Oligonucleotides, viral vectors and their applications and RNAi drug preparations

Through RNAi technology using oligonucleotides and viral vectors, the COL8A2 mutant mRNA is specifically inhibited, solving the problem of treatment and prevention of corneal dystrophy and achieving non-invasive and highly effective treatment effects.

CN115505593BActive Publication Date: 2025-10-10WUHAN NEUROPHTH BIOTECHNOLOGY LTD CO
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202110698782.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-06-23
Publication Date
2025-10-10
Estimated Expiration
2041-06-23

AI Technical Summary

Technical Problem

Existing technologies cannot effectively treat and prevent corneal dystrophy caused by COL8A2 gene mutation, especially Fuchs endothelial corneal dystrophy (FECD), and traditional treatments such as corneal transplantation are highly invasive and have a high rejection rate.

Method used

Oligonucleotides and viral vectors, especially AAV, lentivirus, siRNA or antisense oligonucleotides (AON), are used to specifically inhibit or degrade COL8A2 mutant mRNA and reduce its protein expression through RNA interference (RNAi) technology, and the drug is administered through intracameral injection, intravitreal injection or subconjunctival injection.

Benefits of technology

Significantly reducing the expression of COL8A2 mutations, reducing the loss of corneal endothelial cells, treating existing corneal dystrophy and preventing its occurrence, providing a non-invasive treatment and prevention method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application relates to the field of medicine, in particular to oligonucleotide, viral vector and its application and RNAi drug preparation. The oligonucleotide is one or two of the nucleic acid sequences shown in SEQ ID NO: 1 to SEQ ID NO: 7; or the oligonucleotide with the nucleic acid sequence of the above-mentioned oligonucleotide is not less than 80% consistent. The present application finds that the RNAi drug can significantly reduce the expression of mutant COL8A2, can treat the corneal dystrophy that has occurred, and can prevent the occurrence of corneal dystrophy. It can be seen that the RNAi drug preparation of the present application can effectively treat and prevent the corneal dystrophy caused by COL8A2 mutation.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of medicine, in particular to oligonucleotides, viral vectors and their use and RNAi drug formulations. BACKGROUND

[0002] Corneal dystrophy (CD) is a group of inherited, usually progressive ophthalmic diseases, which is primary in cornea, only invades a certain layer of cornea at the beginning; in the late stage, it can affect adjacent layers, and even affect the whole layer of cornea; drug treatment is invalid. Those who affect vision can be treated by corneal transplantation surgery. According to the anatomical position, it is divided into three types of anterior, stroma and posterior. Generally, the posterior disorder is more serious, and the proportion of patients is the most (endothelial corneal dystrophy). Most of the CD has corneal opacity of various shapes. CD has been studied for many years, but the mechanism is still unclear. TGFBI is a relatively common mutant gene that has been reported, but the anterior CD caused by TGFBI mutation is mostly not too serious in most patients, and the treatment demand is not high, and relatively speaking, the endothelial CD is more serious.

[0003] Fuchs corneal endothelial dystrophy (Fuchs endothelial corneal dystrophy, FECD) is a common inherited corneal endothelial degenerative disease associated with the presence of corneal guttata, microscopic collagen accumulations beneath the corneal endothelial layer. FECD is the most common type of CD, and disease hallmarks include loss of corneal endothelial cells, formation of Descemet's membrane overgrowth, and in advanced stages, all cellular layers of the cornea are involved. Up to 5% of the US adult population over the age of 40 show corneal guttata. The presence of guttata is an indication of FECD, but often presents as a mild disease with no symptoms at all. Advanced (severe) disease develops in a small fraction of patients with guttata. Advanced FECD is characterized by extensive guttata, endothelial cell loss, corneal edema, corneal opacity, and vision loss due to corneal edema and opacity. Corneal edema, opacity, and subsequent vision loss are a direct consequence of endothelial cell degeneration and loss to swelling. The best treatment option is corneal transplantation, but the recurrence rate is high. Although corneal transplantation is a largely successful treatment, it has disadvantages, it is invasive and associated with a rejection rate of about 30%, which is not different from other solid organ allografts. An alternative approach that replaces only the corneal endothelium (endothelial keratoplasty) can also be performed, but only by experienced surgeons. Both interventions are limited by the lack of donor material (transplantable corneal sheets or cornea-derived endothelial cells derived from donor corneas). FECD is also a risk for other surgeries such as cataract surgery and is contraindicated for refractive surgery such as laser-assisted in situ keratomileusis (LASIK) as these techniques lead to additional corneal endothelial cell loss.

