asp Phe Pro Ser Leu Arg Arg 805 810 815 Leu Glu Leu Lys Asp Tyr Val Cys Cys Lys Gln Leu Pro Val Gly Leu 820 825 830 Gly Gln Leu Pro Phe Leu Asp Tyr Ile Trp Ile Asp His Ala Pro Ser 835 840 845 Ile Val Ser Ile Gly His Asp Leu Leu Phe Leu Ser Ser Ser Ser Ala 850 855 860 Asp Asp Gln Lys Val Thr Thr Gly Thr Arg Ile Thr Arg Lys Leu Gln 865 870 875 880 Leu His Gly Leu Ser Arg Gly Asp Ala Gly Val Ala Phe Pro Lys Leu 885 890 895 Glu Thr Leu Gly Leu Lys Gly Met Leu Gly Trp Arg Val Trp Asn Trp 900 905 910 Asp Gln Gln Thr Pro Gly Met Pro Ala Leu Asp Val Val Thr Ile Thr 915 920 925 Gly Cys Lys Leu Arg Tyr Leu Pro Leu Gly Leu Val His His Ala Thr 930 935 940 Ala Leu Arg Val Leu Asn Leu Arg Asn Ala Pro His Leu Ile Ser Val 945 950 955 960 Glu Asn Phe Pro Ser Leu Val Glu Leu Thr Ser Ala Asp Asn Pro Lys 965 970 975 Leu Gln Arg Ile Ser Asn Ser Pro Arg Leu Arg His Ile Val Val Ile 980 985 990 Arg Cys Pro Gly Leu Lys Val Val Lys Asp Leu Gln Ser Leu Arg Ser 995 1000 1005 Val Ile Trp Lys Asp Leu Asp Ala Asp Ala Leu Pro Glu Tyr Leu Arg 1010 1015 1020 Glu Thr Glu Leu Asn Lys Leu Asp Val Tyr Cys Ser Leu Arg Leu Leu 1025 1030 1035 1040 Lys Leu Ile Ser Leu Gln Asp Gly Ser Tyr Glu Trp Glu Lys Ile Gln 1045 1050 1055 His Val Gln Leu Leu Lys Ala Tyr Gly Lys Arg Ser Thr Glu Asp Lys 1060 1065 1070 Val Asp Arg His Ile Phe Tyr Thr Lys Asp Pro Tyr Ser Phe Glu Ala 1075 1080 1085 Asp Met Gly Glu Asp Leu 1090 <210> 3 <211> 7860 <212> DNA <213> Oryza sativa L. <400> 3 atggcggcgg cgctggaagc attcgcggcc aagctggcga acgtcctggt ggggatggcg 60 aaggaggagg tggagacgct cctgggcgtg cccggcgcga tcgccaagct cgagacgacg 120 ctcggcgacc tgagcagcat cctggccgac gccgaccgga ggcgcatcca cgacccgggc 180 gtggagcggt gggtgaggga gctcaaggac gccatgtacg acgccgacga catccttgac 240 ctcttccgcg ccatggaggg cggagaagac cccggctcgc cgccaagagc tgctccggcg 300 ccgtcggcgt gctggagcgc cctctgccgc cgcagccctg ccgctacgcg caagatcggg 360 aggaagatcc aggagctcaa ccggagggtg gaggagatcg cgaagaggag ctcccgcttt 420 ggatttgtct cccaagtaat ccactcctcc tcggcccttc gtctaaccga tagacccatg 480 tgttcttgct cgtcagaaag cagccgcaac agcaagacgg gaccatccat cattcgatcc 540 gatgttgtcg gcgacaagat agatcttcac acaaggaacc tcgttgatct gctgattggc 600 aacaagctgg cggatggtcg cacgcgcgca agatcgtcag gcgatgtcat cgccgtcgcg 660 atcaccggcg ctggggggat aggcaagacc acgcttgcca ggatggtctt caacgacgcc 720 gtgttggaga gccacttcga caagaaggta tggctgagcg tgaatcagga ggtcaacgag 780 gttcacctcc tgcacggcgt gatcgccgcg tttgggggaa gctaccatgg ctgcgccggg 840 gacaaggccc tgctcgagga cacgttgaag catgccgtga ggcagaagag gttcctgctg 900 gtgatggatg acgtgtggag cgatagggtg tggagcgatc tgctccgagc accgctcggt 960 gcttgtgctc ctggaagccg