A ketoreductase mutant and its application

Abstract

The invention discloses a ketoreductase mutant, which can convert 3,4-dihydroxy-2'-chloroacetophenone into (R)-3,4-dihydroxy-2'-chlorophenethanol, and then prepare norepinephrine and epinephrine. The ketoreductase mutant has a conversion substrate concentration of up to 120g / L, a conversion rate of more than 95.5%, and an ee value of more than 99%, so that the preparation cost of epinephrine and norepinephrine is greatly reduced, and green production is achieved at the same time.

Description

Technical field:

[0001] The invention belongs to the technical field of biocatalysis, and in particular relates to a ketoreductase mutant, which can be used for preparing an intermediate of norepinephrine and epinephrine, (R)-3,4-dihydroxy-2'-chlorophenylethanol. Background technology:

[0002] Norepinephrine (INN name: Norepinephrine, also known as Noradrenaline, abbreviated NE or NA), formerly known as "norrepinephrine", chemical name (R)-4-(2-amino-1-hydroxyethyl)-1,2-benzenediol, is a substance formed by removing the N-methyl group from adrenaline, and also belongs to catecholamines in chemical structure. Norepinephrine is an anti-shock vasoactive drug, mainly used to rescue shock caused by acute hypotension and peripheral vasodilation.

[0003] Patent CN111019981A discloses the use of dehydrogenase to catalyze noradrenaline ketone to obtain noradrenaline (Scheme 1). However, the corresponding gene information and the chiral value of the converted product are not disclosed, and the conversion substrate concentration is only 25 g / L.

[0004]

[0005] Epinephrine can be used for cardiac arrest, bronchial asthma, anaphylactic shock, and can also treat urticaria, hay fever, and bleeding from the nasal mucosa or gums.

[0006] Patent CN101906457B discloses the use of alcohol dehydrogenase to catalyze the synthesis of epinephrine from adrenaline ketone, but the concentration of the catalytic substrate is only 21 g / L, which makes it difficult to apply industrially.

[0007] In order to realize the high-efficiency enzymatic catalytic synthesis of chiral adrenaline and noradrenaline intermediates, the present invention selects 3,4-dihydroxy-2'-chloroacetophenone as a substrate, generates (R)-3,4-dihydroxy-2'-chlorophenylethanol under the action of ketoreductase, and further prepares noradrenaline and adrenaline.

[0008] The document Tetrahedron: Asymmetry, 2007, 18, 1799-1803 discloses an alcohol dehydrogenase YMR226c, which can convert 3,4-dihydroxy-2'-chloroacetophenone into (R)-3,4-dihydroxy-2'-chlorophenylethanol, but the ee value is only 97% and the conversion substrate concentration is only 2.37 g / L.

[0009] Therefore, we need to modify the existing ketoreductase to increase the catalytic substrate concentration, conversion rate, ee value, etc., thereby significantly reducing the preparation cost of norepinephrine and epinephrine. Summary of the invention:

[0010] The purpose of the present invention is to provide a new ketoreductase mutant in view of the deficiencies of the prior art.

[0011] On the one hand, the present invention utilizes protein engineering technology to transform the ketoreductase from Lactobacillus kefiri to obtain three ketoreductase mutants A, B and C with high catalytic efficiency.

[0012] Furthermore, the amino acid sequences of the ketoreductase mutants A, B and C are shown in SEQ ID NOs. 3, 5 and 7, respectively.

[0013] Furthermore, the ketoreductase mutant A is a ketoreductase mutant A in which some sites are mutated based on the wild-type sequence, specifically: site 64 is Val, site 76 is Ile, site 88 is Gly, site 95 is Met, site 96 is Ile, site 99 is Leu, site 100 is Gly, site 117 is Ala, site 145 is Ala, site 147 is Ile, site 153 is Met, site 159 is Thr, site 190 is Ala, site 197 is Ala, site 200 is Pro, site 202 is Phe, and site 206 is Cys.

[0014] Furthermore, the ketoreductase mutant B is obtained by substitution and deletion based on the sequence of the ketoreductase mutant A.