[0004] FECD is divided into early onset FECD and age-related FECD, which can be different diseases as guttata are usually not present in early onset FECD. Early onset FECD is rare and associated with genes such as Col82A2, which encodes the alpha 2-subunit of collagen VIII, a basement membrane component of the endothelium. COL8A2 is a large molecular component of the endothelial basement membrane, the main component of Descemet's membrane of the corneal endothelial cells, and a component of the vascular endothelium. It is essential for vascular smooth muscle cell migration and proliferation and thus has a potential role in maintaining vascular wall integrity and structure, especially in atherosclerosis. Mutations in COL8A2 at amino acid 450 and amino acid 455 cause patients to develop the disease and show similar pathological changes in animal models as FECD patients.

[0005] RNA interference (RNAi) is a newly discovered important gene expression regulation method in recent years, which is a post-transcriptional gene silencing phenomenon induced by small interfering RNA (siRNA) produced by endogenous or artificially transfected into cells. The mechanism of RNA interference can be divided into two parts: 1) amplification and initiation stage, after the dsRNA with specific sequence enters the cell, on the one hand, it is amplified exponentially under the action of RNA dependent RNA polymerase (RdRp), and a large amount of RNA against the target sequence is obtained. On the other hand, under the action of Dicer enzyme, small interfering RNA (siRNA) with 21-23 nt is formed, and the siRNA contains 2-3 nt 3' overhanging. 2) Effect stage, siRNA binds to ribonuclease complex to form RNA induced silencing complex (RISC), which depends on ATP release to disperse siRNA double strand into single strand to activate RISC, RISC specifically binds to the homologous region of the mRNA expressed by the exogenous gene, and RISC has the function of nuclease, and the cutting site is the two ends of the complementary binding of the antisense strand in the siRNA. The broken mRNA is degraded immediately after cutting.

[0006] RNAi has the following advantages: 1) high specificity, siRNA binds to the target gene strictly according to the base pairing principle, and has strict sequence specificity. 2) high efficiency, a small amount of siRNA can make the expression of the encoded pathogenic gene product decrease by more than 90%, achieving the effect of knocking out. 3) high stability, the 2 bases overhanging at the 3' end of siRNA make it not easy to be degraded by nucleases in cells. Due to its unique advantages, RNAi technology has been rapidly applied to basic research and clinical application. At present, RNAi drugs have been approved for listing, and some RNAi drugs are in the clinical trial stage. But there is no RNAi drug for COL8A2 mutation induced corneal dystrophy. SUMMARY

[0007] Therefore, the application provides an oligonucleotide, a viral vector and its application and an RNAi drug preparation. The oligonucleotide, the viral vector and the RNAi drug preparation can effectively treat and prevent corneal dystrophy caused by COL8A2 mutation.

[0008] In order to achieve the above-mentioned application purposes, the application provides the following technical solutions:

[0009] The application provides an oligonucleotide, which is one or two of the nucleic acid sequences shown in SEQ ID NO: 1 to SEQ ID NO: 7.

[0010] The present application also provides an oligonucleotide, which is an oligonucleotide having a nucleic acid sequence identical to the above-mentioned oligonucleotide nucleic acid sequence at a rate of not less than 90%.

[0011] Preferably, the oligonucleotide is an oligonucleotide having a nucleic acid sequence identical to the above-mentioned oligonucleotide nucleic acid sequence at a rate of not less than 95%, 96%, 97%, 98% or 99%.

[0012] The present application also provides an oligonucleotide, which is an oligonucleotide chemically modified based on the above-mentioned two oligonucleotide nucleic acid sequences.

[0013] The present application also provides a viral vector, which comprises any of the above-mentioned oligonucleotides.

[0014] Preferably, the viral vector is one of an adeno-associated virus, a lentivirus, a retrovirus or an adenovirus.