agtgttggtg acgacgagga acgacggagt tgctcgtggg 1020 atgagagccc agcacctcca ccggttgag aagctggatc taggtgattc ttggtcactg 1080 ctaaagaagc aggtaagact atcacatagt atctatctat ctattttcta tctatctatc 1140 tattatctat ctatctatta tctattatta agacagctcg aaagaaggc accacgttcg 1200 ctgtggaggc tagaatttc cacattaatc ggaaaaag aaaaaaaga aaagagagt 1260 ccaactagaa atacaatcta aaaagagct gaaattcgaa attaaaaata agcaatattg 1320 acagaaattt ctataga acccaatacg agattatta aaattcgaaa taaaaaaa 1380 aaaattca aattagaaaaaaaggt gagtccatgt aggaatacaa tctaaaaaaa 1440 gctgaaatttc ggaattaaaa ataagcaata ttgaaagaat tttcatata agaacccaat 1500 tcgaaattta tcaaattcg aaaaaaat aaaaaaat ctaaaattag aaagaaaag 1560 gagaatccaa gtaggaatac atttaaaaa cagctgaat tcgaattta aaataggaa 1620 tattaaaaga agaatccaa taagaatcca atacgagatt aattaattt cggataaaa 1680 aaaaaata atccaaatt aggaaaaaaaaaa gagttcaagt aggaaaaaa 1740 1800 1860 gaaaattaa aagagagttc aagtaggaat acaattataa acaactaa attgaaaaata 1920 1980 2040 aatttgtgat aaaaataaag actattaaaaa taaaagacca tctaaaacac atgacgaaat 2100 aaaataag acatgcctat aaaagtag agtggtggcg gttgatacga catataaaaa 2160 ttgttaataa aacatcaaat aaaatcctaa tgacgattaa aaggggac gtcaggcaga 2220 2280 taatcatttc gatttttaaa atctcaatga caataaaaag gagaagcagc gggcggggtg 2340 2400 aattccaatg atagttatgt tcaattttta gaatcaat gaataaag agtatgcggt 2460 ggacggggctg taaaggggca tagtggccctc gtttgatggg acttctaaaa attataaaaa 2520 aaaaacaac aagttcatttt ttaaggtt cggaatttct aaaagtaaaaaaaaaaaaaaaaaaaaaaaca 2580 atgataatca ggttcgattt taaaatctca atgacaaca agaaggaga tagcggacga 2640 gccatagagg agtacaatgg caaagctact gacggtttgg cgggacttct aaaagtaaa 2700 aatgaaccca acgaatatt atgttcaattt ttaaatct caatgacaat aaagagaga 2760 gacgtggac gggccgtaca ggagtgtaat ggcaacgttt gacgggacat ctagaaatta 2820 taaaaatgaa acttaacgtg acataaact ctaaaaacta caaatccaa ttttaaagg 2880 ttccaagaag atgataga atagtggta gatcgagcaa gcaataag aaagagatgg 2940 cataagaggt agcactggt gtgactttc aaactatat aattagaac acgatgatga 3000 taagttttgg tctttcaag tcttaataca atgagatagc tattaata attttaagta 3060 aaatcatact taaaaaatat atgattttgt tgggtgcta gccgggcaat tgcgcgggct 3120 acccagctag ttattacta attagtactg agatgcacat tactattac tctctccatc 3180 taatttgat agtcatattt tattttggca tactgaccaa ggataagtaa ttctacttat 3240 catccattta acatgttat ttctcgttaa caagcgatta attatattt acatttctcg 3300 atgcccatgc agccaatctt gtgtggaaga atggagtc acgcattaaa tctgagaaaa 3360 3420 tggaaatatg cctatcaaa ctagatggag ggagtactaa ttattactcc ctccatccca 3480 taatatagg gattttgagt ttccttgc aacgtttgac cactcatctt attcatttt 3540 tttgaaatt attattatt ttatttgtga cttaatttat tatctatagt actttaagca 3600 taacttttcg tttttatat ttgaaaaaaa atttgaataa