Novel recombinant lysins and their use in the treatment of gram-negative bacterial infections

Abstract

Novel recombinant lysins and their use in treating gram-negative bacterial infections. The present invention relates to a novel recombinant lysin and its use as an antimicrobial agent in a novel therapeutic approach for the elimination of antibiotic-resistant gram-negative bacteria with the maximum reduction of the emergence of new resistances. The invention further relates to polynucleotides encoding the recombinant lysin of the invention, vectors and host cells comprising the same, as well as related methods, medical uses, compositions and kits.

Description

TECHNICAL FIELD

[0001] The present invention relates to the field of clinical and veterinary microbiology. In particular, the present invention relates to a novel recombinant lysin and its use as an antimicrobial agent in a novel therapeutic approach for the elimination of antibiotic-resistant Gram-negative bacteria with the maximum reduction of the emergence of new resistances. BACKGROUND

[0002] Since the introduction of antibiotics in the 1940s, these powerful compounds have been used to treat infections in humans and animals, to eliminate surface microorganisms, and even to preserve food (Farber, L. et al. 1959). However, bacteria quickly began to show signs of resistance to the aforementioned antibiotics, with the first penicillin-resistant Staphylococcus aureus being discovered in 1946 (Davies, J. & Davies, D. 2010; Frankel, R. B. et al. 2006). Misuse and abuse of antibiotics have led to the emergence and spread of antibiotic resistance in almost all pathogens, some of which are even resistant to all available antibiotics. Antibiotic-resistant bacteria are able to grow in the presence of antibiotics that would normally kill them or limit their growth, while multidrug-resistant (MDR) bacteria are able to grow in the presence of two or more unrelated antibiotics. In a clinical setting, the inappropriate use of antibiotics (in viral infections, broad-spectrum antibiotic use, etc.) accounts for 20 to 50% of all antibiotics consumed (Tenover, F. C. 2006, Starrels, J. L. et al. 2009). In the field of the food industry, antibiotics have been used in livestock farming to promote animal growth, as a prophylactic method, and to treat infections in these animals (Lekshmi M. et al. 2017). In the food industry, the unselective use of antibiotics for purposes other than treating infections has led to the emergence of resistant pathogens in the production environment of this industry. Today, livestock farming, poultry farming, and aquaculture are using a variety of medical antimicrobial drugs. Some of these drugs, such as fluoroquinolones, are essential for the treatment of human Gram-negative bacterial infections, and therefore, the emergence of resistance by pathogens with zoonotic potential could threaten the efficacy of the aforementioned antibiotics (Smith, K. E. et al. 1999). Due to the emergence and spread of pathogenic MDR bacteria, there is an increasing awareness of the risk of entering a post-antibiotic era in which it will no longer be possible to treat common bacterial infections in an effective manner (WHO report 2007). Several international studies predict a series of global catastrophic scenarios if a quick solution to antimicrobial resistance is not found. The aforementioned studies predict that in 2050, 10 million people will die each year (O'Neill, J. 2016; Adeyi, O. O. et al. 2017). This risk, together with the very limited development of new therapies today, means that alternative antimicrobial drugs need to be sought, preferably with new mechanisms of action, in order to minimize the development of resistance.

[0003] These issues have led to the publication of numerous documents on the topic by various international organizations, including the Food and Agriculture Organization of the United Nations (FAO), the World Organisation for Animal Health (OIE), and the World Health Organization (WHO). Against this backdrop, the European Commission has called on its member states to develop an action plan on antimicrobial resistance, emphasizing the need for a holistic approach (both human and veterinary) to effectively combat the development and spread of antibiotic resistance.

[0004] In Spain, the Ministry of Health, Consumer Affairs and Social Welfare (MSCBS) has launched a national plan (Plan Nacional frente a la Resistencia a los Antibióticos - PRAN) to address antibiotic resistance, in response to a request from the European Commission. This plan includes a series of joint programs and strategic guidelines for human and animal health, such as voluntary reductions in the consumption of specific antibiotics in different animal species. Specifically, in addition to completely eliminating the use of antibiotics in animal feed, the organization of Spain's major chicken producers (Organización Interprofesional de la Avicultura de Carne de Pollo - PROPOLLO) has set a 45% reduction in total antibiotic consumption as a key objective for the Spanish poultry industry within two years. Specifically regarding colistin, the goal is to reduce it by 80% from the current 4.7 mg / kg to 1 mg / kg.

[0005] Therefore, developing novel antimicrobial agents and new treatments to eliminate drug-resistant microorganisms and minimize the emergence of new resistance to antimicrobial drugs has become an urgent issue today. More promising or complementary alternatives to traditional antibiotics include bacteriophages and their lysins (Hojckova, K. et al. 2013; Czaplewski, L. et al. 2016). Bacteriophages are among the most abundant biological entities in nature and were widely known for their potential as therapeutic agents even before the discovery of antibiotics (Hermoso JA et al. 2007). However, in the West, bacteriophages were marginalized with the advent of antibiotics. The problems caused by drug-resistant microorganisms today have sparked renewed interest in bacteriophages as potential candidates for treating infections, particularly those caused by multidrug-resistant microorganisms (Hermoso JA et al. 2007). Different research groups are exploring strategies to use whole bacteriophages as antibiotic alternatives. In addition, research has been conducted on isolating and optimizing bacteriophage components as antibacterial drugs, opening a new door for the treatment of multidrug-resistant infections.

[0006] Specifically, at the end of its replication cycle, the bacteriophage uses phage lysin to degrade the peptidoglycan (PG) of the bacterial host from within, leading to cell lysis and the release of progeny viral particles. This bactericidal effect has been reported to persist even when the lysin acts externally (“from the outside”) on the bacteria, particularly in the case of Gram-positive bacteria, because the cell wall is more exposed (as Gram-positive bacteria lack an outer membrane, unlike Gram-negative bacteria). This property makes this enzyme candidate an antimicrobial agent (Nelson D. et al 2012; Schmelcher M. et al. 2012), also known as an “antibiotic”. This has been extensively described in the literature, and lysin has been demonstrated to be a therapeutic agent for the prevention of group A streptococcal infection (Pires, DP et al. 2016) or the control of sepsis caused by Enterococcus faecalis and Enterococcus faecium (Nelson D. et al. 2001), Clostridium perfringens (Yoong P. et al. 2004), group B streptococcal infection (Zimmer M. et al. 2002), and Streptococcus pneumoniae infection (Cheng Q. et al. 2005).

[0007] The advantage of endolysins over traditional antibiotics lies in their high specificity for certain PG types, which typically limits their antimicrobial activity to members of certain bacterial genera, species, or even serotypes. This near-species specificity significantly reduces the risk of developing resistant (symbiotic) strains, which is often associated with the use of broad-spectrum antibiotics, thus allowing for the selective killing of a given target pathogen while the symbiotic bacteria or desired organism in the accompanying microflora remain unaffected (Schmelcher, M. et al. 2012). Another advantage of PG hydrolases is their effectiveness against growing cells, but also against non-dividing or slow-growing cells, such as biofilms.

[0008] In recent years, significant efforts have been made to obtain recombinant lysins with improved properties, making lysin derivatives one of the most promising alternatives against antibiotic-resistant bacteria. These improved properties include increased lytic activity (McCullers JA et al. 2007; Schmelcher M. et al. 2011), an expanded bactericidal spectrum (Díez-Martínez, R. et al. 2015; Becker SC et al. 2009; Yang H. et al. 2015; Yang H. et al. 2016), and the application of lysins against Gram-negative bacteria (Briers Y. & Lavigne 2015; Briers Y. et al. 2014; Wang, S. et al. 2017; Heselpoth, RD et al. 2019; WO2015 / 200783 and WO2017 / 049233).

[0009] Gram-negative bacteria are inherently resistant to many antibiotics due to the permeability barrier provided by their unique cell membrane. This membrane consists of an outer membrane (OM) and an inner membrane (IM), separated by the periplasmic space. The OM is an asymmetric lipid bilayer in which phospholipids are distributed only on the inner lobules, while the lipid A portion of lipopolysaccharide (LPS) forms the outer lobules. The LPS layer of the OM is an important component providing a protective layer against harmful compounds in the extracellular environment. The IM is a conventional phospholipid bilayer. Between the two membranes lies the periplasm, a sticky cellular compartment in which the peptidoglycan layer resides (Masi et al. 2017).

[0010] Treating Gram-negative bacteria with lysins is more challenging because the outer membrane (OM) prevents lysins from reaching the proton pump (PG) from the bacterial exterior. OMs are impermeable to macromolecules and allow only limited diffusion of hydrophobic substances through their LPS-covered surface (Vaara M., 1992). Endolysins are characterized by a modular structure, typically possessing multiple cleavage and / or cell wall-binding domains (CBDs). To render lysins active against Gram-negative bacteria, genetically engineered constructs to facilitate OM translocation have recently been described (Nelson D. et al. 2012; Schmelcher M. et al. 2012).

[0011] One approach involves fusing a PG hydrolase with various cationic, polycationic, or other membrane-disrupting peptides, such as those described in WO / 2010149792 or WO / 2011023702. Another approach involves fusing with a peptide possessing OM permeability. Specifically, Wang, S. et al. (2017) describes an Escherichia coli phage lysin (Lysep3) fused with the D8 domain of Lys1521 from Bacillus amyloliquefaciens phage, which contains two cationic regions (Morita et al. (2001)). Wang, S. et al. (2017) reported that the Lysep3 / D8 fusion protein exhibits lytic activity against both Gram-negative and Gram-positive bacteria. Specifically, the study noted that lysis was observed in 14 strains of *Escherichia coli*, 3 strains of *Pseudomonas aeruginosa*, 1 strain of *Acinetobacter baumannii*, and 1 strain of *Streptococcus*. Therefore, this chimeric endolysin does not exhibit selectivity against Gram-negative bacteria.

[0012] However, despite recent progress, the search for novel lysins with improved properties remains crucial for eradicating MDR bacteria and successfully preventing further resistance development. In particular, there is a ongoing need to identify novel lysins capable of lysing Gram-negative bacteria upon external application, which are non-toxic and specific to a narrow range of closely related pathogens. Antibiotic resistance in *Escherichia coli* is especially concerning among Gram-negative bacteria, as *E. coli* is the most common Gram-negative pathogen in humans. For example, in the 2017 European surveillance, the prevalence of *E. coli* MDR ranged from 12% to 50% (European Centre for Disease Prevention and Control, European Antimicrobial Resistance Surveillance – Annual Report of the European Antimicrobial Resistance Surveillance Network (EARS-Net) 2017, Stockholm: ECDC; 2018).

[0013] In addition, there is a need to find novel recombinant lysins with the required safety, efficacy and selectivity to replace and / or reduce the use of antibiotics in the treatment of Gram-negative bacterial infections (e.g. caused by Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa and / or Acinetobacter species) (e.g., by using lysins in combination with antibiotics). Summary of the Invention

[0014] In one aspect, the present invention provides a novel recombinant endolysin comprising a domain having PG hydrolase activity and a cell permeability domain that increases OM permeability.

[0015] The chimeric protein of this invention exhibits excellent bactericidal efficacy against Gram-negative bacteria, particularly *Escherichia coli*, *Klebsiella pneumoniae*, *Acinetobacter baumannii*, and *Pseudomonas aeruginosa*. The inventors also state that this novel antibiotic enzyme is safe for mammalian cells and exhibits a high degree of selectivity against Gram-negative bacteria, especially *Escherichia coli*, *Klebsiella pneumoniae*, *Acinetobacter baumannii*, and *Pseudomonas aeruginosa* in the chicken microbiota, but does not affect Gram-positive bacteria.

[0016] In in vitro assays using the chimeric protein of the present invention (i.e., IKB206), it can be observed that even at very low concentrations (5 μg / mL)... -1 Under these conditions, the chimeric enzyme significantly reduced the number of *Escherichia coli* ATCC 25922 (a serotype O6 reference strain commonly used for quality control tests within 15 minutes (Minogue et al, 2014)). Figure 3 Furthermore, when the concentration of IKB206 was increased to 15 μg / mL... -1 At this time, it was able to significantly reduce the number of cells within just 5 minutes and kill all cells present in the suspension (5 logs) after 30 minutes of cell incubation. These results were achieved at concentrations as low as 15 μg / mL. -1 This enzyme was obtained at a dosage of [specific value] and without the use of membrane disruptors. Furthermore, this enzyme can be [obtained] at a dosage of 60 μg / mL. -1 At concentrations as low as 15 minutes, it kills all cultures.

[0017] Surprisingly, the efficacy obtained was significantly higher than that described in Wang, S. et al. 2017 (where the fusion of Escherichia coli phage lysin (Lysep3) with the D8 domain of Lys1521 of Bacillus amyloliquefaciens phage (Morita, M. et al. 2001; Orito Y. et al. 2004)).

[0018] In fact, in Wang, S. et al. 2017, at 60 μg mL -1 The protein concentration was measured at 15 μg / mL, whereas in the case of the chimeric protein of the present invention, the concentration was measured at 15 μg / mL. -1 At a concentration of (i.e., one-quarter of the amount), bactericidal effect was observed after only 15 minutes of incubation (reduction of more than 3 logs) (see...). Figure 3(A and B). Furthermore, the chimeric protein of this invention has been shown to kill all cells within a mere 30-minute incubation period, while the protein of Wang, S. et al. only achieved a 1- or 2-log reduction within a 2-hour incubation period. Moreover, Wang, S. et al. failed to demonstrate bactericidal activity against O157:H7 (the most clinically relevant E. coli serotype), while the chimeric lysin of this invention exhibited excellent activity against this serotype. Figure 4 (A and 4B).

[0019] Furthermore, the bactericidal activity of IKB206 against MDR Escherichia coli strains isolated from chickens was determined. It was observed that when used with 15 μg / mL... -1 After incubation with IKB206 for 30 minutes, IKB206 significantly reduced the number of bacteria present in the assay by 2 to 5 logs (to 1 / 100 to 1 / 100,000). Figure 5 ).

[0020] On the other hand, IKB206 exhibited strong bactericidal activity against tested strains of Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa (including antibiotic-resistant strains). Figure 7 and Figure 8 IKB206 at 15 μg mL -1 At concentrations and incubation times of 120 minutes, it showed bactericidal activity against all tested strains. Furthermore, at 150 μg / mL... -1 At a concentration of [specific concentration] and after 120 minutes of incubation, the chimeric protein was able to kill all cells present in the assay.

[0021] It is well known that the composition of the gut microbiota significantly influences human and animal health through a wide range of mechanisms, including immune function control (Hooper, LV et al. 2012), metabolic homeostasis control (Ley, RE et al. 2006, Cani, PD & Delzenne, NM 2009), and metabolic control by pharmaceutical products (Claus, SP et al. 2011). Antimicrobial use is associated with reduced microbiota diversity, which in turn is associated with subsequent metabolic attenuation (Schulfer AF et al. 2018, Le Roy, CI et al. 2019). Therefore, it is important to determine whether antimicrobial drugs affect the host microbiota.

[0022] To determine whether the chimeric protein of the present invention has a bactericidal effect on other bacteria present in the chicken gut microbiota, IKB206 was used for in vitro assays to determine its bactericidal effect on different bacterial species that are part of the chicken gut microbiota. In these assays, it was observed that the studied species that are part of the gut microbiota of farmed chickens were unaffected by IKB206, thus providing a safe treatment for the gut microbiota. Figure 6 ).

[0023] Structural modeling and sequence alignment of the domains indicate that the catalytic domain of IKB206 belongs to T4 lysozyme-like endosin, and residues E15, D24, and T33 form the catalytic triad of the enzyme. Figure 9 ).

[0024] Surprisingly, the inventors discovered that the catalytic domain (SEQ ID NO: 1) itself possesses inherent bactericidal activity against Gram-negative bacteria. In particular, they found that at a concentration of 15 μg / mL... -1 IKB206ΔD8 induced a decrease of approximately 3 log CFU / mL in E. coli strain ATCC 25922 after 60 minutes, and reached a decrease of approximately 5 log CFU / mL at 180 minutes. Figure 10 ).

[0025] Based on the results obtained, a series of in vivo assays were performed in a zebrafish animal model. For example... Figure 11 As shown, IKB206 exhibits protective efficacy against death caused by Escherichia coli ATCC 25922 infection, particularly at 1 μg / g. -1 At the specified dose (survival rate 66.6%).

[0026] In addition, in vitro toxicity studies were conducted on human cells. Figure 12 Protein IKB206 was observed to be non-toxic at the tested concentrations / dosages. These results indicate that the recombinant lysin of the present invention will be safe for use in humans or animals for prophylactic and / or therapeutic treatment of Gram-negative bacterial (e.g., Escherichia coli) infections.

[0027] Finally, the inventors evaluated the potential synergistic effects between the chimeric protein of the present invention and some of the most commonly used antibiotics against MDR E. coli strains, particularly in combination with carbapenem antibiotics. Checkerboard assays showed a synergistic effect between meropenem and imipenem (Tables 3 and 4). Figure 13 A and B). These results were confirmed by bacterial mortality assays of Escherichia coli ATCC 25922 strain. Figure 14 (A and B).

[0028] Therefore, in a first aspect, the present invention relates to a protein comprising or composed of the following:

[0029] a) An amino acid sequence SEQ ID NO: 1 or a variant sequence or fragment having at least 60% identity with it, wherein said variant has conserved amino acid changes, and said variant or fragment has at least 90% of the peptidoglycan hydrolase activity of SEQ ID NO: 1; and

[0030] The protein described therein is not composed of SEQ ID NO: 1.

[0031] In a second aspect, the present invention provides a chimeric protein comprising:

[0032] a) A polypeptide comprising or composed of the following: an amino acid sequence SEQ ID NO: 1 or a variant sequence having at least 60% identity with SEQ ID NO: 1, or a fragment thereof, wherein said variant has conserved amino acid changes, and said variant or fragment is a biologically active polypeptide. In particular, said variant or fragment has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99%, or 100% of the peptidoglycan hydrolase activity of SEQ ID NO: 1; and

[0033] b) A polypeptide comprising or composed of the following: an amino acid sequence SEQ ID NO:2 or a variant sequence having at least 60% identity with SEQ ID NO:2, or a fragment thereof, wherein said variant has conserved amino acid variations, and said variant or fragment is a biologically active polypeptide. In particular, said variant or fragment has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99%, or 100% of the cell permeability of SEQ ID NO:2.