[0015] Preferably, the viral vector contains one of a U6, H1 or tRNA promoter.

[0016] Preferably, the serotype of the adeno-associated virus is selected from one or more of AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh10 wild type or 7M8, TYF mutant.

[0017] The present application also provides the use of the above-mentioned oligonucleotide or viral vector in the preparation of a drug for preventing and / or treating an eye disease, which is Fuchs endothelial corneal dystrophy (FECD) or posterior polymorphous corneal dystrophy (PPCD) caused by a COL8A2 mutation.

[0018] In the specific embodiments provided by the present application, the eye disease is a disease caused by a Q455K mutation in the COL8A2 gene.

[0019] The present application also provides an RNAi drug preparation, which comprises the above-mentioned oligonucleotide or viral vector, and a pharmaceutically acceptable carrier and / or excipient.

[0020] Preferably, the excipient of the RNAi drug preparation includes, but is not limited to, a nano-carrier or a liposome.

[0021] Preferably, the RNAi drug preparation is a liquid preparation.

[0022] Preferably, the administration mode of the RNAi drug preparation is anterior chamber injection, intravitreal injection, subconjunctival injection or eye surface drop.

[0023] The present application provides oligonucleotides, viral vectors and their applications and RNAi drug preparations. The oligonucleotide is one or two of the nucleic acid sequences shown in SEQ ID NO: 1 to SEQ ID NO: 7; or an oligonucleotide with a nucleic acid sequence having a consistency of not less than 80% with the above-mentioned oligonucleotide nucleic acid sequence. The technical effects of the present application are as follows:

[0024] The present application first uses a luciferase reporter plasmid containing a COL8A2 mutant target sequence and a candidate RNAi sequence plasmid for co-transfection, screens efficient and mutant sequence-specific RNAi target sequences, then performs AAV-RNAi drug treatment on 293 cells stably expressing COL8A2 mutants, detects changes in the mRNA and protein levels of COL8A2, and finds that the RNAi drug can significantly reduce the expression of mutant COL8A2. In addition, the use of AAV-RNAi drugs for mutant COL8A2 mice finds that the drug can treat the already occurring corneal dystrophy and prevent the occurrence of corneal dystrophy. In summary, the in vitro and in vivo experiments first find that the RNAi drug preparation of the present application can effectively treat and prevent corneal dystrophy caused by COL8A2 mutations, indicating that the RNAi drug can be further researched and developed as a clinical treatment or prevention of corneal dystrophy caused by COL8A2 mutations. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 Vector map of AAV-shRNA:

[0026] A: The vector contains AAV2 3' ITR, U6 promoter, shNC not targeting COL8A2 sequence and AAV2 5' ITR;

[0027] B: The vector contains AAV2 3' ITR, U6 promoter, shRNA4 targeting COL8A2 Mut sequence and AAV2 5' ITR;

[0028] C: The vector contains AAV2 3' ITR, U6 promoter, shRNA5 targeting COL8A2 Mut sequence and AAV2 5' ITR;

[0029] D: The vector contains AAV2 3' ITR, U6 promoter, shRNA4 and shRNA5 targeting COL8A2 Mut sequence and AAV2 5' ITR;

[0030] Figure 2Screening of effective RNAi sequence: co-transfect 293 cells with luciferase reporter gene containing COL8A2 mutation (Mut) target sequence and candidate shRNA plasmid, detect luciferase activity after 48 hours, screen shRNA with interference effect on target sequence;

[0031] Figure 3 Effect of pAAV-shRNA plasmid drug transfection and AAV-shRNA drug infection on expression level of mutant COL8A2 mRNA:

[0032] A: Transfect RNAi control or drug in 293 cells stably expressing COL8A2 gene mutation, detect COL8A2 mRNA expression level after 48 hours;

[0033] B: Infection of RNAi control or different doses of drug in 293 cells stably expressing COL8A2 gene mutation, detect COL8A2 mRNA expression level after 48 hours;

[0034] Figure 4 Effect of pAAV-shRNA plasmid drug transfection and AAV-shRNA drug infection on expression level of mutant COL8A2 protein:

