Sorghum SbMS1 protein and its encoding gene and its application

Abstract

The present invention discloses a sorghum SbMS1 protein and a gene encoding it and an application thereof. The purpose of the present invention is to overcome the deficiencies of the prior art and provide an application of the SbMS1 protein and a gene encoding it in regulating plant fertility. Experiments have shown that the functional loss of the SbMS1 gene will lead to high male sterility in sorghum. Compared with the prior art, the present invention has the following beneficial effects: the loss of the SbMS1 gene function will specifically lead to high male sterility in sorghum; the technology of knocking out or inhibiting the specific expression of SbMS1 can be used to obtain a high male sterility line of sorghum, which has very important applications in agricultural production.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to sorghum SbMS1 protein and a coding gene and application thereof. Background Art

[0002] Hybrid vigor is a common phenomenon in the biological world. It refers to the phenomenon that the hybrids produced by the crossbreeding of two parents with different genotypes exceed their parents in growth potential, vitality, fecundity, adaptability, yield, quality and other traits. The use of hybrid vigor is also an important way to increase crop yields. Among them, the cloning of male sterility genes and the cultivation of male sterile lines are the premise and basis for the effective use of hybrid vigor in self-pollinating crops. With rice as a representative, there are two main ways of utilization: "cytoplasmic-nuclear interaction three-line" and "photothermal-sensitive sterile two-line". In sorghum, the use of hybrid vigor is realized by using cytoplasmic male sterile lines. However, "cytoplasmic-nuclear interaction three-line" and "photothermal-sensitive sterile two-line" have their own shortcomings. For example, the cultivation of cytoplasmic male sterile lines requires multiple generations of backcrossing, which is time-consuming and labor-intensive; the production of seeds requires the matching of sterile lines, maintenance lines, and restorer lines, and the seed production process is cumbersome; the genetic resources of the restorer line are limited and require special cultivation; the fertility of the photothermal-sensitive male sterile line is unstable and easily affected by environmental changes, etc.

[0003] High male sterility in plants refers to the phenomenon that the female gametophyte of the plant develops normally, while most of the male gametophytes develop abnormally and usually can only produce a small amount of functional pollen. Plants can be maintained by self-pollination with a small amount of normal pollen, especially some crops with high reproduction coefficients such as rice, wheat, sorghum, rapeseed, millet, pearl millet, etc. Using this highly male sterile material to cultivate a sterile line, combined with materials with dominant herbicide resistance traits as a restorer line, hybrids can be prepared, greatly broadening the genetic basis for the use of hybrid vigor, simplifying the seed production process, and the fertility of the sterile line is relatively stable, which has obvious advantages over the traditional "cytoplasmic-nuclear interaction three-line" and "photothermal-sensitive sterile two-line". Summary of the invention

[0004] The first object of the present invention is to provide a new use of SbMS1 protein.

[0005] The present invention provides the use of SbMS1 protein in regulating plant male fertility:

[0006] The SbMS1 protein is a1) or a2) or a3) or a4):

[0007] a1) the amino acid sequence is the protein shown in SEQ ID NO: 3;

[0008] a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3;

[0009] a3) a protein related to plant male fertility obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 3;

[0010] a4) A protein having 90% identity with the amino acid sequence shown in SEQ ID NO: 3, which is derived from sorghum and is associated with plant male fertility.

[0011] In the protein described in a2) above, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0012] In the protein described in a3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0013] In the protein described in a4) above, "identity" includes amino acid sequences having 90% or more, or 91% or more, or 92% or more, or 93% or more, or 94% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more homology with the amino acid sequence shown in Sequence 3 of the present invention.

[0014] The protein described in a1) or a2) or a3) or a4) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0015] The second object of the present invention is to provide new uses of biomaterials related to SbMS1 protein.

[0016] The present invention provides the use of biological materials related to SbMS1 protein in regulating plant male fertility:

[0017] The biological material is any one of the following A1) to A8):

[0018] A1) a nucleic acid molecule encoding the SbMS1 protein;

[0019] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0020] A3) a recombinant vector containing the nucleic acid molecule described in A1);

[0021] A4) a recombinant vector containing the expression cassette described in A2);

[0022] A5) a recombinant microorganism containing the nucleic acid molecule described in A1);

[0023] A6) a recombinant microorganism containing the expression cassette described in A2);

[0024] A7) a recombinant microorganism containing the recombinant vector described in A3);

[0025] A8) A recombinant microorganism containing the recombinant vector described in A4).

[0026] In the above application, the nucleic acid molecule described in A1) is the gene shown in B1) or B2) or B3) or B4) below:

[0027] B1) The genomic DNA molecule shown in Sequence 1;

[0028] B2) cDNA molecule shown in sequence 2;

[0029] B3) a cDNA molecule or genomic DNA molecule that has 75% or more identity with the nucleotide sequence defined in B1) or B2) and encodes the SbMS1 protein;

[0030] B4) a cDNA molecule or a genomic DNA molecule that hybridizes with the nucleotide sequence defined in B1) or B2) or B3) under stringent conditions and encodes the SbMS1 protein.

[0031] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0032] A person skilled in the art can easily mutate the nucleotide sequence encoding the protein SbMS1 of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence encoding the protein SbMS1 are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein SbMS1 and have the same function.

[0033] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 3 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0034] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0035] In the above application, the stringent conditions are hybridization and washing at 68°C in a 2×SSC, 0.1% SDS solution for 5 min each time, and hybridization and washing at 68°C in a 0.5×SSC, 0.1% SDS solution for 15 min each time; or hybridization and washing at 65°C in a 0.1×SSPE (or 0.1×SSC), 0.1% SDS solution.

[0036] In the above application, the expression cassette (SbMS1 gene expression cassette) containing a nucleic acid molecule encoding protein SbMS1 described in A2) refers to a DNA capable of expressing protein SbMS1 in a host cell, and the DNA may include not only a promoter for initiating transcription of SbMS1, but also a terminator for terminating transcription of SbMS1. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters; tissue, organ and development-specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and nopaline and octopine synthase terminators.

[0037] The recombinant vector containing the SbMS1 gene expression cassette can be constructed with an existing expression vector. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb, etc. The plant expression vector can also include the 3' non-translated region of the foreign gene, that is, a polyadenylic acid signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylic acid signal can guide polyadenylic acid to be added to the 3' end of the mRNA precursor, such as the Agrobacterium crown gall induction (Ti) plasmid gene (such as the nopaline synthase gene Nos), the non-translated region transcribed at the 3' end of the plant gene (such as the soybean storage protein gene) all have similar functions. When using the gene construction plant expression vector of the present invention, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The source of the translation control signal and the start codon is extensive and can be natural or synthetic. The translation initiation region can come from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic marker genes (such as nptII gene that confers resistance to kanamycin and related antibiotics, bar gene that confers resistance to the herbicide phosphinothricin, hph gene that confers resistance to the antibiotic hygromycin, dhfr gene that confers resistance to methotrexate, EPSPS gene that confers resistance to glyphosate) or chemical resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker gene can be added, and transformed plants can be directly screened by adversity.

[0038] In the above applications, the vector may be a plasmid, a cosmid, a phage or a viral vector.

[0039] In the above applications, the microorganism may be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0040] The third object of the present invention is to provide a new use of the substance represented by m1 or m2;

[0041] m1. Substances that inhibit or reduce the activity or content of SbMS1 protein in plants;

[0042] m2. A substance that inhibits or reduces the expression of a nucleic acid encoding the SbMS1 protein in a plant or a substance that knocks out a nucleic acid encoding the SbMS1 protein in a plant.

[0043] The present invention provides the use of the substance represented by m1 or m2 in the following 1) or 2):

[0044] 1) Regulating plant male fertility;

[0045] 2) Cultivate male-sterile transgenic plants.

[0046] In the above application, the regulation of plant male fertility is to make the plant male sterile, which is manifested as: when the SbMS1 protein encoding nucleic acid in the plant is knocked out, the plant is male sterile, and further manifested as: when the SbMS1 protein encoding nucleic acid in the plant is knocked out, the pollen activity and / or fruit setting rate of the plant is significantly reduced.

[0047] The fourth object of the present invention is to provide a method for cultivating male sterile transgenic plants.

[0048] The method for cultivating male-sterile transgenic plants provided by the present invention comprises the following steps: reducing the content and / or activity of SbMS1 protein in the recipient plant or inhibiting or reducing the expression of SbMS1 protein encoding nucleic acid in the recipient plant or knocking out SbMS1 protein encoding nucleic acid in the recipient plant to obtain transgenic plants; the transgenic plants are male-sterile.