[0034] In a third aspect, the present invention relates to a polynucleotide comprising a nucleic acid molecule encoding a protein (including chimeric proteins) as described herein.

[0035] In a fourth aspect, the invention further relates to a carrier comprising the polynucleotides as described herein.

[0036] In a fifth aspect, the present invention relates to a host cell comprising a vector as described herein.

[0037] In a sixth aspect, the present invention relates to a method for producing the proteins (including chimeric proteins) of the present invention, wherein the method comprises:

[0038] i. Introduce a vector containing the polynucleotides described herein into a suitable host cell;

[0039] ii. Culture host cells under conditions suitable for the expression of the protein;

[0040] iii. Optionally, the protein may be isolated and / or purified.

[0041] In a seventh aspect, the present invention relates to a composition comprising the proteins (including chimeric proteins), polynucleotides, vectors, or host cells described herein.

[0042] In an eighth aspect, the present invention provides proteins (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, vectors or host cells, or pharmaceutical compositions (collectively, "pharmaceuticals according to the invention") as described herein for the preventive and / or therapeutic treatment of bacterial infections caused by Gram-negative bacteria.

[0043] In a ninth aspect, the present invention relates to the use of proteins as described herein (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, vectors, host cells, or pharmaceutical compositions in the preparation of medicaments for the prophylactic and / or therapeutic treatment of bacterial infections caused by Gram-negative bacteria.

[0044] In a tenth aspect, the present invention relates to a method for preventive and / or therapeutic treatment of bacterial infections caused by Gram-negative bacteria, the method comprising administering to a subject diagnosed with a bacterial infection, at risk of bacterial infection, or exhibiting symptoms of a bacterial infection a composition containing an effective amount of a protein as described herein (including a protein consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), a polynucleotide, a vector, or a host cell.

[0045] In an eleventh aspect, the present invention relates to a method for preparing a pharmaceutical composition, the method comprising mixing one or more of a protein according to the invention (including a protein consisting of an amino acid sequence SEQ ID NO: 1, a protein as described herein, and a chimeric protein), a polynucleotide, a carrier, or a host cell with a pharmaceutically acceptable carrier, solvent, or excipient.

[0046] In a twelfth aspect, the present invention relates to a kit comprising, alone or in combination, proteins as defined herein (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, vectors, host cells, or compositions.

[0047] In a thirteenth aspect, the present invention relates to an in vitro method for inhibiting the growth of Gram-negative bacteria or reducing or killing Gram-negative bacterial populations, the method comprising contacting bacteria with proteins as described herein (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, vectors, host cells, or compositions.

[0048] In a fourteenth aspect, the present invention provides proteins described herein (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, or expression vectors or host cells, wherein the proteins or encoded polypeptides have the property of inhibiting the growth of Gram-negative bacteria, reducing Gram-negative bacterial populations, or killing Gram-negative bacteria.

[0049] In a fifteenth aspect, the invention also relates to agents of the invention as described herein (e.g., proteins (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, expression vectors, or host cells), or pharmaceutical compositions comprising the thereof, for methods of treating and / or preventing Gram-negative bacterial infections as described herein, wherein the treatment comprises administration of a combination of the agent of the invention as described herein and another drug.

[0050] The present invention also relates to the use of the pharmaceutical agents of the present invention as described herein in the preparation of medicaments for treating and / or preventing Gram-negative bacterial infections as described herein through combination therapy using the pharmaceutical agents of the present invention as described herein with another medicament, preferably an antibiotic, as described herein.

[0051] The present invention further relates to a method for treating and / or preventing Gram-negative bacterial infections as described herein, the method comprising administering to a patient requiring such treatment a therapeutically effective amount of the agent of the present invention as described herein, and a therapeutically effective amount of another drug, preferably an antibiotic, as described herein.

[0052] In another aspect, the present invention also relates to the use of proteins as described herein (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins) as material disinfectants and / or surface disinfectants in hospitals and private homes. Attached Figure Description

[0053] Figure 1A) The image above is a schematic diagram of IKB206 (SEQ ID NO.3). The numbers indicate the positions of amino acids. The white box corresponds to the phage Arya endosomalin; the black box corresponds to the D8 domain of the phage lysin of Bacillus amyloliquefaciens. The image below shows the amino acid sequence of the chimeric IKB206. The letters in the white box correspond to amino acids of the phage Arya endosomalin, and the letters in the black box correspond to amino acids of the D8 domain of the phage lysin of Bacillus amyloliquefaciens. B) The image above is IKB206. tags A schematic diagram of (SEQ ID NO.5). Numbers indicate the positions of amino acids. Boxes with black and white squares correspond to the S-tag and thrombin cleavage site; white boxes correspond to the Arya phage endosomalin; black boxes correspond to the D8 domain of the Bacillus amyloliquefaciens phage endosomalin; and diagonal boxes correspond to the thrombin cleavage site and His-tag. The following figure shows chimera IKB206. tags The amino acid sequence is shown below. Bold letters correspond to amino acids in the S-tag and His-tag; underlined letters correspond to amino acids at the thrombin cleavage site; letters in white boxes correspond to amino acids in phage Arya endolysin, and letters in black boxes correspond to amino acids in the D8 domain of Bacillus amyloliquefaciens phage lysin. C) The above is a schematic diagram of IKB206ΔD8 (SEQ ID NO: 1). Numbers indicate the position of amino acids. White boxes correspond to phage Arya endolysin. The following is the amino acid sequence of IKB206ΔD8.

[0054] Figure 2 A) Purified IKB206 tags A) 4-12% SDS-polyacrylamide gel electrophoresis, B) purified IKB206, C) IKB206ΔD8.

[0055] Figure 3 :IKB206 tags Bactericidal effect against Escherichia coli strain ATCC 25922. The E. coli culture was resuspended in buffer, and the bacterial suspension was adjusted to 10... 5 Colony forming units (CFU) mL -1 The cultures were incubated at 37°C for 2 hours in the absence of enzyme (with buffer) or in the presence of enzyme. Data are representative of four independent experiments. Viable cells were determined by counting on LB agar plates. A) IKB206 expression in the presence of different enzyme concentrations. tags The CFU mL -1 The reduced bactericidal effect changes over time. B) The expression of IKB206 under different enzyme concentrations. tagsThe change in bactericidal effect that reduces the log number over time. Error bars represent standard errors. An asterisk indicates a significant difference relative to the control (buffer solution) (*P < 0.05; **P < 0.005; ***P < 0.0005), based on: a one-way ANOVA test followed by a Tukey test when the samples show normality and homoscedasticity; and a Kruskal-Wallis test followed by a U-Mann-Whitney test when the samples do not show normality or show heteroscedasticity.

[0056] Figure 4 :IKB206 tags Bactericidal effect against Escherichia coli serotype O157:H7. The E. coli culture was resuspended in buffer solution, and the bacterial suspension was adjusted to 10... 5 CFU mL -1 The cultures were incubated at 37°C for 2 hours in the absence or presence of the enzyme. Data are representative of five independent experiments. Viable cells were determined by counting on LB agar plates. A) In 15 μg mL -1 In the presence of the enzyme, IKB206 is expressed. tags The CFU mL -1 The reduction in bactericidal effect over time. A) At 15 μg mL -1 In the presence of the enzyme, IKB206 is expressed. tags The change in bactericidal effect that reduces the log number over time. Error bars represent standard errors. An asterisk indicates a significant difference relative to the control (buffer solution) (*P < 0.05; **P < 0.005; ***P < 0.0005), based on: a t-test if the samples show normality and homoscedasticity; and a U-Mann-Whitney test if the samples do not show normality or show heteroscedasticity.

[0057] Figure 5 :IKB206 tags Bactericidal effect against multidrug-resistant strains of Escherichia coli. The E. coli culture was resuspended in buffer solution, and the bacterial suspension was adjusted to 10... 5 CFU mL -1 The cultures were incubated at 37°C for 2 hours in the absence or presence of the enzyme. Data are representative of 3 to 5 independent experiments. Viable cells were determined by counting on LB agar plates. (A, C, and E) were cultured in 15 μg mL... -1 In the presence of the enzyme, IKB206 is expressed. tags Reduction of CFU / mL -1 The bactericidal effect changes over time. (B, D, and F) at 15 μg / mL-1 In the presence of the enzyme, IKB206 is expressed. tags The change in the bactericidal effect of reducing the log number over time. Error bars represent standard errors. An asterisk indicates a significant difference relative to the control (buffer solution) (*P < 0.05; **P < 0.005; ***P < 0.0005), based on: a t-test if the samples show normality and homoscedasticity; and a U-Mann-Whitney test if the samples do not show normality or show heteroscedasticity.

[0058] Figure 6 :IKB206 tags Bactericidal effects on different strains of chicken microbiota. The cultures were resuspended in buffer solution, and the bacterial suspension was adjusted to 10... 3 Up to 10 5 CFU mL -1 The cultures were incubated at 37°C for 2 hours in the absence or presence of the enzyme. Data are representative of 4 to 5 independent experiments. Viable cells were determined by counting on LB agar plates. (A, C, E, and G) were cultured in 15 μg mL... -1 In the presence of the enzyme, IKB206 is expressed. tags The CFU mL -1 The reduced bactericidal effect changed over time. (B, D, F, and H) at 15 μg / mL -1 In the presence of the enzyme, IKB206 is expressed. tags The change in bactericidal effect that reduces the log number over time. Error bars represent standard errors. An asterisk indicates a significant difference relative to the control (buffer solution) (*P < 0.05; **P < 0.005; ***P < 0.0005), based on: a t-test if the samples show normality and homoscedasticity; and a U-Mann-Whitney test if the samples do not show normality or show heteroscedasticity.

[0059] Figure 7 IKB206 exhibits bactericidal activity against Enterobacter species other than Escherichia coli. The culture was resuspended in buffer, and the bacterial suspension was adjusted to approximately 10... 4 -10 6 CFU mL -1Cultures were incubated for 2 hours at 30°C (E. cloacae and Serratia marcescens) or 37°C (C. freundii and Klebsiella pneumoniae) in the absence or presence of the enzyme. Data are representative of 2 to 4 independent experiments. Viable cells were determined by counting on LB agar plates. (A, C, E, G, I, K, and M) were cultured in 15 μg mL... -1 Or 150 μg mL -1 In the presence of the enzyme, the expression of IKB206 resulted in CFU / mL -1 The reduction in bactericidal effect over time. (B, D, F, H, J, L, and N) at 15 μg / mL -1 Or 150 μg mL -1 The bactericidal effect of expressed IKB206, which reduces the log number, changes over time in the presence of the enzyme. Error bars represent standard errors. An asterisk indicates a significant difference relative to the control (buffer) (*P < 0.05; **P < 0.005; ***P < 0.0005), based on: a t-test if the samples show normality and homoscedasticity; and a U-Mann-Whitney test if the samples do not show normality or show heteroscedasticity.

[0060] Figure 8 IKB206 exhibits bactericidal activity against other non-Enterobacterial Gram-negative bacterial species. The culture was resuspended in buffer, and the bacterial suspension was adjusted to approximately 10... 5 -10 6 CFU mL -1 The cultures were incubated at 37°C for 2 hours in the absence or presence of the enzyme. Data are representative of four independent experiments. Viable cells were determined by counting on LB agar plates. (A, C, E, and GM) were cultured in 15 μg mL... -1 Or 150 μg / mL -1 In the presence of the enzyme, the expression of IKB206 resulted in CFU / mL -1 The reduced bactericidal effect changed over time. (B, D, F, and H) at 15 μg / mL -1 Or 150 μg mL -1 The bactericidal effect of expressed IKB206, which reduces the log number, changes over time in the presence of the enzyme. Error bars represent standard errors. An asterisk indicates a significant difference relative to the control (buffer) (*P < 0.05; **P < 0.005; ***P < 0.0005), based on: a t-test if the samples show normality and homoscedasticity; and a U-Mann-Whitney test if the samples do not show normality or show heteroscedasticity.

[0061] Figure 9 (A) Structural model of the catalytic domain of IKB206. This model was constructed using the online available server Phyre2 (Kelley LA et al. 2015). Secondary structure elements are represented by light gray cartoons, and the putative catalytic residues are represented by bars. (B) Structural model of the D8 domain of IKB206. This model was constructed using the online available server Swissmodel (Waterhouse A et al. 2018). Secondary structure elements are represented by gray cartoons. The structures (C) and sequence alignments (D) of the catalytic residues of T4 lysozyme (Daopin S et al. 1991), DLP12 endosomin (Babu K et al. 2018), P22 lysozyme (Mooers BH et al. 2006), and AB 5075UW muramicase (Sykilinda NN et al. 2018) (PDB codes 1L48, 4ZPU, 2ANV, and 6ET6, respectively). Catalytic residues overlapping with E15, D24, and T33 of IKB206 are indicated by bars (C) and marked with an asterisk (D).

[0062] Figure 10 The bactericidal effect of IKB206ΔD8 on Escherichia coli strain ATCC 25922 was demonstrated. The E. coli culture was resuspended in buffer, and the bacterial suspension was adjusted to 10... 5 Colony forming units (CFU) mL -1 The cultures were incubated at 37°C for 2 hours in the absence of enzyme (with buffer) or in the presence of enzyme. Data are representative of three independent experiments. Viable cells were determined by counting on LB agar plates. A) The expression of IKB206ΔD8 at CFU / mL was measured in the presence of different enzyme concentrations. -1 B) The change in reduced bactericidal effect over time. The change in the log-reducing bactericidal effect of expressed IKB206ΔD8 over time in the presence of different enzyme concentrations. Error bars represent standard errors. An asterisk indicates a significant difference relative to the control (buffer) (*P < 0.05; **P < 0.005; ***P < 0.0005), based on: a one-way ANOVA followed by a Tukey test when the samples show normality and homoscedasticity; and a Kruskal-Wallis test followed by a U-Mann-Whitney test when the samples do not show normality or show heteroscedasticity.

[0063] Figure 11Survival curves of zebrafish in infection experiments. These lines represent the survival curves of zebrafish infected with different concentrations of IKB206. tags Survival rate of treated or untreated zebrafish. The black line corresponds to the amount of zebrafish treated with 1 μg g. -1 Processed zebrafish, dark gray lines applied to 0.5 μg -1 The zebrafish were treated; the light gray lines correspond to treatment with 0.25 μg g. -1 The zebrafish were treated, and the dashed lines correspond to the untreated zebrafish. Under each condition, 12 zebrafish were infected with 5.5 × 10⁻⁶ zebrafish. 7 CFU mL -1 The Escherichia coli ATCC 25922 was detected. The results were statistically significant when the treated zebrafish were compared with the untreated control (Mantel-Cox test) (P = 0.001).

[0064] Figure 12 Cytotoxicity assay of human HEK293 cells. Analysis was performed on cells ranging from 50 to 400 μg / mL. -1 Cytotoxicity within a concentration range. The cell growth medium was used as a negative control. Data are the mean of three independent experiments and were statistically analyzed using the Tukey test.

[0065] Figure 13 (A)IKB206 tags +Meropenem and (B)IKB206 tags +Imipenem is represented by an isoelectric line diagram. The points below the dashed line representing the MIC were found to be synergistic.

[0066] Figure 14 Synergistic effects of bacterial death studies. (A) Meropenem and IKB206 tags (B) Imipenem and IKB206 tags . Detailed Implementation

[0067] Definitions

[0068] As used herein, a "polynucleotide" or "nucleic acid" sequence refers to a DNA or RNA sequence, preferably a DNA sequence. The sequence referred to in this term includes any known DNA and RNA base analogues, such as, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxymethyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, etc. Purines, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosyl queosine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, methyl uracil-5-hydroxyacetate, uracil-5-hydroxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-mercaptocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-hydroxyacetate, uracil-5-hydroxyacetic acid, pseudouracil, queosine, 2-mercaptocytosine, and 2,6-diaminopurine.

[0069] As used in this article, the term "coding sequence" or "encoding" gene product refers to a nucleic acid molecule that is transcribed (for DNA) and translated (for mRNA) in vitro or in vivo when placed under the control of appropriate regulatory sequences.

[0070] As used in this article, DNA “control sequences” and “control elements” collectively refer to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites (“IRES”), enhancers, etc., which together enable the replication, transcription, and translation of the coding sequence in the recipient cell. All these control sequences / elements do not necessarily need to be present at all times, provided the selected coding sequence can replicate, transcribe, and translate in the appropriate host cell.

[0071] As used herein, “operably linked” refers to an arrangement of elements in which the components described herein are configured to perform their common functions. Therefore, control sequences operably linked to a coding sequence can influence the expression of the coding sequence. Control sequences do not necessarily have to be linked to the coding sequence, as long as they serve to guide the expression of the coding sequence. Thus, for example, there can be an intermediate untranslated but transcribed sequence between the promoter sequence and the coding sequence, and the promoter sequence can still be considered “operably linked” to the coding sequence.

[0072] As used herein, the term "promoter" refers to a region of DNA that initiates transcription of a specific coding sequence. A promoter is located on the same strand of DNA, upstream (towards the 5' region of the sense strand), near the transcription start site of the gene. Promoters can be approximately 100-1000 base pairs long. A "prokaryotic promoter" typically contains two short sequences at positions -10 and -35 upstream of the transcription start site. The sequence at -10 is called the Pribnow box or -10 element and usually consists of six nucleotides, TATAAT. The Pribnow box is absolutely essential for initiating transcription in prokaryotes. The other sequence at -35 (the -35 element), usually consisting of six nucleotides, TTGACA, controls the transcription rate. Bacterial cells contain sigma factors that assist RNA polymerase in binding to the promoter region. Common bacterial promoters include T7 (constitutive, derived from T7 phage), Sp6 (constitutive, derived from Sp6 phage), lac (constitutive in the absence of lac repressor, induced by IPTG or lactose), araBad (induced by arabinose), trp (repressed by tryptophan), and Ptac (regulated like the lac promoter).