[0035] A: Transfect RNAi control or drug in 293 cells stably expressing COL8A2 gene mutation, detect COL8A2 protein expression level by WB after 48 hours;

[0036] B: Calculate band optical density value using ImageJ software, plot and compare plasmid transfection results;

[0037] C: Infection of AAV-RNAi control or different doses of drug in 293 cells stably expressing COL8A2 gene mutation, detect COL8A2 protein expression level after 48 hours;

[0038] D: Calculate band optical density value using ImageJ software, plot and compare virus transfection results;

[0039] Figure 5 Detect COL8A2 protein fluorescence signal intensity in 293 cells stably expressing COL8A2 gene mutation after infection of different doses of AAV-RNAi control or drug for 72 hours;

[0040] A-D: Detect COL8A2 protein fluorescence signal intensity in 293 cells stably expressing COL8A2 gene mutation after infection of AAV-RNAi control or different doses (1E3, 1E4, 1E5) of AAV-RNAi drug for 72 hours;

[0041] E: The fluorescence signal intensity value was calculated using ImageJ software, and the graph was compared;

[0042] Figure 6 Example 4: Therapeutic effect of AAV-RNAi drug on corneal dystrophy caused by COL8A2 mutation: AAV-RNAi drug was injected into the anterior chamber of 6-month-old COL8A2 gene mutant or wild-type mice, and the number of corneal endothelial cells in the mice was detected after 6 months;

[0043] Figure 7 Example 5: Preventive effect of AAV-RNAi drug on corneal dystrophy caused by COL8A2 mutation: AAV-RNAi drug was injected into the anterior chamber of 1-month-old COL8A2 gene mutant or wild-type mice, and the number of corneal endothelial cells in the mice was detected after 11 months. DETAILED DESCRIPTION

[0044] The present application discloses oligonucleotides, viral vectors and their applications and RNAi drug formulations, and those skilled in the art can refer to the content herein and appropriately improve the process parameters for implementation. It is particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are considered to be included in the present application. The methods and applications of the present application have been described by preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.

[0045] Terminology:

[0046] Brief introduction of corneal endothelium: The corneal endothelium is a non-regenerative cell monolayer on the inner surface of the cornea, which separates the corneal stroma from the anterior chamber fluid. The corneal endothelium is responsible for maintaining corneal transparency through a continuous process that prevents the cornea from excessive hydration due to the influx of cations and water molecules into the collagenous corneal stroma, commonly referred to as "deturgescence".

[0047] The present application uses chemically synthesized siRNA and AAV expressed shRNA to verify the effectiveness of treatment and prevention of corneal dystrophy caused by COL8A2 mutation. According to the principle of RNAi technology, those skilled in the art can reasonably infer that different types of viral vectors expressed shRNA have similar therapeutic effects according to the characteristics of different viral vectors.

[0048] The present application provides a drug for preventing and / or treating genetic diseases, which can be a viral vector such as AAV, lentivirus, etc., or a non-viral vector such as small interfering RNA (siRNA), antisense oligonucleotide (ASON), etc., preferably in a human subject suffering from or at risk of developing a genetic disease, wherein the oligonucleotide is at least partially complementary to a target RNA molecule. The preferred genetic disease treated and / or prevented by using the AAV, lentivirus, siRNA, ASON of the present application is a corneal dystrophy in humans, more preferably a disease called Fuchs endothelial corneal dystrophy (FECD) caused by mutations in the COL8A2 gene. The present application demonstrates that the RNAi drug has the effect of treating and preventing corneal dystrophy caused by COL8A2 mutations by in vitro and in vivo experiments in mice, and explores the mechanism of the RNAi drug to play the role by specifically inhibiting or degrading the mRNA of the mutant COL8A2.

[0049] The presence of COL8A2 gene L450W, Q455K mutations associated with the development of FECD is well known in the art, but there is currently no method disclosed to prevent or treat the development of FECD or alleviate its symptoms. According to the pathogenesis of COL8A2 mutations leading to the onset of FECD patients, the method of using RNAi to inhibit or degrade the mRNA of COL8A2, thereby reducing the production of COL8A2 protein, reducing the accumulation of COL8A2 protein, thereby preventing or alleviating the condition of FECD patients. The present application uses AAV, lentivirus, siRNA or ASON to express the interfering RNA or antisense nucleotide of COL8A2 in the anterior chamber or cornea of the patient's eye. Those skilled in the art should understand that if one of the methods of AAV, lentivirus, siRNA or ASON is effective, the other methods also have similar effects.