[0049] In the above method, the sequence of the SbMS1 protein encoding nucleic acid is the DNA molecule shown in Sequence 1 or Sequence 2.

[0050] Furthermore, the transgenic plant is male sterile, which is manifested in that the pollen activity of the transgenic plant is lower than that of the recipient plant and / or the fruit setting rate of the transgenic plant is lower than that of the recipient plant.

[0051] Furthermore, the substance for knocking out the nucleic acid encoding the SbMS1 protein in the recipient plant is a CRISPR / Cas9 system. The target sequence of the sgRNA in the CRISPR / Cas9 system is specifically a DNA molecule shown in Sequence 4.

[0052] In any of the above applications or methods, the plant is a dicotyledon or a monocotyledon; further, the monocotyledon is a Poaceae plant; further, the Poaceae plant is sorghum (such as sorghum Tx430).

[0053] The last object of the present invention is to provide a specific sgRNA or an expression cassette, vector, host cell, engineered bacteria or transgenic plant cell line containing the sgRNA encoding gene, wherein the target sequence of the sgRNA is the DNA molecule shown in Sequence 4.

[0054] The purpose of the present invention is to overcome the deficiencies of the prior art and provide the application of SbMS1 protein and its encoding gene in regulating plant fertility. Experiments have shown that the functional loss of the SbMS1 gene will lead to high male sterility in sorghum. Compared with the existing technology, the present invention has the following beneficial effects: the loss of the SbMS1 gene function will specifically lead to high male sterility in sorghum; the specific expression technology of knocking out or inhibiting SbMS1 can be used to obtain a high male sterility line of sorghum, which has very important applications in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 The SbMS1 gene structure, target design and gene editing type at the target site.

[0056] Figure 2 Schematic diagram of the SbMS1 genome sequence alignment between the wild-type sorghum variety TX430 and the gene-edited homozygous line sbms1#8.

[0057] Figure 3 Schematic diagram of plant morphological observation of the wild-type sorghum variety TX430 and the gene-edited homozygous line sbms1#8.

[0058] Figure 4 Schematic diagram of the panicle phenotype observation of the wild-type sorghum variety TX430 and the gene-edited homozygous line sbms1#8.

[0059] Figure 5 Pollen I of wild-type sorghum variety TX430 and gene-edited homozygous line sbms1#8 2 -Schematic diagram of IK staining observation.

[0060] Figure 6 Statistical chart of pollen fertility and fruit set rate of wild-type sorghum variety TX430 and gene-edited homozygous line sbms1#8. DETAILED DESCRIPTION

[0061] The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The test methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged.

[0062] The sorghum DNA in the following examples was extracted using the improved CTAB method. The specific steps are as follows: 0.1-0.2 grams of leaves were placed in a small mortar, an appropriate amount of liquid nitrogen was added, and the leaves were immediately ground into powder, placed in a 2 ml centrifuge tube, 800ul of 65°C preheated CTAB solution was added to the centrifuge tube, carefully mixed and placed in a 65°C water bath, and the centrifuge tube was taken out after 20 minutes, 800ul of chloroform / isoamyl alcohol solution (chloroform:isoamyl alcohol = 24:1) was added, mixed vigorously, centrifuged at 12000rpm for 10 minutes, the supernatant was taken, 800ul of chloroform / isoamyl alcohol solution (chloroform:isoamyl alcohol = 24:1) was added again, and the supernatant was taken in a new centrifuge tube, 600ul of isopropanol was added and mixed, and then placed at -20°C for more than half an hour. The precipitated DNA was centrifuged at 12000rpm for 10 minutes. The supernatant was removed, and the precipitate was washed twice with 500ul 70% ethanol, centrifuged and dried, dissolved in 100ul deionized water, and stored in a -20°C refrigerator.

[0063] The genomic sequence of the SbMS1 gene in the following examples is shown as Sequence 1 in the sequence listing, the CDS sequence of the SbMS1 gene is shown as Sequence 2 in the sequence listing, and the amino acid sequence of the SbMS1 protein is shown as Sequence 3 in the sequence listing.

[0064] The sorghum Tx430 in the following examples is described in the document “Sato-Izawa K, Tokue K, Ezura H. Development of a stable Agrobacterium-mediated transformation protocol for Sorghum bicolor Tx430[J]. Plant Biotechnology, 2018, 35(2).”

[0065] Example 1: Application of SbMS1 protein in regulating plant fertility

[0066] 1. Obtaining SbMS1 knockout sorghum

[0067] 1. Design of knockout targets

[0068] According to the SbMS1 gene sequence, the SbMS1 gene knockout target sequence was designed using the plant CRISPR / Cas9 online target design website CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The final screened SbMS1 gene knockout target sequence is as follows: 5'-CCGCACGTAGGGCGAATCCA-3' (sequence 4).

[0069] 2. Obtaining fragments containing target sequences for infusion connection

[0070] Add 5 μl of CRISPR (Sobic) upstream primer 5'-AGATGATCCGTGGCACCGCACGTAGGGCGAATCCAGTTTTAGAGCTATGC-3' and downstream primer 5'-GCATAGCTCTAAAACTGGATTCGCCCTACGTGCGGTGCCACGGATCATCT-3' to 10 μl of the system, incubate at 94°C for 10 min, anneal to 15°C at 0.1°C / s, and maintain at 15°C for 10 min to complete annealing and obtain a DNA fragment containing the target sequence for infusion connection.

[0071] 3. Construction of SbMS1 knockout vector

[0072] The PCas9 vector was digested with restriction endonuclease AarⅠ (Cat no.ER1581, ThermoFisherScientific, United States) at 37°C for 5 h to obtain a PCas9 linear vector. Then the DNA fragment 5'-AGATGATCCGTGGCACCGCACGTAGGGCGAATCCAGTTTTAGAGCTATGC-3' obtained in step 2 was ligated into the PCas9 linear vector using In-Fusion HD Cloning Kits (Cat no.639648, Takara, Japan), transformed into Escherichia coli competent cells Trans-T1 (Cat no.CD501, TransGen Biotech, China) and coated on solid LB medium containing spectinomycin Spec, and a single clone was picked and sequenced using primers 5'-CCCTTCACCGTCAGATGCTACT-3' and 5'-TGGATAATGTGCAAGGGATCTTT-3' (the target product sequence size was 1090 bp).

[0073] The nucleotide sequence of the PCas9 vector is shown in Sequence 5 in the sequence table, wherein positions 1611-1863 of Sequence 5 are nopaline synthase terminator, positions 1992-2789 are aminoglycoside phosphotransferase coding gene sequences, positions 2882-3061 are nopaline synthase promoter sequences, positions 3445-7545 are Cas9 (Csn1) endonuclease coding gene sequences of the type II CRISPR / Cas system of Streptococcus pyogenes, positions 7546-7566 are nuclear localization signal sequences, positions 7640-9632 are maize ubiquitin promoter sequences, positions 9707-10087 are rice snRNA U3 promoter sequences, and positions 10923-11013 are small guide RNA (sgRNA) coding gene sequences.

[0074] The sequencing results showed that the SbMS1 gene knockout vector was obtained by inserting the target sequence 5'-CCGCACGTAGGGCGAATCCA-3' between positions 10087 and 10923 of the PCas9 vector and keeping other sequences unchanged.

[0075] 4. Acquisition and identification of knockout sorghum

[0076] The SbMS1 gene knockout vector constructed in step 3 was introduced into Agrobacterium EHA105 to obtain recombinant bacteria; Agrobacterium-mediated genetic transformation was used to transform sorghum Tx430 immature embryo callus to obtain T 0 The primers 5'-GTGGAGCCCTGCTGCTG-3' and 5'-AAGGGCAGGCTACGACTA-3' (target product sequence size 315 bp) were used to generate transgenic plants. 0 DNA testing of transgenic plants was performed to determine the editing method of transgenic plants and obtain T 1 Generation seeds, sowed in a greenhouse, T 1 The transgenic plants of the first generation were tested for DNA again and the SbMS1 gene was amplified and sequenced using the primers in Table 1 to detect whether the editing method was stably inherited and the pure heterozygosity of the plant editing site. Finally, highly male-sterile plants were obtained. After sequencing, it was found that all of them were homozygous edited plants, and they were named sbms1#8, sbms1#11, and sbms1#20 respectively.