[0073] As used herein, the term "amino acid" includes 20 common naturally occurring amino acids, selenocysteine, pyrrolidone, and "non-natural amino acids." As used herein, the term "non-natural amino acid" refers to any other amino acid, modified amino acid, and / or amino acid analogues. Examples of non-natural amino acids include, but are not limited to: p-acetyl-L-phenylalanine, p-iodo-L-phenylalanine, O-methyl-L-tyrosine, p-propynyloxyphenylalanine, p-propynyl-phenylalanine, L-3-(2-naphthyl)alanine, 3-methyl-phenylalanine, O-4-allyl-L-tyrosine, 4-propyl-L-tyrosine, tri-O-acetyl-GlcNAcβ-serine, L-DOPA, fluorinated phenylalanine, isopropyl-L-phenylalanine, and p-azido-L-phenylalanine. Non-natural analogs of acids, p-acyl-L-phenylalanine, p-benzoyl-L-phenylalanine, L-phosphoserine, phosphonylserine, phosphonyltyrosine, p-bromophenylalanine, p-amino-L-phenylalanine, isopropyl-L-phenylalanine, and tyrosine amino acids; non-natural analogs of glutamine amino acids; non-natural analogs of phenylalanine amino acids; non-natural analogs of serine amino acids; non-natural analogs of threonine amino acids; alkyl, aryl, acyl, azide, cyano, halogen, hydrazine, acylhydrazine, and hydroxyl groups. Amino acids substituted with alkenyl, alkynyl, ether, thiol, sulfonyl, selenoyl, ester, thioacid, borate, boronate, phosphate, phosphonyl, phosphine, heterocyclic, enone, imine, aldehyde, hydroxylamine, ketone, or amino groups, or any combination thereof; amino acids with photoactivated crosslinking agents; spin-labeled amino acids; fluorescent amino acids; metal-bound amino acids; metal-containing amino acids; radioactive amino acids; photocage- and / or photoisomerized amino acids; amino acids containing biotin or biotin analogs; amino acids containing ketone groups; amino acids containing polyethylene glycol or polyether; heavily atom-substituted amino acids; chemically cleavable or photocleavable amino acids; amino acids with elongated side chains; amino acids containing toxic groups; sugar-substituted amino acids; amino acids containing carbon-chain sugars; redox-active amino acids; acids containing α-hydroxyl groups; aminothioacids; α,α-disubstituted amino acids; and / or β-amino acids; cyclic amino acids other than proline or histidine; aromatic amino acids other than phenylalanine, tyrosine, or tryptophan, etc.

[0074] As used herein, the terms "peptide linker," "linker," or "spacer region" refer to a spacer region that acts as a hinge region between polypeptide domains, allowing them to move independently of each other while maintaining the three-dimensional form of the individual domains. In this sense, a preferred spacer region is a hinge region characterized by structural extensibility or flexibility that allows such movement. Typically, structurally flexible peptides (i.e., flexible linkers or "flexible connectors") contain two or more amino acids selected from the group consisting of glycine, serine, alanine, and threonine. Preferably, at least 65%, preferably 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the amino acids in the flexible peptide linker are selected from the group consisting of glycine, serine, alanine, and threonine. The spacer peptide may preferably contain repeats of amino acid residues, particularly Gly and Ser, or any other suitable amino acid residue repeats. The length of the spacer region can vary. The preferred range is 2 to 30 amino acids, more preferably 5 to 25, and even more preferably 10 to 20 amino acids.

[0075] As is known in the art, “identity” is the relationship between two or more polypeptide sequences, determined by comparing sequences. “Identity” can be readily calculated using known algorithms well-known in the art. Preferred methods for determining identity aim to provide the maximum match between test sequences. Methods for determining identity are incorporated into publicly available computer programs. The percentage identity between two sequences can be determined using analysis software (i.e., the sequence analysis software package from Genetics Computer Group, Madison, Wisconsin), which incorporates Needelman and Wunsch (J. Mol. Biol., 48; 443-453, 1970) algorithms (e.g., NBLAST and XBLAST).

[0076] Identity can be measured as "local identity" or "global identity." Local identity refers to the degree of sequence correlation between peptides / polynucleotides, determined by matching between such sequence strings. Global identity refers to the degree of sequence correlation between a peptide / polynucleotide and a reference peptide / polynucleotide of full length. Unless otherwise stated, identity as used herein refers to global identity.

[0077] The terms “object” or “individual” are used interchangeably herein and refer to all animals classified as mammals, including but not limited to livestock and farm animals, primates, and humans, such as humans, non-human primates, cattle, horses, pigs, poultry, sheep, goats, dogs, cats, or rodents. Preferably, the object is a male or female human of any age or race.

[0078] The term “treatment” encompasses both preventative and therapeutic treatment. As used herein, the term “therapeutic treatment” or “treatment” refers to restoring the body from a pathological state or disease to its normal, healthy state. As used herein, the term “preventative treatment” refers to preventing a pathological state. Such treatment can be a combination of treatments or therapies. Treatment also refers to reducing morbidity, or alleviating symptoms, eliminating recurrence, preventing recurrence, preventing onset, improving symptoms, improving prognosis, or a combination thereof. “Treatment” also encompasses reducing the population, growth rate, or virulence of bacteria in a subject, thereby controlling or reducing bacterial infection in the subject, or bacterial contamination of an organ or tissue or environment. Thus, “treatment” to reduce morbidity can effectively inhibit the growth of at least one Gram-negative bacterium in a specific context, whether the context is a subject or the environment. On the other hand, “treatment” for an existing infection refers to reducing the population or killing, and even including eradicating, the Gram-negative bacteria that cause the infection or contamination.

[0079] The term "combination therapy" as used throughout this instruction manual is intended to include the administration of the mentioned therapeutic agents to the subject at the same or different times, in the same or different pharmaceutical formulations. If the therapeutic agents are administered at different times, their administration times should be close enough to allow for a combination effect (e.g., enhancement or synergistic response). The specific combination of therapies employed in a combination regimen will take into account the desired therapeutic and / or surgical compatibility and / or the desired therapeutic effect to be achieved. It should be understood that the therapies employed may achieve the desired effect on the same condition, and / or they may achieve different effects (e.g., control of any side effects).

[0080] As used herein, the term "single agent" refers to the use of an active ingredient that is sufficiently separated from another active ingredient in time to prevent enhancement or synergistic effects. More specifically, use as a "single agent" does not cover use as a "combination therapy".

[0081] As used herein, the term "therapeutic effective dose" refers to the amount that is effective in the preventive or therapeutic treatment of a disease, symptom, or pathological condition after administration of a single or multiple doses to a subject (e.g., a human patient).

[0082] In the context of pharmaceuticals, the term "bactericidal" generally refers to having the property of causing bacterial death or the ability to kill bacteria in an initial bacterial population by at least 3 logs (99.9%) or more.

[0083] The term "antibacterial" generally refers to the property of inhibiting bacterial growth, including inhibiting the growth of bacterial cells, thereby causing a reduction of 2 log (99%) or better and at most slightly less than 3 log in the initial bacterial population.

[0084] In the context of pharmaceuticals, the term "antibacterial" is often used to include both bacteriostatic agents and bactericides.

[0085] In the context of pathogens and more specifically bacteria, the term "drug resistance" generally refers to bacteria that are resistant to the antimicrobial activity of drugs. When used more specifically, drug resistance refers specifically to antibiotic resistance. In some cases, bacteria that are normally sensitive to a particular antibiotic can develop resistance to that antibiotic, thus becoming drug-resistant microorganisms or strains. "Multidrug-resistant" pathogens are pathogens that are resistant to at least two classes of antimicrobial drugs, each of which is used as a single therapy. For example, some strains of *E. coli* are able to produce so-called extended-spectrum β-lactamases (ESBLs). ESBLs are enzymes that degrade certain antibiotics, such as penicillins or cephalosporins, so strains that produce these ESBLs are resistant to those antibiotics. Furthermore, ESBL-producing *E. coli* strains resistant to carbapenems, one of the few antibiotics effective against ESBL-producing *E. coli*, have been discovered (https: / / www.cdc.gov / hai / organisms / ESBL.html).

[0086] Those skilled in the art can readily determine whether bacteria are resistant to drugs or antibiotics using standard laboratory techniques for determining bacterial susceptibility or resistance to drugs or antibiotics.

[0087] In the context of antibiotics that are applicable to combat certain bacteria, the term "applicable" means that an antibiotic has been found to be effective against those bacteria, even if resistance subsequently develops.

[0088] Detailed description

[0089] In a first aspect, the present invention relates to a protein comprising:

[0090] a) An amino acid sequence SEQ ID NO: 1 or a variant sequence or fragment having at least 60% identity with it, wherein said variant has conserved amino acid changes, and said variant or fragment has at least 90% of the peptidoglycan hydrolase activity of SEQ ID NO: 1; and

[0091] The protein described therein is not composed of SEQ ID NO: 1.

[0092] This includes, for example, chimeric proteins comprising one or more cell wall-binding domains (CBDs) known in the art. In one specific embodiment, the protein is a chimeric protein of the present invention as described below.

[0093] Preferred features and embodiments relating to proteins including variants of SEQ ID NO: 1 and fragments thereof are described below with respect to the chimeric proteins of the present invention.

[0094] In some embodiments, the protein comprises or is composed of the following:

[0095] a) An amino acid sequence SEQ ID NO: 1 or a variant sequence or fragment having at least 80% identity with it, wherein the variant has conserved amino acid changes, and wherein the variant or fragment has residues corresponding to E15, D24, T33 and R139 of SEQ ID NO: 1, and wherein the variant or fragment has at least 90% of the peptidoglycan hydrolase activity of SEQ ID NO: 1; and wherein the protein is not composed of SEQ ID NO: 1.

[0096] In other embodiments, the protein consists of a variant sequence or fragment having at least 60% identity with SEQ ID NO: 1, wherein the variant has conserved amino acid changes and the variant or fragment has at least 90% of the peptidoglycan hydrolase activity of SEQ ID NO: 1.

[0097] In a second aspect, the present invention relates to a chimeric protein comprising:

[0098] a) A polypeptide comprising or composed of the following: an amino acid sequence SEQ ID NO: 1 or a variant sequence having at least 60% identity with SEQ ID NO: 1, or a fragment thereof, wherein said variant has conserved amino acid changes, and said variant or fragment is a biologically active polypeptide. In particular, said variant or fragment has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99%, or 100% of the peptidoglycan hydrolase activity of SEQ ID NO: 1; and

[0099] b) A polypeptide comprising or composed of the following: an amino acid sequence SEQ ID NO:2 or a variant sequence having at least 60% identity with SEQ ID NO:2, or a fragment thereof, wherein said variant has conserved amino acid variations, and said variant or fragment is a biologically active polypeptide. In particular, said variant or fragment has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99%, or 100% of the cell permeability of SEQ ID NO:2.

[0100] SEQ ID NO: 1 corresponds to the putative endolysin (NCBI reference sequence: YP_009284326.1) of the Enterobacter bacteriophage Arya (NCBI reference sequence NC_031048.1), and consists of the following amino acid sequence:

[0101] 1 mktspngiav tkyfesfear aypdpatggk pytigfgttv ypsgapvrlg dvctkeqaek

[0102] 61 ylqndlakfe kivsdavrvp lnqgqfdalv sftynlgpan lrsstllkkl nagdyagaak

[0103] 121 efprwnrang kvmkgltrrr aaeqclfegm ggasaiergv aaa

[0104] SEQ ID NO: 1 exhibits peptidoglycan (PG) hydrolase activity, as determined by turbidity assay. More specifically, it corresponds to lysozyme based on sequence homology.

[0105] Those skilled in the art will know how to determine the presence of PG hydrolase activity. For example, PG hydrolase activity can be determined by zymography or by turbidity assays based on enzyme activity in Micrococcus lysodeikticus cells (Santin and Cascales, 2017). For illustrative purposes, see the turbidity assay protocol described in the examples. Additionally, there are fluorescent assays where PG is fluorescently labeled and can only be detected after the enzyme has acted (Invitrogen). (Lysozyme assay kit). However, these assays only indicate PG hydrolase activity. More precise methods, such as reversed-phase high-performance liquid chromatography coupled with mass spectrometry (Santin and Cascales, 2017), are needed to determine the cleavage site. In certain embodiments, the variant or fragment of SEQ ID NO: 1 has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99%, or 100% of the PG hydrolase activity of SEQ ID NO: 1.

[0106] SEQ ID NO: 2 corresponds to the cell permeability domain (D8) of the lysin Lys1521 (D1) of Bacillus amyloliquefaciens phage (GenBank: AAK40280.1) (Morita, M. et al. 2001), and consists of the following amino acid sequence:

[0107] 143 nsgtpknv srgtsstktt pkykvkngdn ltkiakkhnt

[0108] 181 tvatllklnp gikdpnmirv gqtlnvtgsg gkthkvksgd tlskiavdnk ttvsklmnln

[0109] 241 peitnpnhik vgqtirls

[0110] The polypeptide having the amino acid sequence SEQ ID NO: 2 was previously described as having cell permeation activity (Orito et al. 2004).

[0111] Previously, it has been reported that helical-forming amphiphilic peptides containing basic amino acid residues appear to interact with negatively charged membrane elements, namely LPS in Gram-negative bacteria (Düring, K., et al. 1999). Morita et al. (Morita et al. 2001) reported that, based on predicted secondary structures, there are two helical peptides at the C-terminus of the endolysin: one present in the D9 region (aa 171-177 of D1, corresponding to aa 29-35 of SEQ ID No: 2) and another present in the D10 region (aa 212-216 of D1, corresponding to aa 70-74 of SEQ ID No: 2), suggesting that these peptides may bind to LPS in Pseudomonas aeruginosa PAO1 strain. Furthermore, the inventors found that the structural model of the D8 cell permeability domain (SEQ ID NO: 2) shows structural similarity to the LysM domain of the putative endopeptidase of Terminus thermofilus (Wong JE et al. 2015), see Example 7. The LysM domain in bacterial proteins is typically a repeating entity known to interact with substrates containing N-acetylglucosamine, such as peptidoglycan. Therefore, without being bound by theory, this data suggests that D8 may be involved in binding to enzyme substrates.

[0112] Those skilled in the art will know how to determine the presence of outer membrane permeability. For example, the ability of endosomalin to permeate the outer membrane of Gram-negative bacteria can be assessed by examining the release of periplasmic β-lactamases from *Pseudomonas aeruginosa* PAO1 after treating the cells of the bacteria with the enzyme to be studied, as described in Orito et al., 2004, and which is repeated below for illustrative purposes.

[0113] Dilute 500 μl of overnight culture of Pseudomonas aeruginosa PAO1 with 30 ml of preheated (37°C) LB medium and incubate at 37°C with shaking (150 rpm) for 2 hours. Add 0.25 mg of [the solution / container name missing] -1After imipenem induces β-lactamase production, the culture is incubated with shaking for 3 hours and harvested by centrifugation at 5000g for 10 minutes at room temperature. The cell pellet is washed once with PBS and then resuspended in PBS to a final volume of 10 ml. Endolysin is added at 40 μg / ml. -1 and 200μg ml -1 The final concentration was added to the cell suspension (25 μl) (total volume, 50 μl). The mixture was incubated at 37 °C for 10 min, then centrifuged in an Eppendorf tube at 15000 g for 30 min at room temperature. Control experimental conditions were performed using the supernatant of sonicated *Pseudomonas aeruginosa* PAO1 cells. The supernatant was collected, and β-lactamase activity was determined using 100 μM chromogenic cephalosporin (CENTA) as a substrate. CENTA hydrolysis was monitored by continuously recording absorbance at 405 nm. β-lactamase release (percentage) was defined as the ratio of β-lactamase activity under control conditions to β-lactamase activity under test conditions.

[0114] In a particular embodiment, the variant or fragment of SEQ ID NO: 2 has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99%, or 100% of the cell permeability of SEQ ID NO: 2.

[0115] In some embodiments, the chimeric protein comprises or is composed of the following:

[0116] a) A polypeptide containing the amino acid sequence SEQ ID NO: 1 or consisting of the amino acid sequence SEQ ID NO: 1; and

[0117] b) Contains an amino acid sequence SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence SEQ ID NO: 2.

[0118] The polypeptide in (b) can be directly fused in tandem or fused to the C-terminus of the polypeptide in (a) via a peptide linker. Preferably, the polypeptide in (b) is directly fused to the C-terminus of the polypeptide in (a).

[0119] In a preferred embodiment, the chimeric protein has antibacterial or bactericidal activity against Gram-negative bacteria as defined herein, preferably bactericidal activity against Gram-negative bacteria.

[0120] In some embodiments, the chimeric protein comprises or consists of the following: an amino acid sequence SEQ ID NO:3 (which corresponds to SEQ ID NO:2 directly fused to the C-terminus of SEQ ID NO:1) or a variant sequence having at least 60% identity with it, or a fragment of either, wherein the variant has conserved amino acid variations, and wherein the variant or fragment is biologically active. In particular, the variant or fragment has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99%, or 100% of the antibacterial or bactericidal activity against Gram-negative bacteria of SEQ ID NO:3.

[0121] The inventors have demonstrated that the chimeric proteins described herein are highly effective in inhibiting growth, reducing population size, or killing Gram-negative bacteria, particularly those in the spp. *Acinetobacter* (e.g., *Acinetobacter baumannii*), *Pseudomonas* (*Pseudomonas aeruginosa*), *Escherichia* (e.g., *Escherichia coli*), and *Klebsiella* (e.g., *Klebsiella pneumoniae*) (see Examples 4 and 6). Assays for analyzing the bactericidal activity of compounds are well known in the art and described, for example, by Loessner et al. (Loessner, M.J et al. 2002) and Schmelcher et al. (Schmelcher, M. et al. 2010). For example, to quantify the bactericidal effect of an antimicrobial agent, incubation is performed at 37°C, for example at 600 nm, in the presence of the agent within the test dose range. 600 Bacterial suspensions with an absorbance of 0.3 at a specific temperature were used. Samples were collected at different time points, serially diluted, and inoculated into plates containing culture medium to determine viable bacteria. Bactericidal activity was quantified as the reduction in log₂ number (log₂) after a given incubation time in the presence of the treatment. 10 (N0 / N i In the case of each treatment, N0 = CFU / mL before treatment. -1 Number, N i = CFU mL after the corresponding incubation time -1 The bacterial suspension can be incubated with an antimicrobial agent in a culture medium or buffer solution (e.g., PBS or another water-based salt solution). Specific assays for determining the bactericidal activity of IKB206 are described in the examples.