[0050] The oligonucleotide, viral vector and its application provided by the present application and the reagents or instruments used in the RNAi drug preparation can be purchased from the market.

[0051] The RNAi drug can bind to the mutant COL8A2 mRNA, thereby inhibiting or degrading the RNA, reducing the expression of the mutant COL8A2 protein, and the present application is further illustrated by the following examples:

[0052] Example 1 Screening of efficient RNAi drugs by luciferase reporter system

[0053] I. Culture of mammalian cells (adherent)

[0054] 1. Cell recovery

[0055] 1) Prepare 37-38°C warm water in advance, take out the cells (293 cells and 293-COL8A2 overexpression cell lines) that need to be recovered from the liquid nitrogen tank, fix them with an ophthalmic surgical forceps, and quickly place them in the water, ensuring that the cryogenic tube is completely immersed in the water to ensure uniform heating until the cells in the cryogenic tube are completely thawed.

[0056] 2) Sterilize the cryogenic tube with alcohol.

[0057] 3) Use a pipette to pre-absorb 5 mL of cell culture medium in a T25 cell culture flask, and then use a new pipette to transfer the thawed cells to the cell flask and gently blow them.

[0058] 4) Cover the cell flask and place it in a cell culture incubator at 37°C, 5% CO2, and incubate.

[0059] 5) After about 6-8 hours (depending on different cells), replace the fresh culture medium to eliminate the effect of DMSO remaining in the cell cryopreservation solution on cell growth.

[0060] 2. Cell passage and cryopreservation

[0061] 1) When the cells grow to fill the T25 cell flask, use a pipette to aspirate the culture medium and discard it.

[0062] 2) Add 10 mL of PBS, gently wash the cells, and then use a pipette to aspirate and discard them.

[0063] 3) Use a pipette to aspirate 1-1.5 mL of trypsin, covering the bottom of the cell flask, and place the cell flask in a 37°C, 5% CO2 cell culture incubator for 3-5 min (the length of the digestion time depends on the type of cells).

[0064] 4) Observe under a microscope, the adherent cells become round and all detach from the cell flask wall.

[0065] 5) In the cell operation platform, use a pipette to aspirate about 4 mL of medium into the cell flask, gently blow it to disperse the cells and neutralize the trypsin digestion effect.

[0066] 6) Use a pipette to aspirate the evenly dispersed cell suspension (volume about 1 / 3-2 / 3) into another new cell flask, and add 5 mL of culture medium, and place it in a cell culture incubator at 37°C, 5% CO2, and continue to incubate.

[0067] II. 293 cell transfection

[0068] 1. Count the cells after trypsinization the day before transfection (about 24 h). According to the corresponding well plate, take the corresponding amount of cells to plate, so that the cell coverage rate is 70-90% when transfection.

[0069] 2. All plasmids and reagents were placed at room temperature before transfection. The volume of plasmids and PEI max were calculated.

[0070] 3. The corresponding volume of plasmids was added to a certain volume of DMEM, mixed, and formed A liquid. The corresponding volume of PEI max was added to a certain volume of DMEM, mixed, and formed B liquid.

[0071] 4. B liquid was quickly added to A liquid, mixed, and rested for 20 min to form a transfection complex. The transfection complex was slowly added to the cell culture medium and mixed gently.

[0072] 5. Incubate at 37°C, 5% CO2 for 48 h, and then perform dual luciferase activity detection.

[0073] III. Luciferase activity detection

[0074] After 48 h of transfection, the detection steps were performed according to the instructions of Dual-GloTM luciferase assay system (Promega, USA), and the specific experimental operation was as follows:

[0075] 1) Take the cell culture plate out of the incubator, aspirate the culture medium, wash once with PBS, and add the corresponding volume of PLB to lyse the cells according to the corresponding well plate. Incubate at room temperature for 15 min on a horizontal shaker.