[0077] Table 1. Gene sequencing primers

[0078] Primer name Product length Upstream primer Downstream primer SbMS1-1 921 GGGACGAGCCTACAGGAA TAACAGTGCGGTTGTAAGGT SbMS1-2 1210 TCCCTCTGAAGAAACCTC GACTCATTCGCATTGGAC SbMS1-3 1254 CTTTCGTGATCGGTGTCC TGCACCAGCAGTAACCAT SbMS1-4 1369 ATGCTTAGGGAACTTGAA AGGAGTATGAATGGTGGG

[0079] Compared with the wild-type sorghum Tx430 genomic DNA, the only difference of sbms1#8 is that a base A is inserted in the gene sequence encoding the SbMS1 protein shown in Sequence 1. The insertion position of the base A is between positions 259 and 260 in Sequence 1 ( Figure 1 ), which causes frameshift and premature termination, and loss of SbMS1 protein function. The SbMS1 genome sequence alignment diagram of the wild-type sorghum variety Tx430 and the gene-edited homozygous line sbms1#8 is shown in Figure 2. Figure 2 shown.

[0080] Compared with the wild-type sorghum Tx430 genomic DNA, the only difference of sbms1#11 is that there is a 3bp base deletion in the gene sequence encoding the SbMS1 protein shown in Sequence 1. The deleted bases are located at positions 260-262 (ATT) of Sequence 1, resulting in the change of Asp (D) at position 88 to Ala (A) and the deletion of Ser (S) at position 89 in the amino acid sequence of the SbMS1 protein shown in Sequence 3.

[0081] Compared with the wild-type sorghum Tx430 genomic DNA, the only difference of sbms1#20 is that there is a 25bp base deletion in the gene sequence encoding the SbMS1 protein shown in Sequence 1. The deleted bases are located at positions 238-262 of Sequence 1, resulting in frame shift and premature termination, and the SbMS1 protein function is lost.

[0082] 2. Fertility analysis of SbMS1 knockout sorghum

[0083] 1. Observation of plant and ear morphology

[0084] The wild-type sorghum variety Tx430 and the gene-edited homozygous line sbms1#8 at the flowering stage were used for plant morphological observation, and the wild-type sorghum variety Tx430 and the gene-edited homozygous line sbms1#8 at the mature stage were used for panicle phenotype observation.

[0085] Schematic diagram of plant morphological observation of wild-type sorghum variety Tx430 and gene-edited homozygous line sbms1#8 Figure 3 The results showed that there was no significant difference in plant height between the gene-edited homozygous line sbms1#8 and the wild-type sorghum variety Tx430. Figure 4 As shown, the results showed that the wild-type sorghum variety Tx430 had normal fruiting, while the gene-edited homozygous strain sbms1#8 had a serious impact on fruiting and only produced a small number of seeds, indicating that the SbMS1 mutation seriously affected sorghum fruiting.

[0086] 2. Pollen I 2-IK staining

[0087] Place the anthers of wild-type sorghum variety Tx430 and gene-edited homozygous strain sbms1#8 on a glass slide, add 1 drop of distilled water, crush the anthers thoroughly with tweezers to release pollen grains, and then add 1-2 drops of I 2 -KI solution, cover with a coverslip, and observe under a low-power microscope. Those stained black are active pollen grains containing starch, and those stained yellow-brown are poorly developed pollen grains.

[0088] The results are as follows Figure 5 As shown, pollen from wild-type sorghum variety Tx430 and gene-edited homozygous line sbms1#8 were subjected to I 2 -IK staining revealed that pollen from the wild-type sorghum variety Tx430 could be colored normally ( Figure 5 Left), while most pollen of the gene-edited homozygous strain sbms1#8 cannot be colored normally ( Figure 5 Right). The pollen activity of the gene-edited homozygous line sbms1#8 was significantly lower than that of the wild-type sorghum variety Tx430 ( Figure 6 Left).

[0089] 3. Fruit setting rate

[0090] The ears of the wild-type sorghum variety Tx430 and the gene-edited homozygous line sbms1#8 at maturity were taken, and the number of florets and the number of fruits on the five primary branches of each ear were randomly counted. The fruit setting rate was calculated according to the formula "fruit setting rate = (number of fruits / number of florets) * 100%". The fruit setting rates of at least 5 plants were counted for the wild-type sorghum variety Tx430 and the gene-edited homozygous line sbms1#8, respectively.

[0091] The results are as follows Figure 6 The results showed that the wild-type sorghum variety Tx430 could bear fruit normally, while the fruit-bearing rate of the gene-edited homozygous line sbms1#8 was significantly reduced ( Figure 6 Right). This indicates that the gene-edited homozygous line sbms1#8 exhibits a partial male sterility phenotype, that is, SbMS1 mutation can lead to high male sterility in sorghum, and SbMS1 has the function of regulating plant male fertility.