[0122] In a preferred embodiment, the antibacterial or bactericidal effect is achieved in an in vitro assay after incubation with bacteria for 120 minutes, preferably 90 minutes, more preferably 60 minutes, even more preferably 30 minutes, 15 minutes, for example 10 minutes or less, including 9, 8, 7, 6, 5, 4, 3, 2 or 1 minute; wherein the initial concentration of Gram-negative bacteria (e.g., Escherichia coli) in the bacterial culture corresponds to A 600 The absorbance level is 0.3. It can be determined, for example, using a Spectrostar nanospectrophotometer (BMGlabtech).

[0123] Similarly, in the preferred embodiment, the antibacterial or bactericidal effect is achieved at levels below 60 μg / mL. -1 55 μg mL is preferred -1 50 μg mL -1 45μg mL -1 40μg mL -1 35μg mL -1 30μg mL -1 25μg mL -1 20μg mL -1 15μg mL -1 10 μg mL -1 9μg mL -1 8μg mL -1 7μg mL -1 6μg mL -1 or 5μg mL -1 The chimeric protein concentration of the present invention was achieved in an in vitro assay; wherein the initial concentration of Gram-negative bacteria (e.g., Escherichia coli) in the bacterial culture corresponds to A. 600 The absorbance level is 0.3. It can be determined, for example, using a Spectrostar nanospectrophotometer (BMG Labtech).

[0124] This antibacterial or bactericidal effect is preferably a bactericidal effect. In a preferred embodiment, the bactericidal effect is to reduce the initial bacterial population by at least 4 log, preferably by at least 5 log, at least 6 log, at least 7 log, or better.

[0125] In a more preferred embodiment, the bactericidal effect is achieved at 15 μg / mL. -1 The concentration was determined in vitro after incubation with bacteria for 30 minutes, more preferably 15 minutes; wherein the initial concentration of Gram-negative bacteria (e.g., Escherichia coli) in the bacterial culture corresponds to A. 600 The absorbance level is 0.3. It can be determined, for example, using a Spectrostar nanospectrophotometer (BMGlabtech).

[0126] In another preferred embodiment, the bactericidal effect is achieved at 15 μg / mL. -1 The concentration is achieved in in vitro assays after incubation with bacteria for 10 minutes, more preferably 5 minutes, or even more preferably 4, 3, 2, or 1 minute; wherein the initial concentration of Gram-negative bacteria (e.g., Escherichia coli) in the bacterial culture corresponds to an A600 of 0.3. The absorbance level can be determined, for example, using a Spectrostar nanospectrophotometer (BMG Labtech).

[0127] In some embodiments, the polypeptide having at least 60% identity preferably has at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 87%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or most preferably at least 99% identity with the corresponding sequence.

[0128] In obtaining variant bioactive peptides and their respective coding sequences, those skilled in the art will recognize that peptides can be modified by certain amino acid substitutions, additions, deletions, and post-translational modifications without loss or reduction of biological activity. In particular, it is well known that conserved amino acid substitutions—that is, replacing one amino acid with another of similar size, charge, polarity, and conformation—are unlikely to significantly alter protein function. The 20 standard amino acids that make up proteins can be broadly classified into four groups of conserved amino acids: the nonpolar (hydrophobic) group includes alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, and valine; the polar (uncharged, neutral) group includes asparagine, cysteine, glutamine, glycine, serine, threonine, and tyrosine; the positively charged (basic) group includes arginine, histidine, and lysine; and the negatively charged (acidic) group includes aspartic acid and glutamic acid. Replacing one amino acid in a protein with another from the same group is unlikely to adversely affect the protein's biological activity.

[0129] Generally, the preparation of the chimeric proteins of this invention can be accomplished using the procedures disclosed herein and recognized recombinant DNA techniques, including, for example, polymerase chain reaction (PCR), plasmid DNA preparation, DNA digestion with restriction endonucleases, oligonucleotide preparation, DNA ligation, mRNA isolation, DNA introduction into suitable cells, host transformation or transfection, and host culture. Furthermore, the fusion molecules can be separated and purified using centrifugal agents and well-known electrophoresis, centrifugation, and chromatography methods. See Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd edition, 1989); and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York (1989) for disclosures related to these methods.

[0130] The proteins or peptides of the present invention can be prepared having one or more amino acid substitutions, deletions, or additions compared to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. These changes are preferably minor, i.e., conserved amino acid substitutions and other changes that do not significantly affect the folding or activity of the protein or peptide, and include N-terminal or C-terminal extensions, such as N-terminal methionine residues, small linker peptides of up to about 20-25 residues, or may include tags to facilitate modification, recognition, and / or purification of the fusion protein. Two or more tags can be used in combination (e.g., affinity tags that facilitate purification). Peptides containing affinity tags may further include peptide linkers and / or proteolytic cleavage sites between the peptide and the affinity tag.

[0131] As discussed in Example 7, the inventors investigated the mechanism of action of the chimeric protein of the present invention. Structural modeling of the catalytic domain revealed an overall folding similar to that of T4 lysozyme and other T4 lysozyme-like endosomals (e.g., P22 phage lysozyme (MooersBH et al. 2006) or endosomal encoded by *E. coli* DLP12 prophage (Babu K et al. 2018)). Based on sequence alignment (… Figure 9 The structural models of D) and IKB206 overlap with the crystal structures of these endosomalins. Figure 9 (C) The inventors proposed that the catalytic domain of IKB206 belongs to T4 lysozyme-like endosomalin, and that residues E15, D24, and T33 form a catalytic triplet of the enzyme. Furthermore, they believe that R139 can form a salt bridge with E15.

[0132] In some embodiments, the variants of SEQ ID NO:1 or SEQ ID NO:3 are characterized by conserved amino acid changes, and the residues corresponding to E15, D24, and T33 of SEQ ID NO:1 or SEQ ID NO:3, respectively, are maintained in the variants or fragments. In some embodiments, the amino acid changes are conserved, and the residues corresponding to positions 12 to 35, or even positions 12 to 54, of SEQ ID NO:1 or SEQ ID NO:3 remain unchanged. Furthermore, in some embodiments, with any of the foregoing combinations, the amino acid corresponding to R139 of SEQ ID NO:1 or SEQ ID NO:3 remains unchanged, for example, the residues corresponding to E15, D24, T33, and R139 remain unmodified.

[0133] In some embodiments, variants of SEQ ID NO: 2 are characterized by conserved amino acid changes, and the amino acids corresponding to positions 29-35 and 70-74 of SEQ ID NO: 2 are maintained in the variant or fragment.

[0134] In one specific embodiment, the present invention relates to a chimeric protein comprising:

[0135] a) A polypeptide comprising an amino acid sequence SEQ ID NO: 1 or a variant sequence or fragment having at least 80% identity with it, wherein the variant is characterized by conserved amino acid changes, and wherein the variant or fragment has residues corresponding to E15, D24, T33, and R139 of SEQ ID NO: 1, and preferably has at least 90% of the peptidoglycan hydrolase activity of SEQ ID NO: 1; and

[0136] b) A polypeptide comprising an amino acid sequence SEQ ID NO:2 or a variant sequence or fragment having at least 80% identity with it, wherein the variant is characterized by having conserved amino acid changes, and wherein the variant or fragment has residues corresponding to positions 29-35 and 70-74 of SEQ ID NO:2, and preferably has at least 90% of the cell permeability of SEQ ID NO:2.

[0137] The polypeptide described in (b) is directly fused to or fused to the C-terminus of the polypeptide described in (a) via a peptide linker.

[0138] In another embodiment, the present invention relates to a chimeric protein comprising or composed of the following: an amino acid sequence SEQ ID NO:3 or a variant sequence or fragment having at least 80% identity with it, wherein the variant is characterized by having conserved amino acid changes, and wherein the variant or fragment has residues corresponding to E15, D24, T33 and R139 of SEQ ID NO:3, and preferably has at least 90% of the antibacterial or bactericidal activity of SEQ ID NO:3 against Gram-negative bacteria.

[0139] Proteins or peptides may contain specific affinity purification tags. Illustrative, non-limiting examples of affinity tags include glutathione S-transferase (GST), maltose E-binding protein, protein A, FLAG tags, hexahistidine, myc tags, or influenza HA tags. These affinity purification tags may be directly tandemly fused, or, alternatively, fused to the peptide via a cleavable linker (i.e., a peptide containing an amino acid sequence that can be specifically cleaved by enzymatic or chemical means (i.e., a recognition / cleavage site)). When an affinity tag is directly fused, it links the reading frame of the target peptide with the reading frame of the gene encoding the affinity tag, resulting in a translational fusion. In one embodiment, the cleavable adapter comprises an amino acid sequence that can be cleaved by a protease, such as enterokinase, Arg-C endopeptide, Glu-C endopeptide, Lys-C endopeptide, factor Xa, furin-like proprotein convertase, thrombin, etc. Alternatively, in another embodiment, the cleavable adapter comprises an amino acid sequence that can be cleaved by a chemical reagent, such as cyanogen bromide cleaving methionine residues or any other suitable chemical reagent. The cleavable adapter is useful if subsequent removal of the affinity purification tag is required.

[0140] In some embodiments, the chimeric protein of the present invention further includes a recognition / cleavage site downstream of peptide (b). In one specific embodiment, the cleavage site is a thrombin cleavage site (e.g., amino acid sequence SEQ ID NO: 4).

[0141] In some preferred embodiments, the chimeric protein of the present invention comprises or is composed of a polypeptide with the amino acid sequence SEQ ID NO: 5. The chimeric protein composed of the amino acid sequence SEQ ID NO: 5 is the result of the fusion of SEQ ID NO: 1 and SEQ ID NO: 2, wherein SEQ ID NO: 2 is directly fused to the C-terminus of SEQ ID NO: 1 (SEQ ID NO: 3), and further cloned and expressed in the pET29b+ vector. This protein is characterized by further presenting an S-tag at the N-terminus and a 6-His tag at the C-terminus; and further including a thrombin cleavage site (SEQ ID NO: 4) and three additional amino acids (to improve thrombin cleavage efficiency) at both ends between the tag and SEQ ID NO: 3, thereby producing a chimeric protein with 329 amino acids, referred to as IKB206tags. For illustrative and non-limiting purposes, Figure 1 (A and B) provide illustrations of IKB206 and IKB206tags.

[0142] In a further embodiment, optionally in combination with one or more embodiments and features described herein, the chimeric protein of the present invention may comprise an additional peptide (e.g., a polycationic peptide) having OM permeability or destabilizing properties. In a preferred embodiment, it does not comprise another peptide (e.g., a polycationic peptide) having OM permeability or destabilizing properties.

[0143] In yet another embodiment, optionally in combination with one or more of the embodiments and features described herein, the chimeric protein of the present invention may include additional domains having antimicrobial activity. In a preferred embodiment, it does not include additional domains having antimicrobial activity.

[0144] In some embodiments, the chimeric protein of the present invention can be chemically modified. Chemical modification includes, but is not limited to, adding chemical moieties, forming new bonds, and removing chemical moieties. Chemical modification can occur anywhere on the polypeptide, including amino acid side chains and amino or carboxyl termini. Such modification can be present at more than one site on the polypeptide. Furthermore, one or more side groups or terminal groups of the polypeptide can be protected with protecting groups known to those skilled in the art.

[0145] Furthermore, in some embodiments, the chimeric protein of the present invention may include a linker of a duration-enhancing portion. A non-limiting example of a duration-enhancing portion is polyethylene glycol (PEG). PEG has been used in the art to obtain therapeutic peptides with prolonged duration of action (Zalipsky, S., Bioconjugate Chemistry, 6:150-165 (1995); Mehvar, R., J. Pharm. Pharmaceut. Set, 3:125-136 (2000)). PEG backbone [(CH2CH2—O—) n [n: the number of repeating monomers] is flexible and amphiphilic. When linked to another chemical entity, such as the chimeric protein of this invention, the PEG polymer chain can protect the polypeptide from immune responses and other clearance mechanisms. Therefore, PEGylation can improve efficacy and safety by optimizing pharmacokinetics, increasing bioavailability, reducing immunogenicity, and adjusting dosage and / or frequency.

[0146] The proteins (including chimeric proteins) of this invention can be used alone or in combination with permeabilizers or disruptors of Gram-negative bacterial outer membranes, including but not limited to metal chelators such as EDTA, TRIS, lactic acid, lactoferrin, polymyxin, and citric acid (Vaara M. Microbiol Rev. 56(3):395-441(1992)). These permeabilizers can be part of the same or different compositions. In a preferred embodiment, the proteins (including chimeric proteins) are used without a permeabilizer.

[0147] In a third aspect, the present invention relates to a polynucleotide comprising a nucleic acid molecule encoding a protein (including chimeric proteins) as described herein.

[0148] In some embodiments, the polynucleotide comprises:

[0149] a) A nucleic acid sequence comprising or consisting of: SEQ ID NO: 6 or a variant sequence having at least 70% identity with it, or a fragment thereof, wherein the variant sequence or fragment encodes a bioactive polypeptide.

[0150] SEQ ID NO: 6

[0151] atgaaaacctctccaaatggtatcgccgttaccaagtacttcgaatcatttgaagcccgcgcataccctgaccccgccactggcggtaaaccatacacgattggcttcggaaccactgtcta cccgtctggcgcacccgtccgtttaggggatgtgtgtacgaaagaacaggccgagaaatatttacaaaatgacttggcgaaattcgagaagattgtatctgacgcagtgcgcgttcccctta atcaaggtcagtttgacgcgttagtgtcatttacgtataacttaggacccgccaatttgcgcagcagtaccctgttaaaaaagttgaacgctggggactatgcgggggccgctaaagagttt ccgcgttggaaccgtgcaaacggtaaagtgatgaaaggtttgacacgtcgccgcgcggcagaacaatgtttgtttgaagggatgggaggcgcgagcgcgattgaacgtggtgtagccgctgca

[0152] In other embodiments, the polynucleotide comprises:

[0153] a) A nucleic acid sequence comprising or consisting of: SEQ ID NO: 6 or a variant sequence having at least 70% identity with it, or a fragment thereof, wherein the variant sequence or fragment encodes a bioactive polypeptide; and

[0154] b) A nucleic acid sequence comprising or consisting of: SEQ ID NO: 7 or a variant sequence having at least 70% identity with it, or a fragment thereof, wherein the variant sequence or fragment encodes a bioactive polypeptide.

[0155] SEQ ID NO: 7

[0156] aacagtgggaccaaagaatgtttcccgcggaacctcgtccacgaagacaacacctaagtataaggtaaaaaatggtgacaacttaactaaaatcgcgaagaaacataatactacagtagcgacattgctgaaacttaatccagggatcaaagaccccaacatgattcgtgta gggcagactttaaatgttacagggtccggtgggaaaactcataaagtcaagtcgggtgacacactgagtaaaaatcgcagttgataataagacgactgttagcaagttgatgaatcttaacccggaaatcactaatcctaaccatatcaaagtcggccagacaatccgtttgagc.

[0157] In a preferred embodiment, the polynucleotide comprises:

[0158] a) A nucleic acid sequence comprising or consisting of: SEQ ID NO: 6 or a variant sequence having at least 70% identity with it, or a fragment thereof, wherein the nucleic acid sequence encodes SEQ ID NO: 1 or a variant or fragment thereof as defined herein; and

[0159] b) A nucleic acid sequence comprising or consisting of: SEQ ID NO: 7 or a variant sequence having at least 70% identity with it, or a fragment thereof, wherein the nucleic acid sequence encodes SEQ ID NO: 2 or a variant or fragment thereof as defined herein.

[0160] In a further embodiment, the polynucleotide comprises or consists of the following: SEQ ID NO: 8 or a variant sequence having at least 70% identity with it, or a fragment of either, wherein the variant sequence or fragment encodes a bioactive polypeptide.

[0161] SEQ ID NO: 8>

[0162] atgaaaacctctccaaatggtatcgccgttaccaagtacttcgaatcatttgaagcccgcgcataccctgaccccgccactggcggtaaaccatacacgattgg cttcggaaccactgtctacccgtctggcgcacccgtccgtttaggggatgtgtgtacgaaagaacaggccgagaaatatttacaaaatgacttggcgaaattcga gaagattgtatctgacgcagtgcgcgttccccttaatcaaggtcagtttgacgcgttagtgtcatttacgtataacttaggacccgccaatttgcgcagcagta ccctgttaaaaaagttgaacgctggggactatgcgggggccgctaaagagtttccgcgttggaaccgtgcaaacggtaaagtgatgaaaggtttgacacgtcgcc gcgcggcagaacaatgtttgtttgaagggatgggaggcgcgagcgcgattgaacgtggtgtagccgctgcaaacagtgggacaccaaagaatgtttcccgcgga acctcgtccacgaagacaacacctaagtataaggtaaaaaatggtgacaacttaactaaaatcgcgaagaaacataatactacagtagcgacattgctgaaactt aatccagggatcaaagaccccaacatgattcgtgtagggcagactttaaatgttacagggtccggtgggaaaactcataaagtcaagtcgggtgacacactgagt aaaatcgcagttgataataagacgactgttagcaagttgatgaatcttaacccggaaatcactaatcctaaccatatcaaagtcggccagacaatccgtttgagc

[0163] In a preferred embodiment, the polynucleotide comprises or consists of the following: SEQ ID NO: 8 or a variant sequence having at least 70% identity with it, or a fragment of either, wherein the nucleic acid sequence encodes SEQ ID NO: 3 or a variant or fragment thereof as defined herein.

[0164] In yet another embodiment, the polynucleotide comprises or consists of the following: SEQ ID NO: 9 or a variant sequence having at least 70% identity with it, or a fragment of either, wherein the sequence encodes a bioactive polypeptide.