gacgagtagt caatgttac 3660 aagcaaaaac tgaaaatccc ttatattgtg ggatggaggg agtattagta ctgggaataa 3720 ttgaatatag atagaatg tgcatctctg tactactccg tccaaata taagaacacc 3780 gataggaca atttctagga ttacgaatct agatatttcc tagtactg attctggaca 3840 tatagcctgt ctagattcgt agtactagga aatgtcctat ccggtgttct tattgggacg 3900 gaggagtac tattagtga gatgcacatt actattctat attcattaa gagagaatcc 3960 actcagtgcc actgagttta tcacacctct acaatttacc atcgactttg tcaagttcca 4020 caatacca ttctgctttc ttcaacctct actctctgcc atcaccgtgc actagctgtc 4080 agttaacctc tagttaacct ctgttagcgc tttgaaaga cctatttgcc cctactcat 4140 tccacaggt aattagttgt attttgca acctcaggac acacataata aaggtagta 4200 aaccatcaaa cggttcagc siaccata gggaaaaaa atcacatt ttgcttattt 4260 tagctatcca atcaaaaat ttcaacatg atggatgaca ctaagctcct atagatatag 4320 gagtgaagac caaatattt cagtatatta gccaactcca tacagtttag taccataata 4380 tgaagagata ttcattaca ttagccaact agaagtca cacacgttca tatagttcac 4440 acattagcca actccatgca gttcagccat acatgttgag gcatacagtt tagaatcaca 4500 gtgaatacgc gcgtccggtt gctgccgcat tggggacgga agtgccagta caacggcggt 4560 ggagatgctg caggcggacg gttctggtgc cgctgctgac ggcgacgatg gggactgctg 4620 cgctagggac agcgacgcca ggaggccgtt tgtggtggag gcgcggtagg cagaagcttg 4680 tcgcagcgcc ggtgacgaca ccaccaagac atcgatgatt gggacggtgg gcgcatgatg 4740 ggaggattgc ggcggcgctg aggatggaag tgccaggaca ccagcagcgg aggcgtgctg 4800 ggcggatggt tgctgcggca ctgctgtcgg caacgatggg gatggctgcg ctggggacgg 4860 tggcgcctgg aggccgccgg cattggaggc gcggcaagcg gacgcttgca gcggtgctgg 4920 ggacggcgcc accaggatgt ccgcgattag ggtggtgggg gcgtgggggg ttgcggcaac 4980 gccaagccgt cgccagtgga ggcgctgttg ggcgacggcg ccatgggatc tggatgggag 5040 aggttcatgg ccggcggcgc atttcggtgg ggagagggga acgaagggga tctggatggg 5100 gagagggctc gtgtgcggcg gcgcatttca gtggggggag gggaacgatg gggatctgga 5160 tggggagagg gctcatcggc ggtggcacat ttcggtgggg agaggggaac gatggggaat 5220 taggtcaggg gtggtggtat ctagggttac aaaggttatt ttagtcaata cgagaaaatt 5280 aacagcgcaa aatgtatcct aactgacggt tcgtgacggc gatggcagag agtggaggtt 5340 gaagaaagca ggatggtata ttgtggaact tgacaaagtc gatggtagat tgtagagatg 5400 tgataaactc agtggcactg agtggattct ctcttcaatt attcacagca gcacatacat 5460 gcgttggtgg atggtatttc tcttgctcct acaaaatgtg aggctgttac tagtatttct 5520 gctcagagga aaacaagtgt ttttagcaca aattaagccg ttgaaaccaa cggaaaacaa 5580 cttgatgcaa tatattttac tagtactagg ttttttctcc ctagttttgt tcctctcttg 5640 ctctctgatg tggcaattct ccaacaggta gttctgaacg agggcgatga atctgagatt 5700 gatggactag aggacatcgg attgaagatc gtagaaagat gtgatggctt gccacttgcg 5760 attaaggttg tgggtggact cttactgaac aagggcaaaa cgagagatgc ttgggtgaac 5820 gtctctaatc actttgcatg gtcaatgaca agaagcaatg