[0015] Furthermore, ketoreductase mutant C was obtained by knocking out multiple loops based on ketoreductase mutant B.

[0016] Furthermore, the ketoreductase mutant is derived from the wild-type Lactobacillus kefiri, and the accession number of the wild-type template NCBI is 4RF2_A.

[0017] Furthermore, the ketoreductase mutant is constructed in vitro onto a recombinant expression vector, preferably a PET series vector.

[0018] Furthermore, the host cell of the ketoreductase mutant is Escherichia coli, and the cell is BL21(DE3), BL21(DE3)PLysS or Origami B(DE3).

[0019] Furthermore, after expression of the host cells under IPTG induction, the proteins of the above three mutants can be obtained. In order to improve the utilization rate of the ketoreductase mutants, the whole cells after fermentation can be directly used for late substrate catalysis.

[0020] On the other hand, the ketoreductase mutant provided by the present invention can convert 3,4-dihydroxy-2'-chloroacetophenone into (R)-3,4-dihydroxy-2'-chlorophenethanol, and the technical scheme adopted is as follows:

[0021]

[0022] Furthermore, the concentration of the 3,4-dihydroxy-2'-chloroacetophenone can reach 120 g / L.

[0023] Furthermore, the ketoreductase mutant is ketoreductase enzyme powder or whole cells or cell disrupted liquid containing the ketoreductase, preferably whole cells of ketoreductase.

[0024] Furthermore, a coenzyme system needs to be added to the reaction, preferably NADPH.

[0025] Furthermore, the reaction utilizes the reverse reaction of the ketoreductase mutant to achieve the regeneration of the coenzyme NADPH using isopropanol as a substrate.

[0026] Furthermore, the concentration of isopropanol in the reaction is controlled between 20% and 40%.

[0027] Furthermore, the reaction temperature of the reaction is controlled at 25-45°C, preferably 37°C.

[0028] Furthermore, the pH of the reaction is controlled between 5.0 and 7.5, preferably 6.0.

[0029] The beneficial effect of the present invention is that the present invention provides a new ketoreductase mutant, the conversion substrate concentration is as high as 120g / L, the conversion rate is more than 95.5%, and the chiral ee value is greater than 99%.

[0030] The preparation cost of epinephrine and norepinephrine has been greatly reduced, and green production has been achieved. Specific implementation method:

[0031] The technical content of the present invention is further described below in conjunction with specific embodiments, the purpose of which is to provide a better understanding of the content of the present invention, but the protection scope of the present invention is not limited thereto.

[0032] Example 1 Construction of ketoreductase

[0033] The wild-type gene sequence of ketoreductase from Lactobacillus kefiri was obtained from the NCBI website. Two upstream and downstream primers were designed using the primer design software Primer 5, which contained the cleavage sites of restriction endonucleases NdeI and XhoI, respectively. The specific primer information is shown in Table 1.

[0034] Table 1 Primer sequences for PCR amplification

[0035] Primer name Primer sequence (5'→3') NdeI-upstream primer TACGGCTAGCATGACTGATCGTTTAAAAGG XhoI-downstream primer CATGCTCGAGTTATTGAGCAGTGTATCCACC

[0036] According to the principle of PCR amplification, the target gene was synthesized with the help of a PCR instrument using the amplification ability of PrimeSTAR HSDNA Polymerase with the participation of upstream and downstream primers. The specific PCR system and amplification conditions are shown in Tables 2 and 3. After about 2 hours of amplification, 1% agarose electrophoresis gel analysis was performed, and the results showed that the gene size was correct.

[0037] Table 2 PCR reaction system

[0038] Ingredients Dosage 5X buffer 10ul dNTP (2.5 mM) 2ul Upstream primer (10pmol / ul) 1ul Downstream primer (10pmol / ul) 1ul KRED gene 50ng PrimeSTAR HSDNA Polymerase 1ul <![CDATA[ddH2O]]> Add to 50ul

[0039] Table 3 PCR amplification conditions

[0040]

[0041]

[0042] Example 2 Recombinant expression of ketoreductase

[0043] The recombinant plasmid pET21a-lkKRED constructed above was transformed into DH5α competent cells by chemical transformation and cultured in the presence of Amp + The cells were inverted and cultured on resistant LB plates at 37°C overnight. Positive single clones were selected for gene sequencing. After confirming that the sequence was correct, the recombinant expression vector was transferred into competent E. coli BL21 (DE3) cells, and single clone cells were extracted to obtain genetic engineering strains of Arthrobacter transaminase that could be induced to express.