[0165] SEQ ID NO: 9

[0166] atgaaagaaaccgctgctgctaaattcgaacgccagcacatggacagcccagatctgggtaccctggtgccacgcggttccatggcgatatcggatccgatgaaaacctctccaaatggtatcgccgttaccaagtacttcgaatcatttgaagcccgcgcataccctgaccccgccactggcggtaaaccatacacgattggcttcggaaccactgtctacccgtctggcgcacccgtccgtttaggggatgtgtgtacgaaagaacaggccgagaaatatttacaaaatgacttggcgaaattcgagaagattgtatctgacgcagtgcgcgttccccttaatcaaggtcagtttgacgcgttagtgtcatttacgtataacttaggacccgccaatttgcgcagcagtaccctgttaaaaaagttgaacgctggggactatgcgggggccgctaaagagtttccgcgttggaaccgtgcaaacggtaaagtgatgaaaggtttgacacgtcgccgcgcggcagaacaatgtttgtttgaagggatgggaggcgcgagcgcgattgaacgtggtgtagccgctgcaaacagtgggacaccaaagaatgtttcccgcggaacctcgtccacgaagacaacacctaagtataaggtaaaaaatggtgacaacttaactaaaatcgcgaagaaacataatactacagtagcgacattgctgaaacttaatccagggatcaaagaccccaacatgattcgtgtagggcagactttaaatgttacagggtccggtgggaaaactcataaagtcaagtcgggtgacacactgagtaaaatcgcagttgataataagacgactgttagcaagttgatgaatcttaacccggaaatcactaatcctaaccatatcaaagtcggccagacaatccgtttgagcctgggtaccctggtgccacgcggttccctcgagcaccaccaccaccaccac

[0167] In a preferred embodiment, the polynucleotide comprises or consists of the following: SEQ ID NO: 9 or a variant sequence having at least 70% identity with it, or a fragment of either, wherein the nucleic acid sequence encodes SEQ ID NO: 5 or a variant or fragment thereof as defined herein.

[0168] Preferably, the nucleic acid sequence having at least 70% identity has 75%, at least 80%, at least 85%, at least 87%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or most preferably at least 99% identity with SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9, respectively.

[0169] In some embodiments, the polynucleotide comprises the aforementioned nucleic acid sequences (a) and (b), preferably selected from SEQ ID NO: 8 and SEQ ID NO: 9; or sequences having at least 70% identity with them, wherein the sequences encode a bioactive polypeptide, and the polynucleotide is operatively linked to a control sequence. Preferably, the polynucleotide is operatively linked to at least one promoter, preferably to a prokaryotic promoter, i.e., a prokaryotic promoter that enables the inserted coding sequence to be expressed in prokaryotic cells, such as bacterial cells. In one specific embodiment, the polynucleotide is a vector.

[0170] In a fourth aspect, the invention further relates to a vector comprising polynucleotides as described herein. "Vector" refers to any genetic element capable of replicating and transporting gene sequences between cells when associated with appropriate control elements, such as plasmids, bacteriophages, hybrid vectors, transposons, granules, chromosomes, viruses, viral particles, etc. Sequences encoding peptides described herein can be inserted into vectors capable of delivering and maintaining nucleic acid molecules within bacterial cells. Polynucleotides can be inserted into autonomously replicating vectors. Vectors can be bacterial vectors such as pET29b+, pGEM3Z, and pcDNA3 and their derivatives; or bacteriophage DNA vectors, such as bacteriophage λ or M13 and their derivatives. Preferably, the vector is a bacterial plasmid. The plasmid can be an extrachromosomal plasmid or an integrative plasmid, preferably an extrachromosomal plasmid.

[0171] In addition to encoding nucleic acid molecules, the expression vector also includes elements that allow expression, such as promoters and regulatory sequences. The expression vector may contain transcriptional control sequences that control transcription initiation, such as promoters, enhancers, operons, and repressor sequences. The respective transcriptional control sequences are well known to those skilled in the art. The expression vector may also include translational regulatory sequences (e.g., untranslated 5' sequences, untranslated 3' sequences). The vector may be capable of autonomous replication, or it may integrate into the host DNA to ensure stability during peptide production.

[0172] Expression vectors containing inducible promoters typically contain an operon sequence. Operon sequences that can be used are well-known in the art and include lac, gal, deo, gin, raf, rha, araC, fru, and mel. One or more fully palindromic operon sequences can be used. In some embodiments, the operon sequence overlaps with the transcription start site. It should be recognized that operon systems are typically used in conjunction with appropriate repressor sequences. The repressor sequence produces a repressor protein, such as the lacl gene sequence when using the lac operon. Other lac repressor sequences can also be used, such as the laclq sequence, to increase the level of the lac repressor protein. The repressor sequence can also be provided from the host cell genome or by using additional compatible plasmids.

[0173] Expression can be induced by adding inducers such as isopropyl-β-D-1-thiogalactopyranoside (IPTG), IPTG analogs such as isobutyl-C-galactopyranoside (IBCG), lactose, or melibiose. Other inducers can be used and are described more comprehensively elsewhere (e.g., see The Operon, eds. Miller and Renznikoff (1978)). Inducers can be used alone or in combination. The construction of suitable plasmids or expression vectors is readily apparent to scientists with general technical skills.

[0174] After constructing a vector containing the nucleic acid described herein, it can be used to transform host cells. Transfection can be performed using any available technique. For bacterial cells, suitable techniques may include heat shock, calcium chloride transformation, electroporation, and phage transfection.

[0175] In a fifth aspect, the present invention relates to host cells comprising a vector as described herein. Preferably, the host cell is a prokaryotic host cell. Examples of prokaryotic cells include bacterial cells, such as Gram-negative bacterial cells including *Escherichia coli*, *Salmonella typhimurium*, *Serratia marsescens*, *Pseudomonas putida*, and *Pseudomonas aeruginosa*, and Gram-positive bacterial cells including *Bacillus subtilis*. Preferred host cells are bacteria, particularly those of the Enterobacteriaceae family, preferably *Escherichia coli*, including strains B or K12 of *Escherichia coli*. Most preferably, the host cell is *Escherichia coli* BL21(DE3).

[0176] Nucleic acids are introduced into cells, which can then induce or allow expression from the nucleic acids, for example, by entering the host cell under conditions suitable for polynucleotide expression. Typically, cells are cultured in a cell culture medium under appropriate temperature and atmospheric conditions (e.g., 37°C). Depending on the host cell, this medium can be a “microbial medium,” which refers to any substrate suitable for the growth and reproduction of microorganisms such as bacteria or fungi. The most common growth media for microorganisms are nutrient broth (liquid nutrient medium) or LB medium (lysogen broth). Liquid media are typically mixed with agar and poured into petri dishes using a sterile dispenser to solidify. Those skilled in the art will understand that the term “microbial medium” encompasses solid plate media, as well as semi-solid and liquid microbial growth systems.

[0177] In a sixth aspect, the present invention relates to a method for producing the proteins (including chimeric proteins) of the present invention, wherein the method comprises:

[0178] i. Introduce a vector containing the polynucleotides described herein into a suitable host cell;

[0179] ii. Culture host cells under conditions suitable for the expression of the protein;

[0180] iii. Optionally, the protein may be isolated and / or purified.

[0181] Those skilled in the art will know the most suitable culture conditions for the host cell. Examples of host cells and their culture methods have already been provided above.

[0182] Methods for peptide isolation and / or purification are well known in the art (see, for example, Isolation and Purification of Proteins, CRC Publication, February 5, 2003, ISBN 9780824707262). The peptide purification procedure initially depends on the protein's expression site. Some proteins are secreted into cell culture media; others are intracellular proteins. In the latter case, the first step of the purification process involves cell lysis, which can be accomplished by various methods, including mechanical shearing, osmotic shock, or enzymatic treatment. Optionally, cell debris is removed by differential centrifugation or filtration.

[0183] After obtaining a clear solution containing the target peptide, a combination of different chromatographic techniques is typically used to attempt to separate the target peptide from other proteins produced by the cell. These techniques separate protein mixtures based on their charge, degree of hydrophobicity, or size. Several different chromatographic resins can be used for each of these techniques, allowing for precise customization of the purification protocol according to the specific protein involved. Affinity chromatography, which utilizes specific interactions between the protein to be purified and the immobilized trap, can also be an option for some peptides. For example, affinity chromatography can be used to purify proteins that contain tags, as described herein. In other embodiments, when the protein does not contain a tag, cation exchange chromatography can be used, preferably followed by size exclusion chromatography.

[0184] The proteins (including chimeric proteins) of the present invention can also be produced in protein expression systems other than bacteria, including baculovirus expression systems using Drosophila Sf9 cells, yeast or filamentous fungal expression systems, and mammalian cell expression systems.

[0185] Furthermore, the proteins (including chimeric proteins) and peptides described herein can be synthesized using an automated peptide synthesizer via solid-phase methods. For example, peptides can be synthesized on Cyc(4-CH2Bxl)-OCH2-4-(oxymethyl)-phenylacetamide methyl resin using a dual-coupling procedure. Peptides can also be synthesized by many other methods, including solid-phase synthesis using conventional FMOC protection (i.e., coupling with DCC-HOBt and deprotection with piperidine in DMF).

[0186] In a seventh aspect, the present invention relates to a composition comprising the proteins (including chimeric proteins), polynucleotides, vectors, or host cells described herein.

[0187] Appropriate amounts of proteins (including chimeric proteins), polynucleotides, vectors, or host cells as described herein can be formulated with pharmaceutically acceptable excipients, solvents, and / or carriers to obtain a pharmaceutical composition. Preferably, the pharmaceutical composition comprises proteins (including chimeric proteins), polynucleotides, or expression vectors as described herein.

[0188] The phrase "pharmaceutically acceptable" means a molecular entity and composition that does not produce adverse, allergic, or other adverse reactions when administered to animals or humans. As used herein, "pharmaceutically acceptable excipients, solvents, and / or carriers" include solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, and absorption delay agents that are acceptable for use in the formulation of pharmaceuticals (e.g., pharmaceuticals suitable for administration to humans). The use of such media and agents for pharmaceutically active substances is well known in the art. Their use in therapeutic compositions is contemplated unless any conventional media or agent is incompatible with the active ingredient of this disclosure. Complementary active ingredients may also be incorporated into the composition, provided they do not inactivate the pharmaceutical agents of the present invention, such as the chimeric proteins of the present invention.

[0189] In an eighth aspect, the present invention provides proteins (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, vectors or host cells, or pharmaceutical compositions (collectively, "pharmaceuticals according to the invention") as described herein for the preventive and / or therapeutic treatment of bacterial infections caused by Gram-negative bacteria.

[0190] In a ninth aspect, the present invention relates to the use of proteins as described herein (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, vectors, host cells, or pharmaceutical compositions in the preparation of medicaments for the prophylactic and / or therapeutic treatment of bacterial infections caused by Gram-negative bacteria.

[0191] In a tenth aspect, the present invention relates to a method for the preventive and / or therapeutic treatment of bacterial infections caused by Gram-negative bacteria, the method comprising administering to a subject diagnosed with a bacterial infection, at risk of bacterial infection, or exhibiting symptoms of a bacterial infection a composition containing an effective amount of a protein as described herein (including a protein consisting of the amino acid sequence SEQ ID NO: 1, a protein as described herein, and a chimeric protein), a polynucleotide, a vector, or a host cell. Preferably, the effective amount is a protein as described herein (including a protein consisting of the amino acid sequence SEQ ID NO: 1, a protein as described herein, and a chimeric protein).

[0192] In a preferred embodiment, the infection is caused by intestinal Gram-negative bacteria, preferably selected from the group consisting of: Acinetobacter, Bacteroides, Campylobacter, Fusobacterium, Haemophilus, Helicobacter, Mobiluncus, Porphyromonas, Prevotella, Pseudomonas, and Veillonella, as well as bacteria of the family Enterobacteriaceae (also referred to herein as Enterobacteriaceae). Some illustrative but non-limiting examples of Enterobacteriaceae include Citrobacter, Enterobacter, Escherichia, Klebsiella, Proteus, Salmonella, Serratia, Shigella, and Yersinia.

[0193] In specific embodiments, the Gram-negative bacteria are selected from the group consisting of: *Acinetobacter*, *Pseudomonas*, *Escherichia*, *Klebsiella*, *Serratia*, and *Citrobacter*, preferably from the group consisting of *Acinetobacter*, *Pseudomonas*, *Escherichia*, and *Klebsiella*. In preferred embodiments, the Gram-negative bacteria are selected from the group consisting of: *Escherichia coli*, *Klebsiella pneumoniae*, *Acinetobacter baumannii*, *Pseudomonas aeruginosa*, *Serratia marcescens*, and *Citrobacter freundii*, preferably from the group consisting of *Escherichia coli*, *Klebsiella pneumoniae*, *Acinetobacter baumannii*, and *Pseudomonas aeruginosa*. In some embodiments, the Gram-negative bacteria are drug-resistant strains, including multidrug-resistant (MDR) strains.

[0194] In the 2019 European surveillance conducted by EARS-Net, the most frequently reported bacterial species was *Escherichia coli* (44.2%), followed by *Staphylococcus aureus* (20.6%), *Klebsiella pneumoniae* (11.3%), *Enterococcus faecalis* (6.8%), *Pseudomonas aeruginosa* (5.6%), *Streptococcus pneumoniae* (5.3%), *Enterococcus faecium* (4.5%), and *Acinetobacter* spp. (1.7%) (European Centre for Disease Prevention and Control, EU / EEA (EARS-Net) Antimicrobial Resistance - 2019 Epidemiological Annual Report, Stockholm: ECDC; 2020). This surveillance study observed that in 2019, more than half of the reported *Escherichia coli* isolates and more than one-third of the reported *Klebsiella pneumoniae* isolates were resistant to at least one monitored antimicrobial group, and frequently exhibited combined resistance to several antimicrobial groups. Carbapenem resistance is common in Pseudomonas aeruginosa and Acinetobacter species, and its percentage is higher than that in Klebsiella pneumoniae.

[0195] In some embodiments, the Gram-negative bacteria belong to the Enterobacteriaceae family. In a preferred embodiment, the infection is caused by *Escherichia coli*. The *E. coli* strain is not particularly limited to any serotype; exemplary examples include *E. coli* bacteria from serotypes O1 (e.g., O1A), O2, O6 (e.g., O6A), O25 (e.g., O25B), or O157, which are serotypes frequently involved in urinary tract infections (Huttner and Gambillara 2018). In a preferred embodiment, the *E. coli* strain belongs to serotype O6 (e.g., *E. coli* ATCC 25922) or serotype O157 (e.g., *E. coli* O157:H7). In some embodiments, the *E. coli* strain is a drug-resistant strain, including multidrug-resistant (MDR) strains.

[0196] These MDR strains can be resistant to one, two, three, four, five, six, seven or more antibiotics, such as sulfonamides (e.g., sulfamethoxazole and trimethoprim-sulfamethoxazole), penicillins (e.g., ticarcillin, ticarcillin-clavulanic acid, piperacillin, piperacillin-tazobactam, amoxicillin, amoxicillin-clavulanic acid), cephalosporins (e.g., ceftazidime, cefepime, cefoperazone), monocyclic lactams (e.g., aztreonam), lincosamides (e.g., lincomycin), fluoroquinolones (e.g., ciprofloxacin, levofloxacin, norfloxacin), carbapenems (e.g., imipenem, meropenem, ertapenem, doripenem), aminoglycosides (e.g., gentamicin, tobramycin, amikacin), and polymyxins (e.g., colistin, polymyxin B). For example, the MDR strain is resistant to one or more (including all) of the antibiotics selected from the list of the following: sulfonamides, penicillins, lincosamides, fluoroquinolones, aminoglycosides, and tetracyclines. Preferably, the MDR strain is resistant to one or more (including all) of the antibiotics selected from the list of the following: sulfonamides, amoxicillin, lincosamides, etc. (Lincomycin + Spectinomycin), Enrofloxacin, Neomycin and Doxycycline (see Table 1 and the MDR E. coli strains in Example 4).

[0197] In one embodiment, the Gram-negative bacterium is *Escherichia coli* and is resistant to one or more of sulfonamides, amoxicillin, lincomycin, lincospectin, enrofloxacin, neomycin, and doxycycline. In another embodiment, the Gram-negative bacterium is *Klebsiella pneumoniae* and is resistant to one or more of β-lactams (e.g., carbapenems), fluoroquinolones, and trimethoprim / sulfamethoxazole.

[0198] In a further embodiment, the Gram-negative bacterium is Acinetobacter baumannii and is resistant to one or more of aminoglycosides and trimethoprim / sulfamethoxazole.

[0199] In yet another embodiment, the Gram-negative bacterium is Pseudomonas aeruginosa and is resistant to β-lactams.

[0200] Infections caused by Gram-negative bacteria can occur in any organ or tissue of the subject. In specific embodiments, infections caused by Gram-negative bacteria occur in the blood, gastrointestinal tract, heart, cardiovascular system, liver, lungs, respiratory tract, kidneys, urinary tract, central nervous system, skin, subcutaneous tissue, or surgical wounds. In a preferred embodiment, infections caused by Gram-negative bacteria (e.g., one or more of the genera or species described above, preferably *Escherichia coli* strains) occur in the urinary tract. In another preferred embodiment, the infection occurs in the blood.

[0201] The Gram-negative bacteria causing the infection to be treated can be human or animal pathogens or strains. In some embodiments, the Gram-negative bacteria are human pathogens or strains. In other embodiments, the Gram-negative bacteria are animal pathogens or strains, such as avian or non-human mammal pathogens or strains.

[0202] Compositions comprising the proteins described herein (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, vectors, or host cells, preferably proteins (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), can be delivered to the subject via a variety of routes, including but not limited to topical (e.g., topical, rectal, ocular, etc.) or systemic administration. Systemic delivery may include oral or parenteral (e.g., intravenous, subcutaneous, intramuscular, and intraperitoneal) administration. Additionally, compositions comprising the pharmaceutical agents of the present invention may be administered intranasally or sublingually, allowing for systemic administration via a non-invasive method. Furthermore, intraventricular administration may be appropriate. Preferred routes of delivery are intravascular (e.g., intra-arterial or intravenous) or subcutaneous injection. In specific embodiments, the pharmaceutical agents used according to the present invention are administered subcutaneously or intravenously to the subject. Those skilled in the art are familiar with the principles and procedures discussed in well-known and available resources, such as Remington's Pharmaceutical Science (17th edition, Mack Publishing Co., Easton, Pa., 1985) and Goodman and Gilman's The Pharmaceutical Basis of Therapeutics (8th edition, Pergamon Press, Elmsford, NY, 1990), both of which are incorporated herein by reference.