acgacatcaa caaagcggtc 5880 tatctgagct acgaagagct gcctccgcat ttgaaacagt gcttcgtgtt ctgctcactt 5940 ttccctaaag atgaactgat cataagagga gtaatagtca ggatgtggat tgcacaaggt 6000 tacggacatg acataatgag atcgacgcta cctgaagatt tgggagttga atattacaat 6060 gagttggtgt cacggaatct tctagagcca tacaaacgat cctatgatct atcagcaagc 6120 6180 gtcaatgaca gcaagatgt gcatggtatt gcaggtgctt caaagctgcg tcacttgtct 6240 gtatccaaaa ctgcaataga gcgggtcgct atacaaaagc aagtgtcatt gaggacattg 6300 ttgctctttg ggagatgtat aactgagttg acgtattttca ggaaatat ctcttgccta 6360 agagtactac atttacaagg tgtagatctt gttgacctgc cggactatat atgccatctc 6420 aagcatctaa gatacttggg gcttgcaaat acaggcatat ctgcaatccc tcgaggcata 6480 ggaaatctaa aatttctaca gttcattgac cttatggggt gtcggaattt tcatcagctt 6540 cctgacagca tcttgaagct agaatatg aggtttctcg acttcagggg cacgaggtta 6600 acctcaattc ctccaggtat gggaaaagcta gaaaacttgg tgaacatgtt ggggttccca 6660 acttatttgg atgacagggg acatgcctgg agcagcttgg aagaactacg gtctttgtcg 6720 aacctaaaat ggcttgattt aagaggtcta gagcttgcat cttcaggctc tatggctgct 6780 acagcaatgc tcaacagtaa aaagcacttg aaaatcttag acttgacatt tgccagtagg 6840 ctcaccgaca acgggatgat cgaaggaacc agcaatgtca tcgaggagca ggaacgagcc 6900 gaggatgtgt tgagtaatct ctgtcctccg ccttgcgtag aatgtcttac ggtcaatggt 6960 tactttggat atcgactacc ccgatggatg agaacaatgt cggactttcc aagcttaagg 7020 cgtttggagc tgaaggacta cgtatgctgc aagcagctgc ctgtcggctt gggccagctc 7080 ccttttcttg attatatttg gattgatcat gctccatcca tcgtgagcat tggccatgat 7140 ctcctcttcc tctcctcctc tagtgctgat gaccagaaag tcacaactgg aacaaggatc 7200 actaggaagc tgcagctcca tggtctttct cgcggtgatg ctggtgttgc atttccgaag 7260 ctagaaacac tgggtttaaa ggggatgttg ggatggagag tgtggaactg ggatcagcaa 7320 acaccaggga tgcccgcctt agacgttgtt accatcaccg gttgtaaact acgttatctt 7380 ccgcttggac ttgtacacca tgcaaccgca ctaagggtgc tgaatctcag aaatgcgccg 7440 cacctgatct ccgtagagaa cttcccgtca cttgtggagc tcacgtcagc tgacaacccg 7500 aagctgcaga ggatctccaa cagtccaaga ctgcgacata tcgtcgttat cagatgccca 7560 gggctgaagg tagtgaagga tttgcaatca cttaggagcg tcatttggaa ggatttggat 7620 gctgatgccc tcccagagta cctacgagag acagagctaa ataagctgga cgtgtactgc 7680 agtctaagat tgcttaaact catatccttg caagatggca gctatgagtg ggaaaagatc 7740 cagcacgtcc agctactgaa ggcatatggg aagagatcaa cggaggataa ggttgaccgg 7800 cacatcttct acactaagga tccgtactcg tttgaagcag atatgggcga agatctatga 7860 <210> 4 <211> 17 <212> DNA <213> Primer <400> 4 gatgggagag gttcatg 17 <210> 5 <211> 17 <212> DNA <213> Primer <400> 5 atgtcatgtc cgtaacc 17 <210> 6 <211> 21 <212> DNA <213> Primer <400> 6 cgatcggtat aacagcaaaa c 21 <210> 7 <211> 21 <212> DNA <213> Primer <400> 7 tctgatcatg catgttctgt g 21