[0044] BL21(DE3) cells containing the target gene were inoculated into ++In a resistant LB test tube, culture at 37°C overnight to obtain a primary seed culture solution. The seed culture solution was transferred to a 2YT liquid culture medium containing resistance at a 1% inoculation ratio, placed in a shaker, cultured at 37°C, 200rpm for 3-5h, and when the OD reached 0.6-0.8, cooled to 20°C, IPTG was added, and the concentration was controlled at 0.5mM for overnight induction expression. The fermentation broth was centrifuged and the bacteria were collected, and the collected bacteria were dissolved with 20mMTris-HCL buffer (pH7.5), and the cells were broken by ultrasound. After centrifugation at 12000rpm for 10min again, the supernatant obtained was the transaminase protein, and the proteins were all in soluble expression.

[0045] Example 3 Preparation of (R)-3,4-dihydroxy-2'-chlorophenethyl alcohol

[0046] Add 0.2 g of 3,4-dihydroxy-2'-chloroacetophenone to a 50 mL reaction bottle, dissolve it with 4 mL of isopropanol, add 2 mg of NADP, add 16 mL of water, adjust the pH to 7.0 with 0.1 M NaOH solution, and finally add 1 g of cells (wild-type ketoreductase). Stir the reaction in a 37 ° C water bath for 24 h, add acetonitrile to terminate the reaction, and rotary evaporate at 40 ° C to obtain the target product. The conversion rate is 65% and the ee value is 45%.

[0047] Example 4 Preparation of (R)-3,4-dihydroxy-2'-chlorophenethyl alcohol

[0048] Add 0.4g 3,4-dihydroxy-2'-chloroacetophenone to a 50mL reaction bottle, dissolve it with 5mL isopropanol, add 2mg NADP coenzyme, add 16mL water, adjust the pH to 7.0 with 0.1M NaOH solution, and finally add 1g mutant A cells (containing ketoreductase mutant A), stir the reaction in a 37℃ water bath, and use 0.1M NaOH solution to control the pH to 6.0 during the reaction. After 24h of reaction, add acetonitrile to terminate the reaction, evaporate at 40℃, and concentrate to obtain the target product, with a conversion rate of 85% and an ee value of 99.2%.

[0049] Example 5 Preparation of (R)-3,4-dihydroxy-2'-chlorophenethyl alcohol

[0050] Add 1g 3,4-dihydroxy-2'-chloroacetophenone to a 50mL reaction bottle, dissolve it with 6mL isopropanol, add 2mg NADPH, add 14mL water, adjust the pH to 7.0 with 0.1M NaOH solution, and finally add 0.8g ketoreductase mutant B enzyme powder, stir and react in a 37℃ water bath for 24h. After the reaction, add acetonitrile to dissolve, rotary evaporate at 40℃, and concentrate to obtain the target product with a conversion rate of 95% and an ee value of 99.3%.

[0051] Example 6 Preparation of (R)-3,4-dihydroxy-2'-chlorophenethyl alcohol

[0052] Add 2.4 g of 3,4-dihydroxy-2'-chloroacetophenone to a 50 mL reaction bottle, dissolve it with 8 mL of isopropanol, add 2 mg of NADPH, add 12 mL of water, adjust the pH to 7.0 with 0.1 M NaOH solution, and finally add 0.4 g of mutant C cells (containing ketoreductase mutant C) and stir the reaction in a 37 ° C water bath for 24 h. Add acetonitrile to terminate the reaction, rotary evaporate at 40 ° C, and concentrate to obtain the target product with a conversion rate of 95.5% and an ee value of 99.3%.