[0092] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. Sequence Listing <110> Institute of Crop Sciences, Chinese Academy of Agricultural Sciences <120> Sorghum SbMS1 protein and its encoding gene and its application <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 3789 <212> DNA <213> Artificial Sequence <400> 1 atgccgagcg gcgggaggcg gctgccgccg tggacgtcgc cgaggagcgc gggggcgggg 60 gcggcgaggt ggagccctgc tgctggtacg cccgcggccg cgggtggaca gcgctcgggc 120 tcgggctacg ggacgccgcc tctgagcgcg ggttgcttcg gcacgcgcgt cacgccgccg 180 acgagtgggg gcgcgcgcgt cacgccgccc tcgaccgggg gatgctcgtc gcggccgccc 240 aggccgccgc cttccctgga ttcgccctac gtgcgggcca agcaggcgca ggtaattcat 300 catcggcagt accatttcgg tcatgtttag gctcagaatt actcgagcat taccgggtca 360 gcaattagtc gtagcctgcc cttcagctca cgcatgagac tggcgactgt taccattaaa 420 tggtttaggc atttctcata cacaatgtta tgttcgatcg atacttgccg gattcaggcc 480 tttaacactt caattatgtc aagccttctc ccttgtctgt agcaaagatt ttcatttttc 540 gcatgtatgt gtacttaatt tcagaagaat gaattaaagt ttctaacatg cattgcatgt 600 actcccagtt taaacgcagg gggaaatgtg gcttccttga cttaagtggc aaagtttttt 660 ttccctctga agaaacctct tcgaagagg cacggcagtc ctgcaattca cttaagaaga 720 aaaggattga cctggtttat aagggaaact aggcccaaaa accttacaac cgcactgtta 780 ttaggaggat tacgtgccac agtctactag gtttactcaa ttgttgagac tggcaatgca 840 atggtcctct gcagactgtg aaagtctttt aacatctagt tattagttaa agtatcaata 900 tatatgtgat gttgacctga ttaactgctt aatgaaacac gtgccattgc atgttctcga 960 aaaaaaaatg ttgacctgat taaattactc aaacatttct aatcctcagt taataggtac 1020 cctgcaagct gcattatgat ggcatttggt cctctgtgta tgcactatac tgcaggctcg 1080 ttctcatatg tgtttgcaga ctcgagggta acatattggg gggcaatgat gtattatcct 1140 ttaaggaaat caccattat gttttagaat accatattac catgtagctg taacaaaatg 1200 ccaggaaatt tctctgcact aacaaaattg tagattgggt aagcattccc aggaagtgag 1260 gaattgaaac taaaatactg gtccttctga ttgtgcatct tattaccaga aacctgctgt 1320 accgagagat tggattgaca ctatttatgt gtactggcat caactttttt ttttggaatt 1380 gtggatgttc attaaaaaa ttgcgtttga catcctgaac atatgaagta cataagcta 1440 aatatgcaga tttttatgtg tccttatgtt gtttctgtta ttccagatag ttgaaaagga 1500 ccccaacaag gccgttccat tgttttgggc agctataaac agtggtgacc ggactgagag 1560 cgcattgaag gatatggcca atgtactgaa acaagcaaat cgggctgaag aagccattga 1620 ggcaataaga tcctttcgtg atcggtgtcc ctatgaagct caggagtccc ttgacaatat 1680 tcttctagat ctatacaagg tatattgttt gtcctttcaa agaaagaggt tcatttttat 1740 aagctaacag ttcctctgta gctccattgg tttggttatg cagatacatt ttttttctc 1800 gaaaacttgg ttaggcagat gcatattgaa cacatttaat taattatcac attgtccaat 1860 gcgaatgagt catcttaaaa taattagtta tcacatgaat tttggatgaa aatgtcacta 1920 acacatttct tctgaaacta ataatttca tgttaaacca gaaatgtggt aggacagatg 1980 agcagatcga aatgctgaca ataaagctgc gaattgttga tgaggagcta gcttctggtc 2040 ggtggaaaac aaaaatgtct aaatctcatg gaagggtagt ctacctgtct ctcagagatg 2100 aaaaagcaag gtactggaaa tctttatatt cccatttgag atttgacttt taaacactat 2160 tcaaactaag ttccttgttt cttgccaagg ctattgggga accttgcttg ggcctatatg 2220 cagtccgaaa attatgaggg agcagagatg ctctacaggt acatcttgag ttcattcttc 2280 tcccatttct aaatgtcacg agttttctca aatggcatat tgcagatgaa cctataatcc 2340 cgccacaata ctaagtgtgt gaatgacata cttgcatgtg gtgtgctgtg tgcacctacc 2400 ctttatctca aaagggaaac aaactaattc tggctactat tgacttggca caggcaagct 2460 cttgctatag aagctgacta caacaaagag tgtaacttgg ccatctgttt gatgaagact 2520 ggaaaggtgg ctgaagctaa atacctgatt caagctatac cttacaactg tgatgatgaa 2580 agtcatgtga agtctctttc ccgggctact gaaatgctta gggaacttga attgcaatca 2640 ctcccctctc ccataactca ggcgaagtcc aaagaatcac agatttttct tgctgatgat 2700 gtggagatgc ttgtagatct acagccacaa acactatcaa ctcctttgag tgaactgaaa 2760 tataaaagac cacatatttc agtttcacaa aatgcagaga agcatgagaa ttgcaattca 2820 tggcttccat ctcccataac tcagttgaga cgtgaagaac cacacattat ggttactgct 2880 ggtgcagaaa agaatgaaag ctttgcagag ttccaagatc tttctcgact gttcaatgat 2940 gctgctacac ctcattcaat acttgagaaa ctacgaaaga ggctagttaa agaggcacca 3000 aaaatcggta ttcatgatga tcagattcag actcctattc caactgaatg cttgccaaac 3060 tctgaaagaa acctagatgc tagtgagact cccatgcaag aagggaagct attgaccaaa 3120 ggtgttaaga aaacatgggc tgacatggtg gatgaagagg aacaacaatt gggtgatgat 3180 aaaccattgg ctgacatggt ggcgaaggat gaacagcaat tgggtgaaag caagtcaaca 3240 cttggtgtgg gaactactga acaaaaggag agcagtaagc atgcaagtaa gctggaatac 3300 agaacaccat tggcctctca agaaagcagg acccatcaaa gaccattcat gggtggtcaa 3360 ctgcaaggtt cttcagcagc ttcatggaga cagaatgact ccaaaatctc catggataag 3420 aacgtgaacc gggatcttgt gaggactgct ccgacatgga gcaagcataa ggcacaagac 3480 cacaacaatc gagtttggca aaggcttgac acagttcatc cccatgagag agcctcagac 3540 acgaaccaag taccacggag aagcaacaca tctcagcgcg ctctttttcc tgactggaaa 3600 tcaaagggtg aaggacatgg ccatggttgt gttctgtttg atgataacga acgcactcag 3660 tgttccagtc acgttgaggc cactcatcgc tggcataata atgaggcaag tacagggtca 3720 tggaggccac agaaccgtct gcgggtcttc caggaaatca caaatgagat caaccaaaat 3780 gttgtgtaa 3789 <210> 2 <211> 2058 <212> DNA <213> Artificial Sequence <400> 2 atgccgagcg gcgggaggcg gctgccgccg tggacgtcgc cgaggagcgc gggggcgggg 60 gcggcgaggt ggagccctgc tgctggtacg cccgcggccg cgggtggaca gcgctcgggc 120 tcgggctacg ggacgccgcc tctgagcgcg ggttgcttcg gcacgcgcgt cacgccgccg 180 acgagtgggg gcgcgcgcgt cacgccgccc tcgaccgggg gatgctcgtc gcggccgccc 240 aggccgccgc cttccctgga ttcgccctac gtgcgggcca agcaggcgca gatagttgaa 300 aaggacccca acaaggccgt tccattgttt tgggcagcta taaacagtgg tgaccggact 360 gagagcgcat tgaaggatat ggccaatgta ctgaaacaag caaatcgggc tgaagaagcc 420 attgaggcaa taagatcctt tcgtgatcgg tgtccctatg aagctcagga gtcccttgac 480 aatattcttc tagatctata caagaaatgt ggtaggacag atgagcagat cgaaatgctg 540 acaataaagc tgcgaattgt tgatgaggag ctagcttctg gtcggtggaa aaaaaatg 600 tctaaatctc atggaagggt agtctacctg tctctcagag atgaaaaagc aaggctattg 660 gggaaccttg cttgggccta tatgcagtcc gaaaattatg agggagcaga gatgctctac 720 aggcaagctc ttgctataga agctgactac aaaagagt gtaacttggc catctgtttg 780 atgaagactg gaaaggtggc tgaagctaaa tacctgattc aagctatacc ttacaactgt 840 gatgatgaaa gtcatgtgaa gtctctttcc cgggctactg aaatgcttag ggaacttgaa 900 ttgcaatcac tcccctctc cataactcag gcgaagtcca aagaatcaca gatttttctt 960 gctgatgatg tggagatgct tgtagatcta cagccacaaa cactatcaac tcctttgagt 1020 gaactgaaat ataaagacc acatatttca gtttcacaaa atgcagagaa gcatgagaat 1080 tgcaattcat ggcttccatc tcccataact cagttgagac gtgaagaacc acacattatg 1140 gttactgctg