[0076] 2) Take 20 μL of cell lysate to a 96-well enzyme-labeled plate, add 100 μL of LARII, mix, and detect the luciferase chemiluminescence signal with an enzyme-labeled instrument.

[0077] 3) After detection, add 100 μL of Stop Substrate to each well, mix, and detect the Renilla chemiluminescence signal with an enzyme-labeled instrument.

[0078] IV. Test results

[0079] The present application designs a vector for shRNA (SEQ ID NO: 1, 2) targeting COL8A2 mutation. Figure 1 ) In 293 cells, luciferase plasmids containing mutant COL8A2 sequences were co-transfected with RNAi controls (random sequences not targeting COL8A2, same below) or candidate RNAi drugs (mutation-specific shRNA). Luciferase activity was detected 48 hours after transfection, and it was found that compared with the RNAi control, the 4th and 5th drugs targeting Mut-1 mutant COL8A2 had a significant inhibitory effect on the luciferase activity of Mut-1 mutant COL8A2 ( Figure 2 ). This suggests that these two RNAi drugs may have specific inhibitory effects on the expression of mutant COL8A2.

[0080] The specific sequence of each drug is as follows:

[0081] SEQ ID NO: 1: shRNA4

[0082] CCGGCCACCTATACCTACGAT

[0083] SEQ ID NO: 2: shRNA5

[0084] AAGACAAGCAACCATGTTAAC

[0085] SEQ ID NO: 3: shRNA1

[0086] CACCTATACCTACGATGAGTA

[0087] SEQ ID NO: 4: shRNA2

[0088] GCCCACAACTTCTCCAAACAA

[0089] SEQ ID NO: 5: shRNA3

[0090] CAGTACCTGGAAATGCCTCTA

[0091] SEQ ID NO: 6: shRNA6

[0092] AAGCAACCATGTTAACTGTAT

[0093] SEQ ID NO: 7: shRNA7

[0094] AAGATCAACCTCTGTGAAGTG

[0095] SEQ ID NO: 8: shRNANC

[0096] GGTACAATCCGGAGTTATACT

[0097] Example Two RNAi Drug Treatment Inhibits Mutant-Specific COL8A2 Gene Expression

[0098] I. 293-COL8A2 Overexpression Cell Line Cell Transfection:

[0099] The method is the same as described above.

[0100] II. Reverse Transcription Fluorescence Quantitative PCR Detection of COL8A2 RNA Levels

[0101] 1. The reverse transcription reaction system is as follows:

[0102]

[0103]

[0104] Reverse transcription reaction conditions: 37°C for 1 h, 75°C for 10 min.

[0105] 2. Real-time reaction system

[0106] 1) Detection primers and internal reference primers of target genes

[0107] COL8A2:5'-TCCGGCAGCCGCGAG-3'(sense)

[0108] 5'-GCATTTCCAGGTACTGGCCT-3'(antisense)

[0109] GAPDH:5'-GGAAGGTGAAGGTCGGAGTCAACGG-3'(sense)

[0110] 5'-CTCGCTCCTGGAAGATGGGTGATGGG-3'(antisense)

[0111] 2) Reaction system

[0112]

[0113] 3) Reaction procedure:

[0114]

[0115] 3. AAV infection of 293 cells

[0116] 1. Prepare AAV RNAi control virus and RNAi drug virus.

[0117] 2. The recombinant virus was used to infect 293-COL8A2 overexpressing cell line cells at an MOI of 1E3, 1E4, and 1E5, respectively.

[0118] 3. 48 hours after infection, detect the RNA and protein expression levels of COL8A2.

[0119] 4. Western Blot

[0120] 1. Protein Sample Preparation

[0121] 1) Lyse cells using lysis buffer, extract cell proteins, and determine protein concentration.

[0122] 2) Calculate the volume of protein solution needed for loading, add SDS-PAGE loading buffer, mix well, and denature the protein in a 100℃ metal bath for 5 minutes.

[0123] 2. Electrophoresis

[0124] 1) Prepare the appropriate separating gel according to the size of the protein being detected. After the separating gel has solidified, prepare a 5% stacking gel, fill the glass plate, and insert the comb.