[0203] The pharmaceutical preparations of the present invention can be formulated into neutral or salt forms. Pharmaceutically acceptable salts include: those salts formed with a free amino group (e.g., those salts derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc.); and those salts formed with a free carboxyl group, such as those salts derived from sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, iron hydroxide, isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine, or the like.

[0204] Solid dosage forms for oral administration may include conventional capsules, sustained-release capsules, conventional tablets, sustained-release tablets, chewable tablets, sublingual tablets, effervescent tablets, pills, suspensions, powders, granules, and gels. Formulations may include standard carriers such as pharmaceutical-grade mannitol, lactose, starch, magnesium stearate, sodium glycosides, cellulose, magnesium carbonate, etc. In normal practice, such dosage forms may also contain substances other than inert diluents, such as dispersants and / or granulators, surfactants and / or emulsifiers, disintegrants, binders, preservatives, buffers, lubricants, and / or oils. In the case of capsules, tablets, effervescent tablets, and pills, the dosage form may also contain buffers. Tablets and pills may be formulated with an enteric coating.

[0205] Exemplary diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, powdered sugar, and combinations thereof.

[0206] Exemplary granulating agents and / or dispersants include, but are not limited to, potato starch, corn starch, cassava starch, sodium carboxyacetic acid starch, clay, alginic acid, guar gum, citrus pomace, agar, bentonite, cellulose and wood products, natural sponges, cation exchange resins, calcium carbonate, silicates, sodium carbonate, crospovidone, sodium carboxymethyl starch (sodium carboxyacetic acid starch), carboxymethyl cellulose, crospovidone carboxymethyl cellulose (crospovidone carboxymethyl cellulose), methyl cellulose, pregelatinized starch (starch 1500), microcrystalline starch, water-insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (Veegum), sodium lauryl sulfate, quaternary ammonium compounds and combinations thereof.

[0207] Exemplary surfactants and / or emulsifiers include, but are not limited to, natural emulsifiers (e.g., gum arabic, agar, alginic acid, sodium alginate, astragalus gum, chondrux, cholesterol, xanthan gum, pectin, gelatin, egg yolk, casein, lanolin, cholesterol, waxes, and lecithin), colloidal clays (e.g., bentonite [aluminum silicate] and Veegum [magnesium aluminum silicate]), long-chain amino acid derivatives, high molecular weight alcohols (e.g., stearyl alcohol, cetyl alcohol, oleyl alcohol, glyceryl triacetate monostearate, glycol distearate, glyceryl monostearate and propylene monostearate, polyvinyl alcohol), and carbomers (e.g., carboxylated polymethylene, polyacrylic acid, acrylic polymers, and carboxyvinyl groups). Polymers), carrageenan, cellulose derivatives (e.g., sodium carboxymethyl cellulose, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, methyl cellulose), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monolaurate [Tween 20], polyoxyethylene sorbitan [Tween 60], polyoxyethylene sorbitan monooleate [Tween 80], sorbitan monopalmitate [Span 40], sorbitan monostearate [Span 60], sorbitan tristearate [Span 65], glyceryl monooleate, sorbitan monooleate [Span 80]), polyoxyethylene esters (e.g., polyoxyethylene monostearate [Myrj 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and Solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g., Cremophor), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [Brij 30]), poly(vinylpyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl lauryl ether, sodium lauryl sulfate, Pluronic F 68, Poloxamer 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, sodium docusate, and / or combinations thereof.

[0208] Exemplary adhesives include, but are not limited to, starches (e.g., corn starch and starch paste); gelatin; sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); natural and synthetic gums (e.g., gum arabic, sodium alginate, Irish moss extract, panwar gum, ghatti gum, mucilage of isapol husks, carboxymethyl cellulose, methyl cellulose, ethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, microcrystalline cellulose, cellulose acetate, polyvinylpyrrolidone), veegum magnesium aluminum silicate, and larch arabinogalactan; alginates; polyethylene oxide; polyethylene glycol; inorganic calcium salts; silicic acid; polymethyl methacrylate; waxes; water; alcohols; and combinations thereof.

[0209] Exemplary preservatives may include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives. Exemplary antioxidants include, but are not limited to, α-tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite. Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA), citrate monohydrate, disodium edetate, dipotassium edetate, edetate, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and trisodium edetate. Exemplary antimicrobial preservatives include, but are not limited to, benzalkonium chloride, benzyl alcohol, bromonitrile glycol, cetrimonium bromide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethanol, glycerin, hexoterine, imidazoline, phenol, phenoxyethanol, phenethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal. Exemplary antifungal preservatives include, but are not limited to, butylparaben, methylparaben, ethylparaben, propylparaben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid. Exemplary alcoholic preservatives include, but are not limited to, ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoic acid esters, and phenethyl alcohol. Exemplary acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid. Other preservatives include, but are not limited to, tocopherol, tocopherol acetate, deferoxamine mesylate, cetrimonium bromide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, Glydant Plus, phenonip, methylparaben, Germall 115, Germaben II, Neolone, Kathon, and Euxyl. In some embodiments, the preservative is an antioxidant. In other embodiments, the preservative is a chelating agent.

[0210] Exemplary buffers include, but are not limited to, citrate buffer solutions, acetate buffer solutions, phosphate buffer solutions, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium gluconate, calcium gluconate, calcium gluconate, D-gluconic acid, calcium glycerophosphate, calcium lactate, propionic acid, calcium acetopropionate, valeric acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, basic calcium phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixture, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, potassium phosphate mixture, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, disodium hydrogen phosphate, sodium dihydrogen phosphate, sodium phosphate mixture, tromethamine, magnesium hydroxide, aluminum hydroxide, alginate, pyrogen-free raw water, isotonic saline, Ringer's solution, ethanol, and combinations thereof.

[0211] Exemplary lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behenate, hydrogenated vegetable oil, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and combinations thereof.

[0212] Exemplary oils include, but are not limited to, almond oil, avocado oil, babassu oil, bergamot oil, blackcurrant seed oil, borage oil, juniper oil, chamomile oil, canola oil, caraway oil, carnation oil, Brazil palm oil, castor oil, cinnamon oil, cocoa butter, coconut oil, cod liver oil, coffee oil, corn oil, cottonseed oil, emu oil, eucalyptus oil, evening primrose oil, fish oil, flaxseed oil, geraniol oil, gourd oil, grapeseed oil, hazelnut oil, hyssop oil, isopropyl myristate oil, jojoba oil, macadamia nut oil, and bright lavender. Oils, including lavender oil, lemon oil, litsea cubeba oil, macadamia nut oil, mallow oil, mango seed oil, meadowfoam seed oil, mink oil, nutmeg oil, olive oil, orange oil, orange salmon oil, palm oil, palm kernel oil, peach kernel oil, peanut oil, poppy seed oil, pumpkin seed oil, rapeseed oil, rice bran oil, rosemary oil, safflower oil, sandalwood oil, camellia oil, peppermint oil, sea buckthorn oil, sesame oil, shea butter, silicone oil, soybean oil, sunflower oil, tea tree oil, thistle oil, Japanese camellia oil, vetiver oil, walnut oil, and wheat germ oil. Exemplary oils include, but are not limited to, butyl stearate, caprylic / capric triglyceride, caprylic / capric triglyceride, cyclomethicone, diethyl sebate, dimethicone 360, isopropyl myristate, mineral oil, octyl dodecyl alcohol, oleyl alcohol, silicone oils, and combinations thereof.

[0213] Liquid dosage forms for oral administration may include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs containing inert diluents commonly used in this technology, such as water. Those compositions may also contain adjuvants, such as wetting agents, emulsifiers, and suspending agents, as well as sweeteners, flavoring agents, and aromatizers.

[0214] Various delivery systems are known in the art, including those encapsulated in liposomes, microbubbles, emulsions, microparticles, microcapsules, etc.

[0215] Injectable formulations, such as aqueous or oil suspensions, can be formulated using suitable dispersants, wetting agents, and / or suspending agents according to known techniques. Among acceptable solvents and media, water, Ringer's solution, and isotonic sodium chloride solution can be used. Sterile oils are also commonly used as solvents or suspension media.

[0216] Typically, compositions intended for intravenous, intramuscular, subcutaneous, intraperitoneal, or intraventricular administration are sterile isotonic buffers. In some embodiments, the composition may contain a small amount of wetting agent or emulsifier, or a pH buffer. Illustrative, non-limiting examples of pH buffers include Tris-HCl buffer, acetate buffer, citrate and phosphate buffer, or combinations thereof. As used herein, the terms “acetate buffer,” “citrate buffer,” and “phosphate buffer” may refer to a buffer system comprising an organic acid (acetic acid, citric acid, and phosphate, respectively) and its salts. Each of these may be added in sufficient quantities. The pH of the compositions according to the invention may range from about 4 to about 8, preferably from about 5 to about 7, including pH 5, pH 5.5, pH 6, pH 6.5, and pH 7.

[0217] If necessary, compositions containing the pharmaceutical agents of the present invention may also contain solubilizers and local anesthetics to alleviate any pain at the injection site. Typically, these components are provided individually or in mixtures in unit dosage forms (e.g., as dry lyophilized powder or anhydrous concentrate in a sealed container (such as an ampoule or sachet) indicating the amount of active agent). When the composition is administered by infusion, it can be dispensed using an infusion bottle containing sterile pharmaceutical-grade water or saline. When the composition is administered by injection, ampoules of sterile water for injection or saline can be provided to allow mixing of the components prior to administration.

[0218] The effective amount of the agent of the present invention can vary over a wide range and is typically determined by the specific environment of the application, the duration of exposure, and other considerations. In specific embodiments, the dosage range is from 0.01 mg / kg to 20 mg / kg, preferably from 0.05 mg / kg to 10 mg / kg, for example from 0.1 mg / kg to 5 mg / kg, or from 1 mg / kg to 2 mg / kg.

[0219] In an eleventh aspect, the present invention relates to a method for preparing a pharmaceutical composition, the method comprising mixing one or more of a protein according to the invention (including a protein consisting of an amino acid sequence SEQ ID NO: 1, a protein as described herein, and a chimeric protein), a polynucleotide, a carrier, or a host cell with a pharmaceutically acceptable carrier, solvent, or excipient.

[0220] In a twelfth aspect, the present invention relates to a kit comprising, alone or in combination, proteins as defined herein (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, vectors, host cells, or compositions. Reagents, tools, and / or instructions for performing the methods described herein may be provided in the kit. For example, the kit may contain reagents, tools, and instructions for prophylactic and / or therapeutic treatment of infections caused by Gram-negative bacteria or for performing in vitro methods to inhibit the growth of Gram-negative bacteria, or to reduce or kill Gram-negative bacterial populations. For example, the Gram-negative bacteria are one or more of the genera or species described above.

[0221] In a thirteenth aspect, the present invention relates to an in vitro method for inhibiting the growth of Gram-negative bacteria or reducing or killing Gram-negative bacterial populations, the method comprising contacting bacteria with proteins as described herein (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, vectors, host cells, or compositions. Preferably, the proteins as described herein (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins, and chimeric proteins). For example, the Gram-negative bacteria are one or more of the genera or species described above. In a preferred embodiment, the Gram-negative bacteria are Enterobacteriaceae as described above, and preferably, the Gram-negative bacteria are Klebsiella pneumoniae or Escherichia coli. In other preferred embodiments, the Gram-negative bacteria are one or more selected from the group consisting of Acinetobacter, Pseudomonas, Escherichia, and Klebsiella, preferably one or more selected from the group consisting of Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa.

[0222] In a fourteenth aspect, the present invention provides proteins (including proteins, proteins, and chimeric proteins composed of the amino acid sequence SEQ ID NO: 1), polynucleotides, expression vectors, or host cells as described herein, wherein the proteins (including proteins, proteins, and chimeric proteins as described herein, composed of the amino acid sequence SEQ ID NO: 1) or encoded polypeptides have the property of inhibiting the growth of Gram-negative bacteria, reducing Gram-negative bacterial populations, or killing Gram-negative bacteria. For example, the Gram-negative bacteria are one or more of the genera or species described above. In a preferred embodiment, the Gram-negative bacteria are Enterobacteriaceae as described above, preferably Klebsiella pneumoniae or Escherichia coli. In other preferred embodiments, the Gram-negative bacteria are one or more selected from the group consisting of Acinetobacter, Pseudomonas, Escherichia, and Klebsiella, preferably one or more selected from the group consisting of Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa.

[0223] The agents of the present invention (e.g., proteins (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, expression vectors, or host cells) can be used alone or in combination with a permeabilizing agent for the outer membrane of Gram-negative bacteria, including but not limited to metal chelating agents such as EDTA, TRIS, lactic acid, lactoferrin, polymyxin, and citric acid (Vaara M. 1992). This can be part of the same or different compositions. In a preferred embodiment, the agents of the present invention are not used in combination with a permeabilizing agent.

[0224] Proteins (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, vectors, host cells, or pharmaceutical compositions used in the treatment methods described herein may be used alone (i.e., as a single agent) or in combination with one or more therapeutic agents, including preservatives, lanolin antibiotics, bacteriocins, other endosomalins, or antibiotics.

[0225] Preservatives include, but are not limited to, Daquin solution, sodium or potassium hypochlorite solution, sodium benzyl sulfonate solution, certain iodine preparations (such as povidone-iodine), peroxides (such as urea perhydrate solution) and pH-buffered peracetic acid solution, alcohols with or without preservative additives, weak organic acids (such as sorbic acid, benzoic acid, lactic acid and salicylic acid), some phenolic compounds (such as hexachlorophenol, triclosan and dibromophenol), and cationic active compounds (such as benzalkonium chloride, chlorhexidine, methylisothiazolidinone, α-terpineol, thymol, chloroxylenol and oxytinidin solution).

[0226] In a fifteenth aspect, the invention also relates to agents of the invention as described herein (e.g., proteins (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, expression vectors, or host cells), or pharmaceutical compositions comprising the thereof, for methods of treating and / or preventing Gram-negative bacterial infections as described herein, wherein said treatment comprises administration of an agent of the invention as described herein in combination with another drug. Each agent may be administered as a single agent or in combination therapy at a dosage and / or schedule typically used for that agent. Dosage and administration regimens for the chimeric proteins of the invention have been described herein.

[0227] In a specific embodiment, the administration of the pharmaceutical agent of the present invention as described herein is simultaneous with the administration of other drugs as part of the same or different compositions. In another specific embodiment, the administration of the pharmaceutical agent of the present invention as described herein is sequential with the administration of the other drugs (before or after them).

[0228] In a preferred embodiment, the other drugs are antibiotics. Conventional antibiotics used against Gram-negative bacteria in this invention include, but are not limited to: sulfonamides (such as sulfamethoxazole and trimethoprim-sulfamethoxazole), penicillins (such as ticarcillin, piperacillin, amoxicillin, including ureacin [such as azlocillin, piperacillin, meropenem]), cephalosporins (such as ceftazidime, cefepime, cefoperazone)), monocyclic lactams (such as aztreonam), lincosamides (such as lincomycin), fluoroquinolones (such as ciprofloxacin, levofloxacin, norfloxacin), carbapenems (such as imipenem, meropenem, ertapenem, doripenem), aminoglycosides (such as gentamicin, tobramycin, amikacin), and polymyxins (such as colistin, polymyxin B).

[0229] The present invention also relates to the use of the pharmaceutical agents of the present invention as described herein in the preparation of medicaments for treating and / or preventing Gram-negative bacterial infections as described herein through combination therapy using the pharmaceutical agents of the present invention as described herein with another medicament, preferably an antibiotic, as described herein.

[0230] The present invention further relates to a method for treating and / or preventing Gram-negative bacterial infections as described herein, the method comprising administering to a patient requiring such treatment a therapeutically effective amount of the agent of the present invention as described herein, and a therapeutically effective amount of another drug, preferably an antibiotic, as described herein.

[0231] In a preferred embodiment, the combination is a synergistic combination. As described in Example 10, synergistic effects have been found between the proteins of the present invention (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins) and carbapenem antibiotics (preferably selected from the group consisting of imipenem and meropenem). Therefore, in a particularly preferred embodiment, the chimeric protein of the present invention is used as a combination therapy with carbapenem antibiotics.

[0232] In another aspect, the present invention also relates to the use of proteins as described herein (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins) or compositions comprising them as material disinfectants and / or surface disinfectants in hospitals and private homes. These materials and / or surfaces include, but are not limited to, medical devices such as joint replacements and other types of orthopedic devices, artificial heart valves, pacemakers, implantable defibrillators, urinary catheters and stents, peritoneal dialysis catheters, intravascular catheters, cerebrospinal fluid shunts, breast implants, vascular grafts, and stents. The compositions may comprise the proteins of the present invention (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), and optionally also comprise other disinfectants and / or surfactants.

[0233] It is anticipated that any feature described herein may be optionally combined with any embodiment of the present invention, including proteins (including proteins consisting of the amino acid sequence SEQ ID NO: 1, proteins as described herein, and chimeric proteins), polynucleotides, vectors, host cells, compositions, kits, any use, medical use, treatment methods, methods of manufacturing pharmaceuticals, and combination therapies; and any embodiment discussed in this specification may be practiced in any of these aspects. It should be understood that the specific embodiments described herein are shown as illustrative rather than as limiting the invention.

[0234] All publications and patent applications herein are incorporated by reference as if each individual publication or patent application were specifically and individually incorporated by reference.

[0235] The use of “a” or “an” can refer to “one”, but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more.” The term “another” can also refer to one or more. Unless it is explicitly stated that it refers only to alternatives or that the alternatives are mutually exclusive, the term “or” used in the claims is used to mean “and / or.”