gtgcagaaaa gaatgaaagc tttgcagagt tccaagatct ttctcgactg 1200 ttcaatgatg ctgctacacc tcattcaata cttgagaaac tacgaaagag gctagttaaa 1260 gaggcaccaa aaatcggtat tcatgatgat cagattcaga ctcctattcc aactgaatgc 1320 ttgccaaact ctgaaagaaa cttagatgct agtgagactc ccatgcaaga agggaagcta 1380 ttgaccaaag gtgttaagaa aacatgggct gacatggtgg atgaagagga acaacaattg 1440 ggtgatgata aaccattggc tgacatggtg gcgaaggatg aacagcaatt gggtgaaagc 1500 aagtcaacac ttggtgtggg aactactgaa caaaaggaga gcagtaagca tgcaagtaag 1560 ctggaataca gaacaccatt ggcctctcaa gaaagcagga cccatcaaag accattcatg 1620 ggtggtcaac tgcaaggttc ttcagcagct tcatggagac agaatgactc caaaatctcc 1680 atggataaga acgtgaaccg ggatcttgtg aggactgctc cgacatggag caagcataag 1740 gcacaagacc acaacaatcg agtttggcaa aggcttgaca cagttcatcc ccatgagaga 1800 gcctcagaca cgaaccaagt accacggaga agcaacacat ctcagcgcgc tctttttcct 1860 gactggaaat caaagggtga aggacatggc catggttgtg ttctgtttga tgataacgaa 1920 cgcactcagt gttccagtca cgttgaggcc actcatcgct ggcataataa tgaggcaagt 1980 acagggtcat ggaggccaca gaaccgtctg cgggtcttcc aggaaatcac aaatgagatc 2040 aaccaaaatg ttgtgtaa 2058 <210> 3 <211> 685 <212> PRT <213> Artificial Sequence <400> 3 Met Pro Ser Gly Gly Arg Arg Leu Pro Pro Trp Thr Ser Pro Arg Ser 1 5 10 15 Ala Gly Ala Gly Ala Ala Arg Trp Expensive Pro Ala Ala Gly Thr Pro Ala 20 25 30 Ala Ala Gly Gly Gln Arg Ser Gly Ser Gly Tyr Gly Thr Pro Pro Leu 35 40 45 Ser Ala Gly Cys Phe Gly Thr Arg Val Thr Pro Pro Thr Ser Gly Gly 50 55 60 Ala Arg Val Thr Pro Pro Ser Thr Gly Gly Cys Ser Ser Arg Pro Pro 65 70 75 80 Arg Pro Pro Pro Ser Leu Asp Ser Pro Tyr Val Arg Ala Lys Gln Ala 85 90 95 Gln Ile Val Glu Lys Asp Pro Asn Lys Ala Val Pro Leu Phe Trp Ala 100 105 110 Ala Ile Asn Ser Gly Asp Arg Thr Glu Ser Ala Leu Lys Asp Met Ala 115 120 125 Asn Val Leu Lys Gln Ala Asn Arg Ala Glu Glu Ala Ile Glu Ala Ile 130 135 140 Arg Ser Phe Arg Asp Arg Cys Pro Tyr Glu Ala Gln Glu Ser Leu Asp 145 150 155 160 Asn Ile Leu Leu Asp Leu Tyr Lys Lys Cys Gly Arg Thr Asp Glu Gln 165 170 175 Ile Glu Met Leu Thr Ile Lys Leu Arg Ile Val Asp Glu Glu Leu Ala 180 185 190 Ser Gly Arg Trp Lys Thr Lys Met Ser Lys Ser His Gly Arg Val Val 195 200 205 Tyr Leu Ser Leu Arg Asp Glu Lys Ala Arg Leu Leu Gly Asn Leu Ala 210 215 220 Trp Ala Tyr Met Gln Ser Glu Asn Tyr Glu Gly Ala Glu Met Leu Tyr 225 230 235 240 Arg Gln Ala Leu Ala Ile Glu Ala Asp Tyr Asn Lys Glu Cys Asn Leu 245 250 255 Ala Ile Cys Leu Met Lys Thr Gly Lys Val Ala Glu Ala Lys Tyr Leu 260 265 270 Ile Gln Ala Ile Pro Tyr Asn Cys Asp Asp Glu Ser His Val Lys Ser 275 280 285 Leu Ser Arg Ala Thr Glu Met Leu Arg Glu Leu Glu Leu Gln Ser Leu 290 295 300 Pro Ser Pro Ile Thr Gln Ala Lys Ser Lys Glu Ser Gln Ile Phe Leu 305 310 315 320 Ala Asp Asp Val Glu Met Leu Val Asp Leu Gln Pro Gln Thr Leu Ser 325 330 335 Thr Pro Leu Ser Glu Leu Lys Tyr Lys Arg Pro His Ile Ser Val Ser 340 345 350 Gln Asn Ala Glu Lys His Glu Asn Cys Asn Ser Trp Leu Pro Ser Pro 355 360 365 Ile Thr Gln Leu Arg Arg Glu Glu Pro His Ile Met Val Thr Ala Gly 370 375 380 Ala Glu Lys Asn Glu Ser Phe Ala Glu Phe Gln Asp Leu Ser Arg Leu 385 390 395 400 Phe Asn Asp Ala Ala Thr Pro His Ser Ile Leu Glu Lys Leu Arg Lys 405 410 415 Arg Leu Val Lys Glu Ala Pro Lys Ile Gly Ile His Asp Asp Gln Ile 420 425 430 Gln Thr Pro Ile Pro Thr Glu Cys Leu Pro Asn Ser Glu Arg Asn Leu 435 440 445 Asp Ala Ser Glu Thr Pro Met Gln Glu Gly Lys Leu Leu Thr Lys Gly 450 455 460 Val Lys Lys Thr Trp Ala Asp Met Val Asp Glu Glu Glu Gln Gln Leu 465 470 475 480 Gly Asp Asp Lys Pro Leu Ala Asp Met Val Ala Lys Asp Glu Gln Gln 485 490 495 Leu Gly Glu Ser Lys Ser Thr Leu Gly Val Gly Thr Thr Glu Gln Lys 500 505 510 Glu Ser Ser Lys His Ala Ser Lys Leu Glu Tyr Arg Thr Pro Leu Ala 515 520 525 Ser Gln Glu Ser Arg Thr His Gln Arg Pro Phe Met Gly Gly Gln Leu 530 535 540 Gln Gly Ser Ser Ala Ala Ser Trp Arg Gln Asn Asp Ser Lys Ile Ser 545 550 555 560 Met Asp Lys Asn Val Asn Arg Asp Leu Val Arg Thr Ala Pro Thr Trp 565 570 575 Ser Lys His Lys Ala Gln Asp His Asn Asn Arg Val Trp Gln Arg Leu 580 585 590 Asp Thr Val His Pro His Glu Arg Ala Ser Asp Thr Asn Gln Val Pro 595 600 605 Arg Arg Ser Asn Thr Ser Gln Arg Ala Leu Phe Pro Asp Trp Lys Ser 610 615 620 Lys Gly Glu Gly His Gly His Gly Cys Val Leu Phe Asp Asp Asn Glu 625 630 635 640 Arg Thr Gln Cys Ser Ser His Val Glu Ala Thr His Arg Trp His Asn 645 650 655 Asn Glu Ala Ser Thr Gly Ser Trp Arg Pro Gln Asn Arg Leu Arg Val 660 665 670 Phe Gln Glu Ile Thr Asn Glu Ile Asn Gln Asn Val Val 675 680 685 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 ccgcacgtag ggcgaatcca 20 <210> 5 <211> 16179 <212> DNA <213> Artificial Sequence <400> 5 gtcatgcatg atatatctcc caatttgtgt agggcttatt atgcacgctt aaaaataata 60 aaagcagact tgacctgata gtttggctgt gagcaattat gtgcttagtg catctaatcg 120 cttgagttaa cgccggcgaa gcggcgtcgg cttgaacgaa tttctagcta gacattattt 180 gccgactacc ttggtgatct cgcctttcac gtagtggaca aattcttcca actgatctgc 240 gcgcgaggcc aagcgatctt cttcttgtcc aagataagcc tgtctagctt caagtatgac 300 gggctgatac tgggccggca ggcgctccat tgcccagtcg gcagcgacat ccttcggcgc 360 gattttgccg gttactgcgc tgtaccaaat gcgggacaac gtaagcacta catttcgctc 420 atcgccagcc cagtcgggcg gcgagttcca tagcgttaag gtttcattta gcgcctcaaa 480 tagatcctgt tcaggaaccg gatcaaagag ttcctccgcc gctgggaccta ccaaggcaac 540 gctatgttct cttgcttttg tcagcaagat agccagatca atgtcgatcg tggctggctc 600 gaagatacct gcaagaatgt cattgcgctg ccattctcca aattgcagtt cgcgcttagc 660 tggataacgc cacggaatga tgtcgtcgtg cacaacaatg gtgacttcta cagcgcggag 720 aatctcgctc tctccagggg aagccgaagt ttccaaaagg tcgttgatca aagctcgccg 780 cgttgtttca tcaagcctta cggtcaccgt aaccagcaaa tcaatatcac tgtgtggctt 840 caggccgcca tccactgcgg agccgtacaa atgtacggcc agcaacgtcg gttcgagatg 900 gcgctcgatg acgccaacta cctctgatag ttgagtcgat acttcggcga tcaccgcttc 960 ccccatgatg tttaactttg ttttagggcg actgccctgc tgcgtaacat cgttgctgct 1020 ccataacatc aaacatcgac ccacggcgta acgcgcttgc tgcttggatg cccgaggcat 1080 agactgtacc ccaaaaaaac atgtcataac aagaagccat gaaaaccgcc actgcgccgt 1140 taccaccgct gcgttcggtc aaggttctgg accagttgcg tgacggcagt tacgctactt 1200 gcattacagc ttacgaaccg aacgaggctt atgtccactg ggttcgtgcc cgaattgatc 1260 acaggcagca acgctctgtc atcgttacaa tcaacatgct accctccgcg agatcatccg 1320 tgtttcaaac ccggcagctt agttgccgtt cttccgaata gcatcggtaa catgagcaaa 1380 gtctgccgcc ttacaacggc