[0053] Example 7 Preparation of norepinephrine

[0054] 180 mg of (R)-1-(3,4-dihydroxyphenyl)-2-chloro-ethanol obtained in Example 6 was dissolved in 50 mL of dimethyl sulfoxide, 80 mg of urotropine was added, and the mixture was reacted at 70°C for 18 h. The mixture was then cooled to 25°C, 5 mL of ethanol was added, and the mixture was stirred for 30 min. Solid was precipitated, and 19 mL of concentrated hydrochloric acid was directly added. The mixture was stirred at room temperature for 10 h. Ammonia solution was added dropwise to adjust the pH to 8. The mixture was filtered, and the filter cake was washed with water and ethanol to obtain 45 mg of norepinephrine.

[0055] Example 8 Preparation of epinephrine

[0056] Take 20 mg of norepinephrine in Example 7 and 60 mg of S-adenosyl-methionine, adjust the pH of the system to 5 with PBS buffer, add 10 g / L PNMT crude enzyme solution, react at 50° C. for 12 h to obtain epinephrine, and its conversion rate is 96% by HPLC. Sequence Listing <110> Shangke Biopharmaceuticals (Shanghai) Co., Ltd. <120> A ketoreductase mutant and its application <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 252 <212> PRT <213> Lactobacillus kefiri <400> 1 Met Thr Asp Arg Leu Lys Gly Lys Val Ala Ile Val Thr Gly Gly Thr 1 5 10 15 Leu Gly Ile Gly Leu Ala Ile Ala Asp Lys Phe Val Glu Glu Gly Ala 20 25 30 Lys Val Val Ile Thr Gly Arg His Ala Asp Val Gly Glu Lys Ala Ala 35 40 45 Lys Ser Ile Gly Gly Thr Asp Val Ile Arg Phe Val Gln His Asp Ala 50 55 60 Ser Asp Glu Ala Gly Trp Thr Lys Leu Phe Asp Thr Thr Glu Glu Ala 65 70 75 80 Phe Gly Pro Val Thr Thr Val Val Asn Asn Ala Gly Ile Ala Val Ser 85 90 95 Lys Ser Val Glu Asp Thr Thr Thr Glu Glu Trp Arg Lys Leu Leu Ser 100 105 110 Val Asn Leu Asp Gly Val Phe Phe Gly Thr Arg Leu Gly Ile Gln Arg 115 120 125 Met Lys Asn Lys Gly Leu Gly Ala Ser Ile Ile Asn Met Ser Ser Ile 130 135 140 Glu Gly Phe Val Gly Asp Pro Thr Leu Gly Ala Tyr Asn Ala Ser Lys 145 150 155 160 Gly Ala Val Arg Ile Met Ser Lys Ser Ala Ala Leu Asp Cys Ala Leu 165 170 175 Lys Asp Tyr Asp Val Arg Val Asn Thr Val His Pro Gly Tyr Ile Lys 180 185 190 Thr Pro Leu Val Asp Asp Leu Glu Gly Ala Glu Glu Met Met Ser Gln 195 200 205 Arg Thr Lys Thr Pro Met Gly His Ile Gly Glu Pro Asn Asp Ile Ala 210 215 220 Trp Ile Cys Val Tyr Leu Ala Ser Asp Glu Ser Lys Phe Ala Thr Gly 225 230 235 240 Ala Glu Phe Val Val Asp Gly Gly Tyr Thr Ala Gln 245 250 <210> 2 <211> 759 <212> DNA / RNA <213> Lactobacillus kefiri <400> 2 atgactgatc gtttaaaagg caaagtagca attgtaactg gcggtacctt gggaattggc 60 ttggcaatcg ctgataagtt tgttgaagaa ggcgcaaagg ttgttattac cggccgtcac 120 gctgatgtag