[0236] As used herein, the terms “comprising” (and any form of inclusion, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of inclusion, such as “include” and “includes”), or “containing” (and any form of inclusion, such as “contain” and “contains”) are inclusive or open-ended and do not exclude additional, unmentioned elements or method steps. The term “comprising” also covers and explicitly discloses the terms “consisting of” and “substantially consisting of”. As used herein, the phrase “substantially consisting of” limits the scope of the claim to specific materials or steps that do not materially affect the essential and novel features of the claimed invention. As used herein, the phrase “consisting of” excludes any element, step, or component not specified in the claim, except for impurities typically associated with that element or limitation.

[0237] As used herein, the term "or a combination thereof" refers to all permutations and combinations of the items listed preceding the term. For example, "A, B, C, or a combination thereof" is intended to include at least one of the following: A, B, C, AB, AC, BC, or ABC, and if the order is important in the particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, what is explicitly included are repeated combinations containing one or more items or terms, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so on. Those skilled in the art will understand that, unless otherwise apparent from the context, there is generally no limit to the number of items or terms in any combination.

[0238] As used herein, approximations such as, but not limited to, “about,” “approximately,” and “around” refer to a situation where, when modified in this way, it is understood to be not necessarily absolute or extremely accurate, but will be considered sufficiently close to a person skilled in the art to ensure that such a situation is specified as existing. The extent to which the description can vary will depend on how much change can be made, and such that a person skilled in the art still recognizes that the modified feature still possesses the characteristics and capabilities required for the unmodified feature. Generally, but based on the foregoing discussion, numerical values ​​modified herein by approximations such as “about” can differ from the stated value by ±1%, ±2%, ±3%, ±4%, ±5%, ±6%, ±7%, ±8%, ±9%, or ±10%. Thus, the term “about” can refer to an indicated value ±5% of its value, preferably an indicated value ±2% of its value, and most preferably, the term “about” refers to an exact indicated value (±0%).

[0239] The following examples are for illustrative purposes only and should not be construed as limiting the scope of the invention.

[0240] Example

[0241] The measurements disclosed in the following examples were performed using the following materials and methods.

[0242] Bacterial strains and culture media

[0243] Table 1 details the bacterial strains and culture media used.

[0244] All solutions and culture media used were sterilized by moist heat in an autoclave at 120°C and 1 atmosphere, or by filtration through a sterile Millipore filter with a diameter of 0.2 μm.

[0245] Antibiotics are prepared from concentrated aqueous solutions. These solutions are sterilized by filtration and stored at -20°C.

[0246] Table 1. Bacteria and Culture Media

[0247]

[0248] a Multidrug-resistant isolates obtained from diseased chickens in poultry farms. 93568 is resistant to sulfonamides, amoxicillin, lincomycin, lincomycin, enrofloxacin, neomycin, and doxycycline; 93729 is resistant to sulfonamides, amoxicillin, lincomycin, enrofloxacin, neomycin, and doxycycline; 93449 is resistant to amoxicillin, lincomycin, lincomycin, enrofloxacin, neomycin, and doxycycline; and 94657 is resistant to sulfonamides, amoxicillin, lincomycin, lincomycin, neomycin, and doxycycline.

[0249] b It exhibits resistance to β-lactams.

[0250] c It exhibits resistance to β-lactams, fluoroquinolones, and trimethoprim / sulfamethoxazole.

[0251] d It exhibits resistance to carbapenems. e It exhibits resistance to aminoglycosides and trimethoprim / sulfamethoxazole.

[0252] f It exhibits resistance to β-lactams.

[0253] Construction, expression and purification of IKB206 and IKB206 variants

[0254] IKB206 is the result of a fusion of the putative endosomalin (SEQ ID NO: 1) (protein ID: YP_009284326.1) of the Enterobacterial bacteriophage Arya (NCBI accession number NC_031048.1) and the putative cell wall binding domain (D8) (Morita 2001) (SEQ ID NO: 2) of the endosomalin of Bacillus amyloliquefaciens (accession number AAK40280.1). Two IKB206 constructs were designed and used... The DNA fragment encoding the IKB206 chimera was cloned into the expression plasmid pET29b(+). For the first IKB206 construct, the DNA fragment encoding the IKB206 chimera was cloned into the plasmid, thereby removing the sequences encoding the two tags (S-tag and His-tag) from the plasmid. For the second IKB206 construct, the sequences corresponding to the tags were not removed, and thrombin cleavage sites and 3 amino acids were added to the resulting fusion to improve thrombin cleavage efficiency. For illustrative and non-limiting purposes, Figure 1 The diagram provided is a schematic of the chimeric solvent.

[0255] Furthermore, following the same strategy as with the untagged IKB206, the putative endosin from phage Arya was cloned separately into plasmid pET29b(+). This construct was named IKB206ΔD8.

[0256] The three recombinant plasmids IKB206 were transformed into competent Escherichia coli BL21(DE3) (Invitrogen, Carlsbad, CA, USA).

[0257] For those with the tag (IKB206) tags Overexpression of ) was used to transform BL21(DE3) cells at 37°C with 30 μg / mL of [a solution / method / etc.]. -1The culture was in LB medium containing kanamycin sulfate. When the culture was at 600 nm (A... 600 When the absorbance at the α-cell level reaches 1.5, add 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) and incubate at 37°C for 4–5 hours. Collect cells by centrifugation (10,000 × g, 30 min), resuspend in 20 mM Na₂HPO₄ / NaH₂PO₄, 0.5 M NaCl, 20 mM imidazole, pH 7, and lyse using a Branson Sonifier SFX150 (Branson Sonic Power, Danbury). Separate the soluble protein fraction (supernatant) by centrifugation (15,000 × g, 30 min), filter (0.45 μm), and then purify. Use pre-packaged... IKB206 was purified using a 5 mL HisTrap FF column in a chromatography system (GE Healthcare, USA). tags The column is pre-loaded with Ni Sepharose. IKB206 tags Elution was performed using 20 mM Na₂HPO₄ / NaH₂PO₄, 0.25 M NaCl, 0.4 M imidazole, at pH 8. Subsequently, it was used in… 5 mL HiTrap™ Desalting and 20 mM Na₂HPO₄ / NaH₂PO₄, pH 6, in a chromatography system (GE Healthcare, USA) for IKB206 tags Desalination is performed. IKB206 tags Store at -20℃.

[0258] For overexpression of untagged IKB206, transformed BL21(DE3) cells were incubated at 37°C with 30 μg / mL of [a solution / prescription]. -1 Cells were cultured in self-induced kanamycin sulfate LB broth (Studier FW, 2005). After 3 hours at 37°C, the temperature was reduced to 25°C, and cells were cultured for 4 hours before harvesting. Cells were collected by centrifugation (10000×g, 30 min), resuspended in lysis buffer containing 50 mM Tris pH 9, a protease inhibitor (Thermo Fisher Scientific Massachusetts USA), and DNase I (Roche), and lysed by sonication in a Branson Sonifier SFX150 (Branson Sonic Power, Danbury). The soluble protein fraction (supernatant) was separated by centrifugation (23666×g, 1 h, 30 min), filtered (0.22 μm), and then purified. Cells were then purified using a ligation method. A 5 mL HiTrap SP HP column (Cytiva Lifesciences, USA) was used to perform cation exchange chromatography on the protein solution. IKB206 was eluted with a gradient of 50 mM Tris, 1 M NaCl, and pH 9. The presence of protein was confirmed by SDS-PAGE. Fractions containing protein were combined and concentrated to a final volume of approximately 2–5 mL. The solution was filtered through a 0.22 μm filter and loaded onto a HiLoad 16 / 600 Superdex 75 size-locked column pre-equilibrated with 20 mM Tris, 500 mM NaCl, and pH 8. The presence of protein was confirmed by SDS-PAGE. Subsequently, [the following steps were performed using...]. IKB206 was desalted using a 5 mL HiTrap desalting column and 10 mM Na2HPO4 / NaH2PO4 at pH 6 via a chromatographic system (Cytiva, USA). IKB206 was stored at -80°C.

[0259] For the overexpression of IKB206ΔD8, transformed BL21(DE3) cells were incubated at 37°C with 30 μg / mL of [a solution / method / treatment]. -1 The kanamycin sulfate was cultured in LB broth medium. When the culture was at 600 nm (A... 600 When the absorbance at the α-cell margin reached 0.8, 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) was added, and the cells were incubated overnight at 25°C. Cells were then harvested. Cells were collected by centrifugation (10000×g, 30 min), resuspended in lysis buffer containing 50 mM Tris (pH 8.5), a protease inhibitor (Thermo Fisher Scientific, Massachusetts USA), and DNAse I (Roche), and lysed by sonication in a Branson Sonifier SFX150 (Branson Sonic Power, Danbury). The soluble protein fraction (supernatant) was separated by centrifugation (23666×g, 1 h, 30 min), filtered (0.22 μm), and purified. [The text abruptly ends here, likely due to an incomplete translation or missing information.] The protein solution was subjected to cation exchange chromatography using a 5 mL HiTrap SP HP column from a GO chromatography system (Cytiva Life Sciences, USA). Endolysin was eluted with a gradient of 50 mM Tris, 1 M NaCl, and pH 8.5. The presence of protein was confirmed by SDS-PAGE, and fractions containing protein were combined and then filtered through a 0.22 μm filter. [The last sentence appears to be incomplete and possibly refers to a different process.] Proteins were desalted using a chromatographic system (Cytiva, USA) connected to a 5 mL HiTrap desalting column and 10 mM Na2HPO4 / NaH2PO4 at pH 6. IKB206ΔD8 was stored at -80°C.

[0260] The quantification of purified proteins was performed using the Bradford method with Coomassie blue (Thermo Fisher Scientific). 595 Measured using a Spectrostar nanospectrophotometer (BMG Labtech). The purity of the isolated protein was verified by SDS-PAGE. SDS-PAGE analysis was performed using 4-12% SurePage. TM The gel (GenScript, Nanjing) was processed in Tris-MOPS-SDS electrophoresis buffer (GenScript, Nanjing) at a constant voltage (200V).

[0261] Enzymatic bactericidal activity assay

[0262] The experiments conducted to analyze the bactericidal activity of enzyme IKB206 (untagged, tagged, or without the D8 domain) were performed using a modified version of the protocol previously described by Loessner et al. (Loessner, MJ et al. 2002) and Schmelcher et al. (Schmelcher, M. et al. 2010). In short, depending on the strain, different bacterial cultures were incubated at 37°C or 30°C in specific media (Table 1) until A… 600 The concentration was increased to 0.3. The cells were then precipitated by centrifugation (4500×g, 10 min) and washed twice with the appropriate buffer. 600 Adjust to approximately 0.3. Transfer 160 μl of the bacterial suspension to a sterile 96-well plate and add 40 μl of the solution (dosage range: 1 to 60 μg / mL) to the plate. -1 The enzyme was studied. Control wells were treated with the same volume of enzyme-containing buffer. Plates were incubated at 37°C. Samples were collected at different time points, serially diluted, and inoculated into plates containing the specific culture medium to determine viable bacteria. Experiments were repeated at least three times. The bactericidal effect of IKB206 (and its variants) was quantified as the reduction in log number (log) in the presence of treatment after a given incubation time. 10 (N0 / N i In the case of each treatment, N0 = CFU / mL before treatment. -1 Number, N i = CFU mL after the corresponding incubation time -1The compound is considered to have bactericidal activity when the initial bacterial count is reduced by ≥99.9% (≥3 log reduction) after incubation with the compound.

[0263] Enzymatic specific activity assay

[0264] Specific activity (U mG⁻¹) was determined as follows: using 0.6 mg mL as substrate -1 Frozen stem cells of Micrococcus lysodeikticus were resuspended in a cold buffer for enzymes (for IKB206). tag Suspensions of 10 mM Na₂HPO₄ / NaH₂PO₄, pH 6; and 50 mM K₂HPO₄ / KH₂PO₄, pH 6.2 for egg white lysozyme were prepared and incubated at different enzyme concentrations. Egg white lysozyme (Fisher BioReagents) TM Lysozyme was used as a control. Specifically, 100 μL of *Micrococcus lysinensis* suspension was plated in triplicate into multi-well plates, and 100 μL of enzyme at different concentrations was added to the corresponding wells. The plates were then incubated at an appropriate temperature (IKB206). tags The mixture was incubated at 37°C (with egg white lysozyme at 25°C) in a constant-temperature spectrophotometer, and A was monitored within 10 minutes. 450 The decrease.

[0265] Unit definition: 1 unit is the amount of each lysozyme required to catalyze a decrease in absorbance at 450 nm of 0.001 / min by lysis of a ~0.4-0.6 mg / mL suspension of Micrococcus lysinus in a 1 cm cuvette at appropriate temperature and pH.

[0266] Physico-chemical characterization analysis

[0267] Research IKB206 tags The optimal conditions for enzyme activity were determined by an experiment using Escherichia coli bactericidal activity assay. For this purpose, Escherichia coli strain ATCC 25922 and 1 to 60 μg / mL were used. -1 Protein concentrations were determined within a pH range of 6 to 8 and a concentration range of 10 to 50 mM sodium phosphate buffer (Na2HPO4 / NaH2PO4).

[0268] Stability Study

[0269] The stability of IKB206 was determined by an assay of its bactericidal activity against Escherichia coli after an incubation time of 60 minutes. For this purpose, 15 μg / mL of Escherichia coli strain ATCC 25922 dissolved in different concentrations of glycerol (0, 0.2, 2, 5, and 10%) was used. -1IKB206. Determination was performed at different storage temperatures (-80°C, -20°C, 4°C, 25°C) and storage times (1, 5, 7, 14, 21, and 29 days).

[0270] Cell toxicity assay by sulforhodamine B

[0271] Prior to the experiments, a seeding assay was performed using human HEK293 cells. For this purpose, three different cell concentrations were seeded in 96-well plates containing 100 μl DMEM medium and 10% fetal bovine serum (FBS). These cells were cultured at 37°C and 5% CO2 for 72 hours, and growth was monitored. The initial cell concentration showing 80% confluence at 72 h was selected for further assays, in this case, 7000 cells / well.

[0272] 24 hours after cell seeding, add 100 μl of purified protein IKB206 to be tested. tags The concentration of the culture medium. In this case, it is 400 μg / mL. -1 200μg mL -1 100μg mL -1 and 50 μg mL -1 The assay was performed in quadruplicate. As a control, cells were incubated only with culture medium and buffer containing dissolved proteins (solvent control). The volume of buffer added as the solvent control was the same as the volume at which the highest protein concentration was achieved. The plates were then incubated for another 48 hours.

[0273] Cells were fixed by adding 50 μl of 50% cold trichloroacetic acid (TCA) to each well and incubating the plate at room temperature for 1 hour. After discarding the TCA, the plate was washed with distilled water and 40 μl of 0.4% sulfonylrhodamine B (SRB) was added. The plate was incubated at room temperature for 15 minutes, washed three times with 1% acetic acid, and then air-dried. Finally, 200 μl of 10 mM TrisBase was added to each well and the plate was stirred and incubated at room temperature for 20 minutes to resuspend the SRB. The results were read at absorbance of 510 nm in a Cytation 5 (Bioteck, USA).

[0274] Efficacy assay using the zebrafish septicemia model

[0275] Adult zebrafish were tested at the Ikan Biotech facility in Noáin, Navarre. All scientific methods used in the assays were performed in accordance with Royal Decree No. 53 / 2013 of 8 February 2013 and the National Institutes of Health Guide for the Care and Use of Laboratory (Pamplona, ​​Spain), approved by the Institutional Committee for the Care and Use of Animal of the University of Navarre. The committee under this institution approved all experiments conducted on the animals in this study (Program 034-17 and revision e035-17).

[0276] To calculate the minimum lethal dose that would result in 100% mortality within 7 days, several groups of five (5) six-month-old wild-type female zebrafish were inoculated intraperitoneally (IP) with different dilutions of Escherichia coli in LB medium.

[0277] After determining the minimum lethal dose, 10 μl of 5.5 × 10⁻⁶ lethal doses were intraperitoneally (IP) inoculated into 6-month-old wild-type zebrafish (1.2 g) grown in LB medium containing 5.5 × 10⁻⁶ g of lysate. 7 CFU mL -1 Escherichia coli. All experiments were repeated at least 3 times.

[0278] In order to study chimera IKB206 tags The mediated protective effect was achieved using a lethal dose of Escherichia coli (5.5 × 10⁻⁶). 7 Several groups of five (5) six-month-old wild-type female zebrafish were infected with CFU (carbohydrate-containing fecal microbiota) via intraperitoneal (IP) administration. One hour later, the zebrafish were injected with 1, 0.5, and 0.25 mg / kg CFU. -1 Administer 10 μl of IKB206 subcutaneously at a dose per body weight. tags Animals were treated. Fish in the control group were treated with a buffer solution containing dissolved proteins. Animals were observed several times daily, and the number of deaths was recorded daily at 72 hours post-infection (hpi).

[0279] Bacterial strains, antibiotics and endolysins used in the synergism study

[0280] The *E. coli* strains used in this work and their MICs are shown in Table 2. As previously mentioned, IKB206 was purified from *E. coli* strain BL21(DE3). tags Endolysin.

[0281] Table 2. Each antibiotic and IKB206 in TP-Na 10mM pH 6.15 tags MIC (mg / L) -1 )

[0282]

[0283] Chessboard and isobologram analysis

[0284] As previously mentioned, the checkerboard test was evaluated using a microdilution method (Moody JA 1992, Moellering EG., Jr. 1996). All compounds were tested at six concentrations, with two-fold serial dilutions, typically ranging from 0.03 × MIC to 2 × MIC. Each microtiter well contained 100 μl of 1 × 10⁻⁶ solution. 5 CFUs mL -1 Escherichia coli inoculum (with or without the corresponding compound) was incubated in 10 mM sodium phosphate (TP-Na) buffer at pH 6.15 with a final volume of 200 μl per well, and the plate was incubated at 37°C for 17 hours.

[0285] The fractional inhibition concentration index (FICI) was calculated as IKB206. tags Alternatively, the MIC of each antibiotic combination can be divided by the MIC of IKB206 alone or by the MIC of each individual antibiotic (Moody JA 1992, Moellering EG., Jr. 1996). FICI is obtained by summing the individual FICIs, as shown below:

[0286] FICI X ═FICI A +FICI B ═Combined MIC A / MIC A + Combination MIC B / MIC B

[0287] The MIC of drug A is plotted on the x-axis of the equivalence plot, and the MIC of drug B is plotted on the y-axis. The line connecting these two datasets is the indifference line (no interaction). Different FICI values ​​for the combination represent synergistic (FICI ≤ 0.5), partially synergistic (0.5 < FICI < 1), additive (FICI = 1), unrelated (1 < FICI < 2), or antagonistic (FICI > 2) interactions.