tctcccgctg acgccgtccc ggactgatgg gctgcctgta 1440 tcgagtggtg attttgtgcc gagctgccgg tcggggagct gttggctggc tggtggcagg 1500 atatattgtg gtgtaaaaa attgacgctt agaacatta ataacacatt gcggacgttt 1560 ttaatgtact gaattaacgc cgaattgaat tatcagcttg catgccggtc gatctagtaa 1620 catagatgac accgcgcgcg ataatttatc ctagtttgcg cgctatattt tgttttctat 1680 cgcgtattaa atgtataatt gcgggactct aatcataaaa acccatctca taaataacgt 1740 catgcattac atgttaatta ttacatgctt aacgtaattc aacagaaatt atatgataat 1800 catcgcaaga ccggcaacag gattcaatct taagaaactt tattgccaaa tgtttgaacg 1860 atctgcttga ctctagggaa ttaattcctg aatcactgcg accggccctc ccgcgaccca 1920 gccgagcgag cttagcgaac tgtggacgag aactgtgcca ccaagcgtaa ggccgttctc 1980 tcgcattccg ctcagaagaa ctcgtcaaga aggcgataga aggcgatgcg ctgcgaatcg 2040 ggagcggcga taccgtaaag cacgaggaag cggtcagccc attcgccgcc aagctcttca 2100 gcaatatcac gggtagccaa cgctatgtcc tgatagcggt ccgccacacc cagccggcca 2160 cagtcgatga atccagaaaa gcggccattt tccaccatga tattcggcaa gcaggcatcg 2220 ccatgtgtca cgacgagatc ctcgccgtcg ggcatgcgcg ccttgagcct ggcgaacagt 2280 tcggctggcg cgagcccctg atgctcttcg tccagatcat cctgatcgac aagaccggct 2340 tccatccgag tacgtgctcg ctcgatgcga tgtttcgctt ggtggtcgaa tgggcaggta 2400 gccggatcaa gcgtatgcag ccgccgcatt gcatcagcca tgatggatac tttctcggca 2460 ggagcaaggt gagatgacag gagatcctgc cccggcactt cgcccaatag cagccagtcc 2520 cttcccgctt cagtgacaac gtcgagcaca gctgcgcaag gaacgcccgt cgtggccagc 2580 cacgatagcc gcgctgcctc gtcctggagt tcattcaggg caccggacag gtcggtcttg 2640 acaaaaagaa ccgggcgccc ctgcgctgac agccgaaaca cggcggcatc agagcagccg 2700 attgtctgtt gtgcccagtc atagccgaat agcctctcca cccaagcggc cggagaacct 2760 gcgtgcaatc catcttgttc aatccccatg gtcgatcgac agatctgcga aagctcgaga 2820 gagatagatt tgtagagaga gactggtgag gggattcgag ttgagagtga atatgagact 2880 ctaattggat accgagggga atttatggaa cgtcagtgga gcatttttga caagaaatat 2940 ttgctagctg atagtgacct taggcgactt ttgaacgcgc aataatggtt tctgacgtat 3000 gtgcttagct cattaaactc cagaaacccg cggctcagtg gctccttcaa cgttgcggtt 3060 ctgtcagttc caaaggtacc cggggatcct ctagagggcc cgacgtcgca tgcctgcagg 3120 tcactggatt ttggttttag gaattagaaa ttttattgat agaagtattt tacaaataca 3180 aatacatact aagggtttct tatatgctca acacatgagc gaaaccctat aagaacccta 3240 attcccttat ctgggaacta ctcacacatt attctggaga aaaatagaga gagatagatt 3300 tgtagagaga gactggtgat ttttgcggac tctagcatgg ccgcggctag tcagttagat 3360 cgacgtcgca tgctcccggc cgccatggcc gcgggatatc accactttgt acaagaaagc 3420 tgggtcggcg cgcccaccct ttcaatcgcc gccgagttgt gagaggtcga tgcgtgtctc 3480 gtagaggcct gtgatagact ggtggatgag ggtggcgtcg agaacctcct tggtagaggt 3540 gtagcgcttg cggtcgatgg tggtgtcgaa gtacttgaag gcggctggag cgccgaggtt 3600 ggtgagggtg aagaggtgga tgatgttctc ggcctgctcg cgaattggct tatcgcggtg 3660 cttgttgtag gcgctgagca ccttatcgag gttggcatcg gcgaggatca cgcgcttgga 3720 gaactcggag atctgctcga tgatctcgtc gaggtagtgc ttgtgctgct cgacgaacag 3780 ctgcttttgc tcgttgtcct ctggggagcc cttgagcttc tcgtagtggg aggcgaggta 3840 gaggaagttc acgtacttgg acgggagagc aagctcgttg cccttctgaa gctcgccagc 3900 agaggcgagc attctcttgc ggccgttctc aagctcgaag aggctgtact tcgggagctt 3960 gatgatgagg tccttcttca cctccttgta gcccttggcc tcgaggaagt cgattgggtt 4020 cttctcgaag ctgctgcgct ccatgatcgt gatgcccagc agctccttga cggacttgag 4080 cttcttgctc ttgcccttct cgaccttggc aaccacgagc acagagtagg ccacggtcgg 4140 agaatcgaag ccgccatact tcttcgggtc ccagtccttc ttgcgggcga tcagcttgtc 4200 ggagttgcgc tttgggagga tggactcctt ggagaagccg ccggtctgaa cctcggtctt 4260 cttcacgatg ttcacttgcg gcatggagag caccttgcgc actgtggcga aatccctgcc 4320 cttgtcccac acgatctcgc ctgtctcgcc gtttgtctcg atgagcggcc tcttcctaat 4380 ctcgccgttg gcgagcgtga tctcggtctt gaagaaattc atgatgttgg agtagaagaa 4440 gtacttggcg gtcgccttgc cgatctcttg ctcggacttg gcgatcatct tgcgcacgtc 4500 gtacaccttg tagtcgccgt acacgaactc ggactcgagc tttgggtact tcttgatgag 4560 ggctgtgccc accacggcat tgaggtaggc gtcgtgggcg tggtggtagt tgttgatctc 4620 gcgcaccttg tagaactgga agtccttgcg gaagtcggac acgagcttgg acttgagggt 4680 gatgaccttc acctcgcgga tgagcttgtc gttctcgtcg tacttggtgt tcatgcggga 4740 gtcgaggatc tgggccacgt gctttgtgat ctggcgtgtc tcgacgagct ggcgcttgat 4800 gaagccggcc ttatcaagct cggaaaggcc gcctctctcg gccttggtga ggttgtcgaa 4860 cttcctctgg gtgatgagct tggcgttgag gagctggcgc cagtagttct tcatcttctt 4920 gacgacctct tcggacggca cgttatcgga cttgcccctg ttcttgtcgg agcgggtgag 4980 caccttgttg tcgatggagt cgtccttcag gaaggactgc ggcacaatat ggtccacgtc 5040 gtagtcggag aggcggttga tgtccagctc ttggtccacg tacatgtcgc ggccgttctg 5100 gaggtagtag aggtagagct tctcgttctg gagctgggtg ttctcgactg ggtgctcctt 5160 gaggatctgg gagcccagct ccttaatgcc ctcctcgatc ctcttcatgc gctcgcggga 5220 gttcttttgg cccttctgtg tggtctggtt ctcgcgggcc atctcgatca cgatgttctc 5280 tggcttgtgc ctgcccatca ccttcaccag ctcgtccacc accttcacgg tctggagaat 5340 gcccttcttg atagccgggg agccggcgag attggcgata tgctcatgga gggaatcgcc 5400 ttggccggac acctgggcct tttggatgtc ctccttgaag gtgagggagt cgtcgtggat 5460 gagctgcatg aagttgcggt tggcgaagcc gtcggacttg aggaagtcga ggatcgtctt 5520 gccggactgc ttgtcgcgga tgccgttgat gagcttccta gagagcctgc cccagccggt 5580 atagcgcctg cgcttcagct gcttcatcac cttgtcgtcg aagaggtggg cgtatgtctt 5640 gaggcgctcc tcgatcatct cgcggtcctc gaagagggtg agggtgagca cgatgtcctc 5700 gaggatgtcc tcgttctcct cgttgtcgag gaagtccttg tccttgataa tcttgaggag 5760 gtcgtggtag gtcccgaggg aggcattgaa cctatcctcg acgccggaga tctcgacgga 5820 gtcgaagcac tcgattttct tgaagtagtc ctccttgagc tgcttcacgg tcaccttgcg 5880 gttggtcttg aacagcaggt cgacgatggc cttcttttgc tcgccgctaa ggaaagctgg 5940 cttcctcatc ccctcggtca cgtacttcac cttggtcagc tcgttgtaca cggtgaagta 6000 ctcgtagagg agtgagtgct tcgggagcac cttctcgttc gggaggttct tgtcgaagtt 6060 ggtcatgcgc tcgatgaaag actgggcaga ggcgccctta tccaccacct cctcgaagtt 6120 ccagggggtg attgtctcct cggactttct ggtcatccag gcgaacctgg agttgcccct 6180 ggcgagcggg cccacgtagt acgggatgcg gaaggtgagg atcttctcaa tcttctcgcg 6240 gttgtccttg aggaacgggt agaagtcctc ttgcctgcgg aggatagcat gaagctcgcc 6300 gaggtggatc tggtgcggga tggagccatt atcgaaggtg cgctgcttgc ggaggggtc 6360 ctctctattg agcttcacga gcagctctc ggtgccgtcc atcttctcga ggatcggctt 6420 gatgaacttg tagaactcct cttgagaagc gccgccatcg atgtagccgg cgtagccgtt 6480 cttggactgg tcgaagaaga tctccttgta cttctctggg agctgctgtc tcacgagggc 6540 cttgaggagt gtgaggtcct ggtggtgctc gtcgtacctc ttgatcatgg aggcggagag 6600 tggggccttg gtgatctcgg tgttcaccct