gtgaaaaagc tgccaaatca atcggcggca cagacgttat ccgttttgtc 180 caacacgatg cttctgatga agccggctgg actaagttgt ttgatacgac tgaagaagca 240 tttggcccag ttaccacggt tgtcaacaat gccggaattg cggtcagcaa gagtgttgaa 300 gataccacaa ctgaagaatg gcgcaagctg ctctcagtta acttggatgg tgtcttcttc 360 ggtacccgtc ttggaatcca acgtatgaag aataaaggac tcggagcatc aatcatcaat 420 atgtcatcta tcgaaggttt tgttggtgat ccaactctgg gtgcatacaa cgcttcaaaa 480 ggtgctgtca gaattatgtc taaatcagct gccttggatt gcgctttgaa ggactacgat 540 gttcgggtta acactgttca tccaggttat atcaagacac cattggttga cgatcttgaa 600 ggggcagaag aaatgatgtc acagcggacc aagacaccaa tgggtcatat cggtgaacct 660 aacgatatcg cttggatctg tgtttacctg gcatctgacg aatctaaatt tgccactggt 720 gcagaattcg ttgtcgatgg tggatacact gctcaataa 759 <210> 3 <211> 252 <212> PRT <213> Artificial Sequence <400> 3 Met Thr Asp Arg Leu Lys Gly Lys Val Ala Ile Val Thr Gly Gly Thr 1 5 10 15 Leu Gly Ile Gly Leu Ala Ile Ala Asp Lys Phe Val Glu Glu Gly Ala 20 25 30 Lys Val Val Ile Thr Gly Arg His Ala Asp Val Gly Glu Lys Ala Ala 35 40 45 Lys Ser Ile Gly Gly Thr Asp Val Ile Arg Phe Val Gln His Asp Val 50 55 60 Ser Asp Glu Ala Gly Trp Thr Lys Leu Phe Asp Ile Thr Glu Glu Ala 65 70 75 80 Phe Gly Pro Val Thr Thr Val Gly Asn Asn Ala Gly Ile Ala Met Ile 85 90 95 Lys Ser Leu Gly Asp Thr Thr Thr Glu Glu Trp Arg Lys Leu Leu Ser 100 105 110 Val Asn Leu Asp Ala Val Phe Phe Gly Thr Arg Leu Gly Ile Gln Arg 115 120 125 Met Lys Asn Lys Gly Leu Gly Ala Ser Ile Ile Asn Met Ser Ser Ile 130 135 140 Ala Gly Ile Val Gly Asp Pro Thr Met Gly Ala Tyr Asn Ala Thr Lys 145 150 155 160 Gly Ala Val Arg Ile Met Ser Lys Ser Ala Ala Leu Asp Cys Ala Leu 165 170 175 Lys Asp Tyr Asp Val Arg Val Asn Thr Val His Pro Gly Ala Ile Lys 180 185 190 Thr Pro Leu Val Ala Asp Leu Pro Gly Phe Glu Glu Met Cys Ser Gln 195 200 205 Arg Thr Lys Thr Pro Met Gly His Ile Gly Glu Pro Asn Asp Ile Ala 210 215 220 Trp Ile Cys Val Tyr Leu Ala Ser Asp Glu Ser Lys Phe Ala Thr Gly 225 230 235 240 Ala Glu Phe Val Val Asp Gly Gly Tyr Thr Ala Gln 245 250 <210> 4 <211> 759 <212> DNA / RNA <213> Artificial Sequence <400> 4 atgactgatc gtttaaaagg caaagtagca attgtaactg gcggtacctt gggaattggc 60 ttggcaatcg ctgataagtt tgttgaagaa ggcgcaaagg ttgttattac cggccgtcac 120 gctgatgtag gtgaaaaagc tgccaaatca atcggcggca cagacgttat ccgttttgtc 180 caacacgatg tctctgatga agccggctgg actaagttgt ttgatattac tgaagaagca 240 tttggcccag ttaccacggt tggcaacaat gccggaattg cgatgattaa gagtctcgga 300 gataccacaa ctgaagaatg gcgcaagctg ctctcagtta acttggatgc tgtcttcttc 360 ggtacccgtc ttggaatcca acgtatgaag aataaaggac tcggagcatc aatcatcaat 420 atgtcatcta tcgcaggtat cgttggtgat ccaactatgg gtgcatacaa cgctactaaa 480 