[0125] 2) Place the gel plate in the electrophoresis tank, with the long plate on the outside and the short plate on the inside, and pour in the electrophoresis buffer.

[0126] 3) Loading: Load 5 μL of pre-stained protein molecular marker SDS-PAGE and protein sample directly into the SDS-PAGE gel loading well. Use 10 μL of 1x SDS-PAGE protein loading buffer to load into the empty loading well next to the sample well.

[0127] 4) Electrophoresis: Use a low voltage of 80V for constant voltage electrophoresis when the upper gel is loaded, and use a high voltage of 120V for constant voltage electrophoresis when the bromophenol blue enters the lower gel.

[0128] 3. Transferring

[0129] Assemble the transfer sandwich according to the corresponding transfer device, place it in the electrophoresis tank containing the transfer buffer, and transfer at a constant voltage of 100V for 80-90 minutes.

[0130] 4. Blocking

[0131] After the transfer is complete, rinse for 1-2 minutes, use a dropper to absorb the buffer, add 5% non-fat milk powder, and slowly shake on a side-to-side shaker for 45-60 minutes at room temperature. Add TBS washing solution and wash for 5 minutes. Repeat the washing process 3 times.

[0132] 5. Antibody incubation

[0133] Dilute the primary antibody with PBS+2% BSA according to the recommended dilution ratio, slowly shake at 4°C overnight or at room temperature on a side-to-side shaker for 2 hours. After incubation, wash. Add the diluted secondary antibody according to the recommended dilution ratio, slowly shake at room temperature on a side-to-side shaker for 40 minutes to 1 hour. After incubation, wash.

[0134] 6. Protein detection

[0135] Use ECL-type reagents to detect proteins. Take 1 mL of each, mix well, and drop onto the protein membrane surface. Incubate in the dark for 1-2 minutes. Use tweezers to place the protein membrane neatly on plastic paper and expose it to the gel imager.

[0136] Five, test results

[0137] First, this example constructed a stable cell line of 293-COL8A2 mutation. COL8A2 mutant cells were transfected with pAAV-shRNA control plasmid and pAAV-shRNA plasmid or infected with AAV-shRNA control and AAV-shRNA drugs. 48 hours after transfection, cell samples were collected and RNA was extracted to detect the expression of COL8A2. It was found that compared with the control, whether it was a single shRNA plasmid (pAAV-shRNA4, pAAV-shRNA5) or a combined shRNA plasmid (pAAV-shRNA4-shRNA5), the RNAi plasmid drug of the present invention could significantly inhibit the RNA expression of mutant COL8A2 ( Figure 3 A); At the same time, after infection with different doses of viral drugs, the mRNA level of COL8A2 in cells decreased significantly compared with the control ( Figure 3 B). 48 hours after plasmid transfection, cell samples were collected and protein was extracted to detect COL8A2 expression. It was found that compared with the control, whether it was a single shRNA plasmid (pAAV-shRNA4, pAAV-shRNA5) or a combined shRNA plasmid (pAAV-shRNA4-shRNA5), the RNAi plasmid drug of the present invention could significantly inhibit the protein expression of mutant COL8A2 ( Figure 4 A, B); At the same time, after infection with different doses of viral drugs, the protein level of COL8A2 in cells decreased significantly compared with the control ( Figure 4 C, D). After 72 hours of infection with different doses of viral drugs, the fluorescence signal intensity of COL8A2 protein in cells was detected using specific antibodies. The results showed that compared with the control, different doses of drug treatment significantly reduced the abundance of COL8A2 protein in cells ( Figure 5 ).

[0138] Example 3 RNAi drugs can treat and prevent corneal dystrophy in humanized mutant COL8A2 mice

[0139] 1. AAV-RNAi Virus Infection of Mice and Analysis

[0140] 1. Construction of humanized COL8A2 mutant transgenic mice.

[0141] 2. Prepare 5*10E12 vg / mL of AAV RNAi control virus and RNAi drug virus.

[0142] 3. 1 μL / eye of control RNAi or drug group RNAi virus was injected into the eyes of 1-month-old or 6-month-old mice through intracameral injection.