gaggatgtcg ctgaggagga tggcgtcgga 6660 gagattcttg gcggcgagga acagatcggc gtactgatcg ccaatctggg cgaggagatt 6720 gtcgaggtcg tcgtcgtagg tgtccttgga aagctggagc ttggcgtcct cggcgaggtc 6780 gaagttggac ttgaagttcg gggtgaggcc aagagagagg gcgatcaggt tgccgaagag 6840 gccattcttc ttctcgcccg gaagttgggc gatcagattc tcgagcctgc gggacttaga 6900 gagcctggca gagagaatag ccttggcgtc aacgccagag gcgttgatcg ggttctcctc 6960 gaacagctgg ttgtaggtct gcacgagctg gatgaacagc ttgtccacat cggagttgtc 7020 cgggttgagg tcgccctcga tgaggaagtg gcccctgaac ttgatcatgt gggcgagggc 7080 gaggtagatg agcctgaggt cggccttatc ggtggagtcg acgagcttct tgcggaggtg 7140 gtagatggtc gggtacttct cgtggtaggc cacctcatcc acgatgttgc cgaagatcgg 7200 atggcgctcg tgcttcttgt cctcctcgac gaggaagctc tcctcgagcc tgtggaagaa 7260 gctgtcgtcc accttggcca tctcgttgga gaagatctct tggaggtagc agatgcggtt 7320 cttgcgcctg gtgtacctgc gtctagcggt cctcttgagc cttgtagcct cggctgtctc 7380 gccagagtcg aacagcaggg cgccgatgag attcttcttg atggagtggc ggtcggtgtt 7440 gccgaggacc ttgaacttct tggacggcac cttgtactcg tcggtgatca cggcccagcc 7500 aacagaattg gtgccgatgt cgaggccgat ggagtacttc ttgtcgacct tgcgcttctt 7560 ctttggggcc atggtgaagg gggcggccgc ggagcctgct tttttgtaca aacttgcccc 7620 gggatcctct agagtcgacc tgcagaagta acaccaaaca acagggtgag catcgacaaa 7680 agaaacagta ccaagcaaat aaatagcgta tgaaggcagg gctaaaaaaa tccacatata 7740 gctgctgcat atgccatcat ccaagtatat caagatcaaa ataattataa aacatacttg 7800 tttattataa tagataggta ctcaaggtta gagcatatga atagatgctg catatgccat 7860 catgtatatg catcagtaaa acccacatca acatgtatac ctatcctaga tcgatatttc 7920 catccatctt aaactcgtaa ctatgaagat gtatgacaca cacatacagt tccaaaatta 7980 ataaatacac caggtagttt gaaacagtat tctactccga tctagaacga atgaacgacc 8040 gcccaaccac accacatcat cacaaccaag cgaacaaaaa gcatctctgt atatgcatca 8100 gtaaaacccg catcaacatg tatacctatc ctagatcgat atttccatcc atcatcttca 8160 atcgtaact atgaatatgt atggcacaca catacagatc caaaattaat aaatccacca 8220 ggtagttga aacagaattc tactccgatc tagaacgacc gcccaaccag accacatcat 8280 cacaaccaag acaaaaaaaa gcatgaaaag atgacccgac aaacaagtgc acggcatata 8340 ttgaaataaa ggaaaagggc aaaccaaacc ctatgcaacg aaacaaaaa aatcatgaaa 8400 tcgatcccgt ctgcggaacg gctagagcca tcccaggatt ccccaaagag aaacactggc 8460 aagttagcaa tcagaacgtg tctgacgtac aggtcgcatc cgtgtacgaa cgctagcagc 8520 acggatctaa cacaaacacg gatctaacac aaacatgaac agaagtagaa ctaccgggcc 8580 ctaaccatgg accggaacgc cgatctagag aaggtagaga gggggggggg gggaggacga 8640 gcggcgtacc ttgaagcgga ggtgccgacg ggtggatttg ggggagatct ggttgtgtgt 8700 gtgtgcgctc cgaacaacac gaggttgggg aaagagggtg tggagggggt gtctatttat 8760 tacggcgggc gaggaaggga aagcgaagga gcggtgggaa aggaatcccc cgtagctgcc 8820 ggtgccgtga gaggaggagg aggccgcctg ccgtgccggc tcacgtctgc cgctccgcca 8880 cgcaatttct ggatgccgac agcggagcaa gtccaacggt ggagcggaac tctcgagagg 8940 ggtccagagg cagcgacaga gatgccgtgc cgtctgcttc gcttggcccg acgcgacgct 9000 gctggttcgc tggttggtgt ccgttagact cgtcgacggc gtttaacagg ctggcattat 9060 ctactcgaaa caagaaaaat gtttccttag tttttttaat ttcttaaagg gtatttgttt 9120 aatttttagt cactttattt tattctattt tatatctaaa ttattaaata aaaaaactaa 9180 atagagttt tagttttctt aatttagagg ctaaataga ataaataga tgtactaaaa 9240 aaattagtct ataaaaacca ttaaccctaa accctaaatg gatgtactaa taaaatggat 9300 gaagtattat ataggtgaag ctatttgcaa aaaaaaagga gaacacatgc acactaaaaa 9360 gataaaactg tagagtcctg ttgtcaaaat actcaattgt cctttagacc atgtctaact 9420 gttcattat atgattctct aaaacactga tattattgta gtactataga ttatattatt 9480 cgtagagtaa agtttaaata tatgtataaa gatagataaa ctgcacttca aacaagtgtg 9540 acaaaaaaaa tatgtggtaa ttttttataa cttagacatg caatgctcat tatctctaga 9600 gaggggcacg accgggtcac gctgcactgc aggcatgcaa gcttgatctc tagaaccact 9660 ttgtacaaga aagctgggtc ggcgcgccca cccttggata atgtgcaagg gatctttaaa 9720 catacgaaca gatcacttaa agttcttctg aagcaactta aagttatcag gcatgcatgg 9780 atcttggagg aatcagatgt gcagtcaggg accatagcac aagacaggcg tcttctactg 9840 gtgctaccag caaatgctgg aagccgggaa cactgggtac gttggaaacc acgtgatgtg 9900 aagaagtaag ataaactgta ggagaaagc atttcgtagt gggccatgaa gcctttcagg acatgtattg cagtatgggc cggcccatta cgcaattgga cgacaacaaa gactagtatt agtaccacct cggctatcca catagatcaa agctgattta aaagagttgt gcagatgatc cgtggcagct cgcaggtggc ggccgcatta ggcaccccag gctttacact ttatgcttcc ggctcgtata atgtgtggat tttgagttag gatccggcga gattttcagg agctaagga gctaaaatgg agaaaaaaat cactggatat accaccgttg atatatccca atggcatcgt aaagaacatt ttgaggcatt tcagtcagtt gctcaatgta cctataacca gaccgttcag ctggatatta cggcctttttt aaagaccgta aagaaaata agcacaagtt ttatccggcc tttattcaca ttcttgcccg cctgatgaat gctcatccgg aattccgtat ggcaatgaaa gacggtgagc tggtgatatg ggatagtgtt cacccttgtt acaccgtttt ccatgagcaa actgaaacgt tttcatcgct ctggagtgaa taccacgacg atttccggca gtttctacac atatattcgc aagatgtggc gtgttacggt gaaaacctgg cctatttccc taaagggttt attgagaata tgtttttcgt ctcagccaat ccctgggtga gtttcaccag ttttgattta 10680 aacgtggcca atatggacaa cttcttcgcc cccgttttca ccatgggcaa atattatacg 10740 caaggcgaca aggtgctgat gccgctggcg attcaggttc atcatgccgt ctgtgatggc 10800 ttccatgtcg gcagaatgct taatgaatta caacagtact gcgatgagtg gcagggcggg 10860 gcgtaaacgc gtggatccgg cttactaaaa gccagataac agtatgcgta tcacctgcac 10920 acgttttaga gctatgctga aaagcatagc aagttaaaat aaggctagtc cgttatcaac 10980 ttgaaaaagt ggcaccgagt cggtgcttt ttttagtagt agcatctgac ggtgaagggg 11040 gcggccgcgg agcctgcttt tttgtacaaa gttgtaagct tagcttgagc ttggatcaga 11100 ttgtcgtttc ccgccttcag tttaaactat cagtgtttga caggatatat tggcgggtaa 11160 acctaagaga aaagagcgtt tattagaata acggatattt aaaagggcgt gaaaaggttt 11220 atccgttcgt ccatttgtat gtgcatgcca accacagggt tcccctcggg atcaaagtac 11280 tttgatccaa cccctccgct gctatagtgc agtcggcttc tgacgttcag tgcagccgtc 11340 ttctgaaaac gacatgtcgc acaagtccta agttacgcga caggctgccg ccctgccctt 11400 ttcctggcgt tttcttgtcg cgtgttttag tcgcataaag tagaatactt gcgactagaa 11460 ccggagacat tacgccatga acaagagcgc cgccgctggc ctgctgggct atgcccgcgt 11520 cagcaccgac gaccaggact tgaccaacca acgggccgaa ctgcacgcgg ccggctgcac 11580 caagctgttt tccgagaaga tcaccggcac caggcgcgac cgcccggagc tggccaggat 11640 gcttgaccac ctacgccctg gcgacgttgt gacagtgacc aggctagacc gcctggcccg 11700 cagcacccgc gacctactgg acattgccga gcgcatccag gaggccggcg cgggcctgcg 11760 tagcctggca gagccgtggg ccgacaccac cacgccggcc ggccgcatgg tgttgaccgt 11820 gttcgccggc attgccgagt tcgagcgttc cctaatcatc gaccgcaccc ggagcgggcg 11880 cgaggccgcc aaggcccgag gcgtgaagtt