ggtgctgtca gaattatgtc taaatcagct gccttggatt gcgctttgaa ggactacgat 540 gttcgggtta acactgttca tccaggtgct atcaagacac cattggttgc agatcttcca 600 gggtttgaag aaatgtgctc acagcggacc aagacaccaa tgggtcatat cggtgaacct 660 aacgatatcg cttggatctg tgtttacctg gcatctgacg aatctaaatt tgccactggt 720 gcagaattcg ttgtcgatgg tggatacact gctcaataa 759 <210> 5 <211> 249 <212> PRT <213> Artificial Sequence <400> 5 Met Thr Asp Arg Leu Lys Gly Lys Val Ala Leu Val Thr Gly Gly Thr 1 5 10 15 Leu Ala Ile Gly Leu Ala Ile Ala Asp Lys Phe Val Glu Glu Gly Ala 20 25 30 Lys Val Val Ile Cys Phe Arg His Ala Asp Val Gly Glu Lys Ala Ala 35 40 45 Lys Ser Ile Gly Gly Thr Asp Val Ile Arg Phe Val Gln Tyr Asp Gly 50 55 60 Asp Glu Ala Gly Trp Thr Lys Leu Phe Asp Ile Thr Glu Glu Ala Phe 65 70 75 80 Gly Pro Val Thr Thr Val Val Asn Glu Phe Ala Ile Ala Met Leu Lys 85 90 95 Ser Leu Gly Asp Thr Thr Glu Glu Trp Arg Lys Leu Leu Met Val Asn 100 105 110 Leu Asp Gly Val Phe Phe Gly Thr Arg Leu Gly Ile Gln Arg Met Lys 115 120 125 Asn Lys Gly Leu Gly Ala Ser Ile Ile Asn Gly Ser Ser Ile Ala Gly 130 135 140 Ile Ile Gly Asp Pro Thr Met Gly Ala Tyr Asn Ala Thr Lys Gly Ala 145 150 155 160 Val Arg Ile Met Ser Lys Ser Ala Ala Leu Asp Cys Ala Leu Lys Asp 165 170 175 Tyr Asp Val Arg Val Asn Thr Val His Thr Ala Gly Leu Lys Thr Gly 180 185 190 Leu Ile Ala Asp Leu Pro Gly Phe Glu Glu Met Cys Ser Gln Arg Thr 195 200 205 Lys Thr Pro Met Gly His Ile Gly Glu Pro Asn Asp Ile Ala Trp Ile 210 215 220 Cys Val Tyr Leu Ala Ser Asp Glu Ser Lys Phe Ala Thr Gly Ala Glu 225 230 235 240 Phe Val Val Gly Gly Phe Thr Ala Gln 245 <210> 6 <211> 750 <212> DNA / RNA <213> Artificial Sequence <400> 6 atgactgatc gtttaaaagg caaagtagca ttggtaactg gcggtacctt ggcaattggc 60 ttggcaatcg ctgataagtt tgttgaagaa ggcgcaaagg ttgttatttg ctttcgtcac 120 gctgatgtag gtgaaaaagc tgccaaatca atcggcggca cagacgttat ccgttttgtc 180 caatacgatg gtgatgaagc cggctggact aagttgtttg atattactga agaagcattt 240 ggcccagtta ccacggttgt caacgaattt gcaattgcga tgctcaagag tctcggagat 300 accactgaag aatggcgcaa gctgctcatg gttaacttgg atggtgtctt cttcggtacc 360 cgtcttggaa tccaacgtat gaagaataaa ggactcggag catcaatcat caatggatca 420 tctatcgcag gtatcatcgg tgatccaact atgggtgcat acaacgctac taaaggtgct 480 gtcagaatta tgtctaaatc agctgccttg gattgcgctt tgaaggacta cgatgttcgg 540 gttaacactg ttcatacagc tggtttgaag acaggattga ttgcagatct tccagggttt 600 gaagaaatgt gctcacagcg gaccaagaca ccaatgggtc atatcggtga acctaacgat 660 atcgcttgga tctgtgttta cctggcatct gacgaatcta aatttgccac tggtgcagaa 720 ttcgttgtcg gtggatttac tgctcaataa 750 <210> 7 <211> 235 <212> PRT <213> Artificial Sequence <400> 7 Met Thr Asp Lys Gly Lys Val Ala Leu Val Thr Gly Gly