[0143] 4. When the mice were 12 months old, they were killed, and their corneal tissues were separated and stained to detect the number of corneal endothelial cells and the total COL8A2 protein content.

[0144] 2. Test results

[0145] One-month-old mice had not yet developed disease and had normal corneal tissue cell morphology. However, six-month-old mice had already developed growths in the Descemet's membrane and endothelial cell loss. In this example, 6-month-old mice were injected with 5*10E9 vg / eye of the RNAi drug into the anterior chamber. Six months later, the number of corneal endothelial cells was measured, and it was found that compared with the control RNAi group, the corneal endothelial cell loss in the RNAi drug treatment group was significantly reduced ( Figure 6 This indicates that RNAi drugs can effectively treat corneal dystrophy caused by COL8A2 mutations. In this example, 5*10E9 vg / eye of RNAi drug and RNAi control were injected into the intracameral chamber of one-month-old mice. Eleven months later, the number of corneal endothelial cells was measured, and it was found that the number of corneal endothelial cells in the RNAi drug treatment group was relatively stable compared to the control RNAi group. Figure 7 ) indicates that RNAi drugs can effectively prevent corneal dystrophy caused by COL8A2 mutation.

[0146] Thus, it can be confirmed that the RNAi drug of the present invention can effectively and specifically inhibit the expression of mutant COL8A2 and play a therapeutic role in preventing corneal dystrophy caused by COL8A2 mutation. This new discovery provides a theoretical and factual basis for the development of drugs for corneal dystrophy.

[0147] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention. Sequence Listing <110> Wuhan Newfors Biotechnology Co., Ltd. <120> Oligonucleotides, viral vectors and their applications and RNAi drug preparations <130> MP21012625 <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 1 CcgGccAcCt atAcCtAcG At 21 <210> 2 <211> 21 <212> DNA / RNA <213> Artificial Sequence <400> 2 AagAcAagC ACcAtGttA Ac 21 <210> 3 <211> 21 <212> DNA / RNA <213> Artificial Sequence <400> 3 CacCtAtACt AcGAtGAgT A 21 <210> 4 <211> 21 <212> DNA / RNA <213> Artificial Sequence <400> 4 GccCacAACt TCTCCAAAC A 21 <210> 5 <211> 21 <212> DNA / RNA <213> Artificial Sequence <400> 5 CagTACCTG GAAATGCCT CTa 21 <210> 6 <211> 21 <212> DNA / RNA <213> Artificial Sequence <400> 6 AagCaACc AtGTTACtG Ta 21 <210> 7 <211> 21 <212> DNA / RNA <213> Artificial Sequence <400> 7 aagatcaacc tctgtgaagt g 21 <210> 8 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 8 ggtacaatcc ggagttatac t 21

Claims

1. An oligonucleotide, characterized in that The oligonucleotides are nucleic acid sequences shown in SEQ ID NO: 1 and SEQ ID NO:

2.

2. A viral vector, characterized in that The viral vector comprises the oligonucleotide according to claim 1.

3. The viral vector according to claim 2, characterized in that The viral vector is one of adeno-associated virus, lentivirus, retrovirus or adenovirus.

4. The viral vector according to claim 3, characterized in that The viral vector contains one of U6, H1 or tRNA promoters.

5. The viral vector according to claim 4, characterized in that The serotype of the adeno-associated virus is selected from one or more of AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh10 wild type or 7M8, TYF mutant types.

6. Use of the oligonucleotide according to claim 1 or the viral vector according to any one of claims 2 to 5 in the preparation of a drug for treating eye diseases, characterized in that: The eye disease is Fuchs' corneal dystrophy or posterior polymorphic corneal dystrophy caused by COL8A2 mutation.

7. An RNAi pharmaceutical preparation, characterized in that The RNAi pharmaceutical preparation comprises the oligonucleotide according to claim 1 or the viral vector according to any one of claims 2 to 5, and a pharmaceutically acceptable carrier.

8. The RNAi pharmaceutical preparation according to claim 7, characterized in that The excipient of the RNAi pharmaceutical preparation is a nanocarrier.

Citation Information

Patent Citations

  • Adeno-associated virus vectors for the delivery of therapeutics

    WO2020176747A1