tggcccccgc cctaccctca ccccggcaca 11940 gatcgcgcac gcccgcgagc tgatcgacca ggaaggccgc accgtgaaag aggcggctgc 12000 actgcttggc gtgcatcgct cgaccctgta ccgcgcactt gagcgcagcg aggaagtgac 12060 gcccaccgag gccaggcggc gcggtgcctt ccgtgaggac gcattgaccg aggccgacgc 12120 cctggcggcc gccgagaatg aacgccaaga ggaacaagca tgaaaccgca ccaggacggc 12180 caggacgaac cgtttttcat taccgaagag atcgaggcgg agatgatcgc ggccgggtac 12240 gtgttcgagc cgcccgcgca cgtctcaacc gtgcggctgc atgaaatcct ggccggtttg 12300 tctgatgcca agctggcggc ctggccggcc agcttggccg ctgaagaaac cgagcgccgc 12360 cgtctaaaaa ggtgatgtgt atttgagtaa aacagcttgc gtcatgcggt cgctgcgtat 12420 atgatgcgat gagtaaataa acaaatacgc aaggggaacg catgaaggtt atcgctgtac 12480 ttaaccagaa aggcgggtca ggcaagacga ccatcgcaac ccatctagcc cgcgccctgc 12540 aactcgccgg ggccgatgtt ctgttagtcg attccgatcc ccagggcagt gcccgcgatt 12600 gggcggccgt gcgggaagat caaccgctaa ccgttgtcgg catcgaccgc ccgacgattg 12660 accgcgacgt gaaggccatc ggccggcgcg acttcgtagt gatcgacgga gcgccccagg 12720 cggcggactt ggctgtgtcc gcgatcaagg cagccgactt cgtgctgatt ccggtgcagc 12780 caagccctta cgacatatgg gccaccgccg acctggtgga gctggttaag cagcgcattg 12840 aggtcacgga tggaaggcta caagcggcct ttgtcgtgtc gcgggcgatc aaaggcacgc 12900 gcatcggcgg tgaggttgcc gaggcgctgg ccgggtacga gctgcccatt cttgagtccc 12960 gtatcacgca gcgcgtgagc tacccaggca ctgccgccgc cggcacaacc gttcttgaat 13020 cagaacccga gggcgacgct gcccgcgagg tccaggcgct ggccgctgaa attaaatcaa 13080 aactcatttg agttaatgag gtaaaagaa aatgagcaaa agcacaaaca cgctaagtgc 13140 cggccgtccg agcgcacgca gcagcaaggc tgcaacgttg gccagcctgg cagacacgcc 13200 agccatgaag cgggtcaact ttcagttgcc ggcggaggat cacaccaagc tgaagatgta 13260 cgcggtacgc caaggcaaga ccattaccga gctgctatct gaatacatcg cgcagctacc 13320 agagtaaatg agcaaatgaa taaatgagta gatgaatttt agcggctaa ggaggcggca 13380 tggaaaatca agaacaacca ggcaccgacg ccgtggaatg ccccatgtgt ggaggaacgg 13440 gcggttggcc aggcgtaagc ggctgggttg tctgccggcc ctgcaatggc actggaaccc 13500 ccaagcccga ggaatcggcg tgacggtcgc aaaccatccg gcccggtaca aatcggcgcg 13560 gcgctgggtg atgacctggt ggagaagttg aaggccgcgc aggccgccca gcggcaacgc 13620 atcgaggcag aagcacgccc cggtgaatcg tggcaagcgg ccgctgatcg aatccgcaaa 13680 gaatcccggc aaccgccggc agccggtgcg ccgtcgatta ggaagccgcc caagggcgac 13740 gagcaaccag attttttcgt tccgatgctc tatgacgtgg gcacccgcga tagtcgcagc 13800 atcatggacg tggccgtttt ccgtctgtcg aagcgtgacc gacgagctgg cgaggtgatc 13860 cgctacgagc ttccagacgg gcacgtagag gtttccgcag ggccggccgg catggccagt 13920 gtgtgggatt acgacctggt actgatggcg gtttcccatc taaccgaatc catgaaccga 13980 taccgggaag ggaagggaga caagcccggc cgcgtgttcc gtccacacgt tgcggacgta 14040 ctcaagttct gccggcgagc cgatggcgga aagcagaaag acgacctggt agaaacctgc 14100 attcggttaa acaccacgca cgttgccatg cagcgtacga agaaggccaa gaacggccgc 14160 ctggtgacgg tatccgaggg tgaagccttg attagccgct acaagatcgt aaagagcgaa 14220 accgggcggc cggagtacat cgagatcgag ctagctgatt ggatgtaccg cgagatcaca 14280 gaaggcaaga acccggacgt gctgacggtt caccccgatt actttttgat cgatcccggc 14340 atcggccgtt ttctctaccg cctggcacgc cgcgccgcag gcaaggcaga agccagatgg 14400 ttgttcaaga cgatctacga acgcagtggc agcgccggag agttcaagaa gttctgtttc 14460 accgtgcgca agctgatcgg gtcaaatgac ctgccggagt acgatttgaa ggaggaggcg 14520 gggcaggctg gcccgatcct agtcatgcgc taccgcaacc tgatcgaggg cgaagcatcc 14580 gccggttcct aatgtacgga gcagatgcta gggcaaattg ccctagcagg ggaaaaaggt 14640 cgaaaaggtc tctttcctgt ggatagcacg tacattggga acccaaagcc gtacattggg 14700 aaccggaacc cgtacattgg gaacccaaag ccgtacattg ggaaccggtc acacatgtaa 14760 gtgactgata taaaagagaa aaaaggcgat ttttccgcct aaaactcttt aaaacttatt 14820 aaaactctta aaacccgcct ggcctgtgca taactgtctg gccagcgcac agccgaagag 14880 ctgcaaaaag cgcctaccct tcggtcgctg cgctccctac gccccgccgc ttcgcgtcgg 14940 cctatcgcgg ccgctggccg ctcaaaaatg gctggcctac ggccaggcaa tctaccaggg 15000 cgcggacaag ccgcgccgtc gccactcgac cgccggcgcc cacatcaagg caccctgcct 15060 cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg agacggtcac 15120 agcttgtctg taagcggatg ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt 15180 tggcgggtgt cggggcgcag ccatgaccca gtcacgtagc gatagcggag tgtatactgg 15240 cttaactatg cggcatcaga gcagattgta ctgagagtgc accatatgcg gtgtgaaata 15300 ccgcacagat gcgtaaggag aaaataccgc atcaggcgct cttccgcttc ctcgctcact 15360 gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta 15420 atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag 15480 caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc 15540 cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta 15600 taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg 15660 ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc 15720 tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac 15780 gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac 15840 ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg 15900 aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga 15960 aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt 16020 agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag 16080 cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct 16140 gacgctcagt ggaacgaaaa ctcacgttaa gggattttg 16179

Claims

1. Application of the material for knocking out the nucleic acid encoding the SbMS1 protein in plants in cultivating male sterile transgenic plants; The SbMS1 protein is a1) or a2): a1) The amino acid sequence is the protein shown in SEQ ID NO:3; a2) A fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in Sequence 3; The plant is sorghum; The substance for knocking out the nucleic acid encoding the SbMS1 protein in the plant is the CRISPR / Cas9 system.

2. A method for cultivating a male-sterile transgenic plant, comprising the following steps: knocking out the nucleic acid encoding the SbMS1 protein of claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant is male-sterile; the plant is sorghum; The knockout of the SbMS1 protein encoding nucleic acid in claim 1 in the recipient plant is achieved through the CRISPR / Cas9 system.

3. The method according to claim 2, Features: The sequence of the SbMS1 protein encoding nucleic acid is the DNA molecule shown in Sequence 1 or Sequence 2.

4. The method according to claim 2 or 3, Features: The target sequence of sgRNA in the CRISPR / Cas9 system is the DNA molecule shown in Sequence 4.

Images