Claims

1. A method for enhancing the antibacterial ability of grass plants, characterized in that: The method comprises: introducing into the plant XA Gene, expressing Xa46 protein with antibacterial activity, the amino acid sequence of the Xa46 protein is shown in SEQ ID NO: 2, wherein the plant is rice, and the fungus is bacterial blight pathogen Xanthomonas oryzae pv. oryzae .

2. The method according to claim 1, characterized in that The introduction of XA Genes include: XA The gene or an expression construct containing the gene is introduced into the plant.

3. The method according to claim 1, characterized in that The plant further comprises other antibacterial genes, which express antibacterial proteins with antibacterial activity, wherein the other antibacterial genes are selected from: XOt , XA1 , Xa3 / Xa26 , Xa4 , x5 , Xa7, Xa10 , xa13 , XA23 , xa25 , XA27 , xa41 , XA , XA14 , XA31 , XA , x8 , xa15 , xa19 or xa20 .

4. The method according to claim 3, characterized in that The other antibacterial genes are XOt .

5. The method according to claim 3, characterized in that The method further comprises: introducing XA The plant containing the gene is crossed with the plant containing the other antibacterial gene to obtain progeny plants that can express active Xa46 protein and active other antibacterial proteins.

6. The method according to claim 5, characterized in that The method further comprises: further hybridizing or selfing the progeny plants to obtain progeny plants capable of expressing active Xa46 protein and other active antibacterial proteins.

7. A XA The use of the gene or the protein encoded by it is used to: enhance the antibacterial ability of Gramineae plants, or to prepare a preparation for enhancing the antibacterial ability of Gramineae plants, the amino acid sequence of Xa46 protein is shown in SEQ ID NO: 2, wherein, The plant is rice, and the fungus is bacterial blight pathogen Xanthomonas oryzae pv. oryzae .

8. The use according to claim 7, characterized in that The grass plant is a plant into which other antibacterial genes are introduced or other antibacterial genes are upregulated and express other antibacterial proteins with antibacterial activity, and the plant containing the other antibacterial genes is: endogenous other antibacterial genes exist, and other antibacterial genes are introduced exogenously, wherein the other antibacterial genes are selected from: XOt , XA1 , Xa3 / Xa26 , Xa4 , x5 , Xa7, Xa10 , xa13 , XA23 , xa25 , XA27 , xa41 , XA , XA14 , XA31 , XA , x8 , xa15 , xa19 or xa20 .

9. The use according to claim 8, characterized in that The other antibacterial genes are XOt .

10. A plant XA The use of the gene or the protein encoded by it is used as a molecular marker for identifying the antibacterial ability of Gramineae plants. The amino acid sequence of the Xa46 protein is shown in SEQ ID NO: 2, wherein: The plant is rice, and the fungus is bacterial blight pathogen Xanthomonas oryzae pv. oryzae .

11. A method for identifying antibacterial properties of grass plants, the method comprising: Identification test plants XA The sequence of a gene or its encoded protein, if the XA The gene encodes a Xa46 protein with antibacterial activity, and no mutation occurs that causes loss of antibacterial activity, then the plant is a plant with antibacterial ability, the mutation that causes loss of antibacterial activity includes: gene frameshift or protein premature termination, the Xa46 protein is a polypeptide with an amino acid sequence as shown in SEQ ID NO: 2, wherein the plant is rice, and the fungus is bacterial blight pathogen Xanthomonas oryzae pv. oryzae .

12. The method according to claim 11, characterized in that The method comprises the steps of identifying whether the 673rd base of the nucleotide sequence shown in SEQ ID NO: 1 is deleted in the Xa46 gene sequence of the test plant. If the deletion occurs, the plant is a plant without antibacterial ability. If the deletion occurs and there is no deletion in other sequences, the plant is a plant with antibacterial ability.

13. A plant cell, tissue or organ, characterized in that: It introduces XA The gene expression construct, the plant cell, tissue or organ has no reproductive ability and does not regenerate into a complete plant body, and the amino acid sequence of the Xa46 protein is shown in SEQ ID NO: 2, wherein the plant is rice.

14. The plant cell, tissue or organ according to claim 13, wherein: It also contains other antibacterial genes, which express antibacterial proteins with antibacterial activity. The plant cells, tissues or organs containing other antibacterial genes are: endogenous antibacterial genes, exogenously introduced antibacterial genes or other antibacterial genes are upregulated, wherein the other antibacterial genes are selected from: XOt , XA1 , Xa3 / Xa26 , Xa4 , x5 , Xa7, Xa10 , xa13 , XA23 , xa25 , XA27 , xa41 , XA , XA14 , XA31 , XA , x8 , xa15 , xa19 or xa20 .

15. The plant cell, tissue or organ according to claim 14, characterized in that The other antibacterial genes are XOt .

Images