Thr Leu Ala 1 5 10 15 Ile Gly Leu Ala Ile Ala Asp Lys Phe Val Glu Glu Gly Ala Lys Val 20 25 30 Val Ile Cys Phe Arg His Ala Asp Val Gly Glu Lys Ala Ala Lys Ser 35 40 45 Ile Gly Gly Thr Asp Val Ile Arg Phe Val Gln Tyr Asp Gly Asp Glu 50 55 60 Ala Gly Trp Thr Lys Leu Phe Asp Ile Thr Glu Glu Ala Phe Gly Pro 65 70 75 80 Val Thr Thr Val Val Asn Glu Phe Ala Ile Ala Met Leu Lys Ser Leu 85 90 95 Gly Asp Thr Thr Glu Glu Trp Arg Lys Leu Leu Met Val Asn Leu Asp 100 105 110 Gly Val Phe Phe Gly Thr Arg Leu Gly Ile Gln Arg Met Lys Asn Lys 115 120 125 Gly Leu Gly Ala Ser Ile Ile Asn Gly Ser Ser Ile Ala Gly Ile Ile 130 135 140 Gly Asp Pro Thr Met Gly Ala Tyr Asn Ala Thr Lys Gly Ala Val Arg 145 150 155 160 Ile Met Ser Lys Ser Ala Ala Leu Asp Cys Ala Leu Lys Asp Tyr Asp 165 170 175 Val Arg Val Asn Thr Val His Thr Ala Gly Leu Lys Thr Gly Leu Ile 180 185 190 Ala Asp Leu Pro Gly Phe Glu Glu Met Cys Ser Gln Gly Glu Pro Asn 195 200 205 Asp Ile Ala Trp Ile Cys Val Tyr Leu Ala Ser Asp Glu Ser Lys Phe 210 215 220 Ala Glu Phe Val Val Gly Gly Phe Thr Ala Gln 225 230 235 <210> 8 <211> 708 <212> DNA / RNA <213> Artificial Sequence <400> 8 atgactgata aaggcaaagt agcattggta actggcggta ccttggcaat tggcttggca 60 atcgctgata agtttgttga agaaggcgca aaggttgtta tttgctttcg tcacgctgat 120 gtaggtgaaa aagctgccaa atcaatcggc ggcacagacg ttatccgttt tgtccaatac 180 gatggtgatg aagccggctg gactaagttg tttgatatta ctgaagaagc atttggccca 240 gttaccacgg ttgtcaacga atttgcaatt gcgatgctca agagtctcgg agataccact 300 gaagaatggc gcaagctgct catggttaac ttggatggtg tcttcttcgg tacccgtctt 360 ggaatccaac gtatgaagaa taaaggactc ggagcatcaa tcatcaatgg atcatctatc 420 gcaggtatca tcggtgatcc aactatgggt gcatacaacg ctactaaagg tgctgtcaga 480 attatgtcta aatcagctgc cttggattgc gctttgaagg actacgatgt tcgggttaac 540 actgttcata cagctggttt gaagacagga ttgattgcag atcttccagg gtttgaagaa 600 atgtgctcac agggtgaacc taacgatatc gcttggatct gtgtttacct ggcatctgac 660 gaatctaaat ttgcagaatt cgttgtcggt ggatttactg ctcaataa 708

Claims

1. A ketoreductase mutant, characterized in that The amino acid sequence of the ketoreductase mutant is shown in SEQ ID NO. 3, 5 or 7.

2. The ketoreductase mutant according to claim 1, characterized in that The gene nucleotide sequence of the ketoreductase mutant is shown in SEQ ID NO. 4, 6 or 8.

3. The ketoreductase mutant according to claim 1, characterized in that The ketoreductase mutants were expressed in BL21(DE3), BL21(DE3)PLysS or Origami B(DE3).

4. The ketoreductase mutant according to claim 1, characterized in that The ketoreductase mutant can convert 3,4-dihydroxy-2'-chloroacetophenone into (R)-3,4-dihydroxy-2'-chlorophenethanol.

Images