[0288] In vitro time kill curve test of single drugs and combinations

[0289] Time-kill assays were evaluated according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (Methods for determining bactericidal activity of antimicrobial agents, National Committee for Clinical Laboratory Standards (NCCLS): Wayne, PA: CLSI; 1999, Document M26-A). The combinations studied in the time-kill assays were performed using individual antibiotics and enzymes or combinations at proven synergistic concentrations. In these assays, 1 × 10⁻⁶... 6 CFU / mL test strains were incubated with individual compounds or combinations in separate tubes in 10 mM TP-Na at pH 6.15. At 17 h, aliquots were removed from each tube and serially diluted (1:10) with sterile saline to determine cell viability. After each dilution, 10 μl was added to LB agar plates and incubated at 37 °C for 24 h (detection limit, 10). 2 CFU mL -1 According to the Clinical and Laboratory Standards Association, in this 17-hour scenario, at the end of the experiment, the combined use of two antimicrobial agents resulted in a reduction of CFU / mL compared to the sum of reductions observed when using a single compound. -1 When the reduction is ≥2 log units, the combination is considered synergistic (CLSI Guidelines).

[0290] Bioinformatic analysis

[0291] Bioinformatics analysis can be performed using programs accessible via the Internet, such as BLAST (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi), GenomeNet (http: / / www.genome.jp), Expasy (https: / / web.expasy.org / protparam / ), and PFAM (http: / / pfam.xfam.org).

[0292] Structural models of the IKB206 catalytic cavity and D8 domain were established using the online software Phyre 2 (Kelley LA et al. 2015) and Swissmodel (Waterhouse, A et al. 2018). Sequence alignment was performed using Clustal omega (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ) and Espript (http: / / espript.ibcp.fr / ESPript / ESPript / ).

[0293] Structural analysis and figures were prepared using Pymol (available online at https: / / pymol.org / 2 / ) and Chimera software (Pettersen EF et al. 2004).

[0294] Statistical analysis

[0295] Depending on the type of assay, the data presented throughout this study represent results obtained from 3 to 5 repeated independent experiments. Furthermore, the mean and standard error are presented for each data point. Statistical analysis was performed using the program GraphPad InStat version 3.0 (GraphPad Software, San Diego, CA) and the software Stata 15.0 (StataCorp LLC, Texas, TX).

[0296] Based on the characteristics of the data (normality and homoscedasticity), the Kruskal-Walis test is used in conjunction with the U-Mann-Whitney test, and analysis of variance (ANOVA) is used in conjunction with the Tukey test or the t-test for in vitro bactericidal activity assays.

[0297] The Kruskal-Walis test is used for data related to human cytotoxicity.

[0298] In survival experiments to determine the protective effect of enzyme IKB206 in different animal models, ANOVA was used in conjunction with the Dunnett test and the ordinal-log-rank (Mantel-Cox) test to verify the significance of surviving animals in different experimental groups.

[0299] Example 1. - Expression and purification of IKB206 and IKB206 tags Example 1. - Expression and purification of IKB206 and IKB206 tags Example 1.

[0300] The chimera was cloned into the pET-29b(+) plasmid in two different ways: with an S-tag and a 6xHis tag (IKB206) at the N and C ends. tags , Figure 1 b), and without any tags (IKB206, Figure 1 a). The first measurement used IKB206. tags The purification process was facilitated. After observing that the chimera exhibited bactericidal activity against Escherichia coli, the following bactericidal assays were performed using the unlabeled chimera IKB206.

[0301] IKB206 tags By using 1mM IPTG in A 600Overexpression was induced in a culture of approximately 1.5 μL at 37°C and 200 rpm for 4–5 hours. This was because better results were obtained using the conditions described in the purification step. Protein purification was performed using a 6xHis tag via affinity chromatography. Figure 2 The obtained IKB206 is shown. tags The protein purity is shown in the figure. As can be seen from the figure, the size estimated by the computer corresponds to the size obtained by electrophoresis (35.4 kDa).

[0302] IKB206 was overexpressed for 4 hours in self-induced LB broth (Studier FW.2005) at 25 °C and 200 rpm. The protein was purified by cation exchange chromatography at pH 9 (IKB206 pI≈10) followed by size exclusion chromatography. Figure 2 b shows the protein purity of the obtained IKB206. The molecular weight of the band corresponds to the molecular weight of IKB206, which is 29.9 kDa.

[0303] Example 2. - Physico-chemical characterization

[0304] To determine IKB206 tags The optimal conditions for obtaining maximum activity in in vitro assays were investigated, focusing on the effects of different sodium phosphate buffer concentrations and pH values ​​on IKB206. tags The effect of bactericidal activity was investigated. For this purpose, *E. coli* ATCC 25922 was resuspended in phosphate buffer at different concentrations and adjusted to different pH values ​​as substrates. The CFU / mL values ​​of the control and protein-treated samples were measured under different conditions. -1 The difference was found to be that the highest bactericidal activity was observed in phosphate buffer at a concentration of 10 mM and pH 6 (data not shown).

[0305] Furthermore, the net charge of both proteins and modules was estimated based on their respective sequences using the bioinformatics portal Expasy ProtParam. The net charge of the intact protein was +21, the net charge of the module corresponding to the bacteriophage Arya endolysin was +7, and the net charge of module D8 was +15.

[0306] Example 3. - Stability study

[0307] To determine the optimal storage conditions for chimeric IKB206, bactericidal activity was determined for chimeric proteins stored at different temperatures for different times. Furthermore, the potential for glycerol to improve protein stability under the different storage conditions investigated was examined. The chimeric protein was found to retain full activity at all tested temperatures and glycerol concentrations after 29 days of storage (data not shown).

[0308] Example 4. - IKB206 tags Functional characterization of IKB206

[0309] Once the choice for IKB206 is determined tags To determine the optimal conditions for enzyme activity, functional characterization of the enzyme was performed. Therefore, the specific activity (U mg) of this enzyme was measured. -1 ) and bactericidal activity.

[0310] The standard test for determining the enzyme activity of lysozyme is to measure the A of the entire suspension of Micrococcus lysodeoxycholica cells after incubation with the enzyme. 450 The reduction was determined after performing two independent measurements of this type and following the above protocol. tags The specific activity is approximately 8100 U mg -1 .

[0311] After determining the specific activity, the bactericidal activity of the enzyme against *Escherichia coli* ATCC 25922 was measured at different concentrations. Following the above protocol, it was observed that, compared to the control group, after only 5 minutes of incubation at a concentration of 15 μg / mL... -1 At that time, IKB206 tags It can significantly reduce (P<0.05) CFU / mL -1 The quantity (reduced by more than 2 logs or reduced to less than 1 / 100 of its original value) Figure 3 Furthermore, if the incubation time is increased to 15 minutes, the concentration is only 5 μg / mL. -1 IKB206 tags In the presence of CFU mL -1 The reduction was significant (P < 0.05). From 10 5 CFU mL -1 This type of assay was initiated using a bacterial suspension, and it was observed that the enzyme was capable of operating at 60 μg / mL. -1 At a concentration of [specific concentration], during an incubation period of 15 minutes and at 15 μg / mL [specific concentration], [specific concentration] was observed. -1 At concentrations that kill the entire culture within 30 minutes ( Figure 3 In other words, IKB206 can reduce the bacterial suspension by 5 logs (to 1 / 100,000) within 30 minutes of incubation.

[0312] To determine IKB206 tags To investigate whether the activity can be extended to serotypes other than E. coli strain ATCC 25922 (O6 serotype), this study was expanded to include E. coli strain DSM 17076 with serotype O157:H7. Based on the previous results, 15 μg / mL was selected. -1 As a concentration suitable for these measurements. Figure 4The results are shown. Recombinant lysin significantly reduced the number of E. coli strain DSM 17076 cells, although it did not kill the entire culture.

[0313] Due to the clinical importance of multidrug-resistant (MDR) Escherichia coli strains to human and veterinary health, a series of assays were performed to identify IKB206. tags Fungicidal activity against MDR strains isolated from chickens (see Table 1). Typically, activity was observed with 15 μg / mL... -1 IKB206 tags After incubating together for 30 minutes, IKB206 tags It can significantly reduce the number of bacteria present in the assay by 2 to 5 log (to 1 / 100 to 1 / 100,000 of its original value). Figure 5 ).

[0314] Example 5 - IKB206 tags Studies on the effect of the microbiota on chickens

[0315] The aim of this study was to obtain a molecule with bactericidal activity against *Escherichia coli* for human and animal health. To this end, to demonstrate the specificity of this enzyme against *E. coli* and to rule out any possible interactions with the bacterial microbiota present in chickens, and thus to rule out any possible influences originating from said microbiota, the bactericidal activity of IKB206 against a range of bacteria present in chickens over 40 days old (i.e., strains of *S. xylosus*, *E. avium*, *Enterococcus faecium*, and *Enterococcus faecalis*) was analyzed (Proietti, PC et al. 2006). Figure 6 The results showed that IKB206 had almost no effect on the analyzed chicken microbiota strains.

[0316] Example 6. - IKB206 spectrum of action study

[0317] Furthermore, to determine the spectrum of action of IKB206, we investigated the bactericidal activity of this enzyme against other Enterobacteriaceae (Citrobacter freundii, Enterobacter cloacae, Serratia marcescens, and Klebsiella pneumoniae) and other non-Enterobacterial Gram-negative bacteria (Acinetobacter baumannii and Pseudomonas aeruginosa). Regarding its action against Enterobacteriaceae, in Figure 7IKB206 exhibited excellent bactericidal activity against Klebsiella pneumoniae, with a reduction of 4 or more logs observed under the test conditions. However, IKB206 did not show the same effect against Citrobacter flexneri, where the bactericidal activity was significantly lower than that observed in Escherichia coli or Klebsiella pneumoniae, although this effect was observed to increase with increasing incubation time. Compared to Citrobacter flexneri, IKB206 exerted a greater effect against Serratia marcescens. Although the lethality against Serratia marcescens did not reach that observed in Escherichia coli within the tested incubation time, a greater upward trend was observed with increasing incubation time, reaching almost 3 logs of bactericidal activity at an incubation time of 120 minutes. In extended studies of bactericidal activity against other non-Enterobacterial Gram-negative bacteria, IKB206 also showed strong bactericidal activity against Acinetobacter baumannii and Pseudomonas aeruginosa, with a reduction of more than 4 logs (CFU / mL). Figure 8 ).

[0318] Example 7. - IKB206 mechanism of action study

[0319] To investigate the mechanism of action of IKB206, the secondary structure of the enzyme was modeled, and the importance of domain D8 in IKB206 activity was determined.

[0320] To determine the putative protein structure of IKB206, structural models of the catalytic domain and D8 domain were constructed using the online software Phyre2 (Kelley LA et al. 2015) and Swissmodel (Waterhouse A et al. 2018), respectively. Figure 9 A and Figure 9 B).

[0321] The D8 domain was constructed using the N-terminal LysM domain of the putative endopeptidase of *Termus thermofilus* (Wong JE et al. 20155) as a template. The output model of the catalytic domain was constructed using the crystal structure of the prephage muramicase of *Acinetobacter baumannii* AB 5075UW2 (Sykilinda NN et al. 2018) as a template. The structural model of the catalytic domain revealed a similar overall folding to that of T4 lysozyme and other T4 lysozyme-like endosomals (e.g., P22 phage lysozyme (Mooers BHe et al. 2006) or endosomal encoded by *Escherichia coli* DLP12 prephage (Babu K et al. 2018)). The catalytic mechanism of T4 lysozyme has been described in detail, as have the residues involved in the catalytic reaction (Rennel D et al. 1991; Kuroki R et al. 1995; Kuroki R et al. 1999). Other endolysins (e.g., P21 and P22) have been shown to have similar amino acids in the catalytic cleft (Xu M, et al. 2005; Mooers BH et al. 2006; Maciejewska B et al. 2017), which constitute the so-called catalytic triplet, typically formed by the E-8aa-D / C-5aa-T motif (Babu K et al. 2018). The presence of this motif has been described as a marker of T4 lysozyme-like endolysins (Sun Q et al. 2009; Maciejewska B et al. 2017; Babu K et al. 2018). The sequence of IKB206 shows that residues E15, D24, and T33 are well aligned with the catalytic residues of DLP12 endosomalin, T4 lysozyme, P22 lysozyme, and BA 5075UW muramicase (Babu K et al. 2018; Daopin S et al. 1991; Mooers BH et al. 2006; Sykilinda NN et al. 2018, respectively). Figure 9 (D), all of which were identified as T4 lysozyme-like endosomalins. Furthermore, the structural model of IKB206 was superimposed on the crystal structures of these endosomalins (PDB codes 1L48, 4ZPU, 2ANV, and 6ET6, respectively). Figure 9Sequence alignment (C) and other methods indicate that E15, D24, and T33 can constitute the catalytic triplet of IKB206. Another structural feature of T4 lysozyme is the salt bridge between R145 and catalytic E11 (Rennel D et al., 1991; Babu K et al., 2018). In other T4 lysozyme-like endosomalins, the presence of a salt bridge between catalytic glutamate and arginine located near the C-terminal region is preserved (Babu K et al., 2018). It has been proposed that this salt bridge functions to orient the glutamate side chain within the catalytic cleft (Rennel D et al., 1991; Babu K et al., 2018). In the structural model of IKB206, R139 can form a salt bridge with E15, supporting the hypothesis that E15 is one of the catalytic residues of IKB206.

[0322] These findings support the view that the catalytic domain of IKB206 belongs to the catalytic triad of T4 lysozyme-like endosomalin and residues E15, D24, and T33 forming an enzyme.

[0323] To determine the importance of domain D8, a protein, IKB206ΔD8, corresponding only to the catalytic domain, was obtained. Overexpression of this construct was performed in LB broth. When A600 reached ≈0.8, protein overexpression was induced for 16 h with 1 mM IPTG at 25 °C and 200 rpm. IKB206ΔD8 was purified by cation exchange chromatography at pH 8.5 (pI ≈ 9.5). Figure 2 C shows the purity of the obtained protein. The molecular weight of the band corresponds to the computed molecular weight of the protein, which is 17.54 kDa. Assays used to determine the bactericidal activity of IKB206ΔD8 in *E. coli* strain ATCC25922 showed that the polypeptide possesses bactericidal activity in the absence of the D8 domain. However, longer incubation times were required to obtain the same level of bactericidal activity as IKB206. Figure 10 ).

[0324] Example 8 - IKB206 tags Study of efficacy in an in vivo sepsis model

[0325] In order to determine IKB206 tags To determine its effectiveness in treating E. coli infection in organisms, a series of assays were conducted, including an evaluation of the molecule's efficacy in a zebrafish E. coli-induced sepsis model.

[0326] The intraperitoneal (IP) route was chosen for the infection model because it is simple and rapid to administer, thus adapting the technique to be particularly suitable for different groups of experimental animals. One hour after infection with *E. coli* ATCC 25922, different doses of IKB206 were administered to each group. High protective efficacy was observed at 72 hpi, protecting 66.6%, 33.3%, and 16.6% of patients in descending order of concentration. Figure 11 In addition, to determine the toxicity of IKB206 in adult fish, uninfected fish were inoculated with the highest amount of protein (1 μg g) used in the efficacy assay. -1 The determination was carried out. It was observed that fish injected with protein buffer and those injected with 1 μg g... -1 There was no difference in protein levels among the fish (data not shown).

[0327] Example 9 - IKB206 tags Toxicity studies on human cells

[0328] To determine IKB206 tags To assess the toxicity of IKB206 to human cells in order to potentially enable its use in humans, toxicity assays were performed on the human HEK293 cell line. This included samples containing dissolved IKB206. tags Protein buffer solution, in case the toxicity measured is related to the buffer solution rather than the protein. For example... Figure 12 As shown, no significant differences were observed between the control (culture medium) and different assay concentrations (p > 0.05).

[0329] Example 10 - IKB206 tags Investigation of possible synergism between IKB206 and antibiotics

[0330] IKB206 tags Synergistic effect with carbapenem antibiotics

[0331] Exploring combinations of two or more antibacterial agents can be useful because they can work synergistically, thus providing an effective way to enhance the bactericidal activity of individual drugs. To test IKB206... tags To assess the bactericidal effects of antibiotics, we tested some of the most commonly used drugs for combating MDR E. coli disease (Hawkey PM et al. 2018). In particular, we used two carbapenem antibiotics. For the E. coli strain, we selected a standard E. coli strain according to the CLSI guidelines: E. coli strain ATCC 25922.

[0332] The combination used in the test (IKB206) tags The results of in vitro studies of endosomal and antibiotic combinations are summarized in Tables 3 and 4. The equivalence curves for each combination of endosomal and antibiotic are shown in Tables 3 and 4. Figure 13As shown. These data demonstrate synergistic and additive effects, depending on the specific antibiotic. Interestingly, none of these combinations produced irrelevant or antagonistic effects. The use of meropenem or imipenem with IKB206... tags The combination showed synergy.

[0333] Table 3. Meropenem and IKB206 obtained by the checkerboard method tags FICI values ​​of the combination. Values ​​in bold indicate synergistic effects, in italics indicate partial synergistic effects, and bars indicate bacterial growth.

[0334]

[0335] Table 4. Imipenem and IKB206 obtained by checkerboard method tags FICI values ​​of the combination. Values ​​in bold indicate synergistic effects, in italics indicate partial synergistic effects, and bars indicate bacterial growth.

[0336]

[0337] Time-kill analysis of drug combinations against E. coli strains

[0338] To confirm IKB206 tags The potential synergistic activity with meropenem and imipenem was investigated by time-kill assays against *Escherichia coli* strain ATCC25922. The effectiveness of the antibiotic and IKB206 was determined based on checkerboard and isomorphic line plot results. tags The range of concentrations. These concentrations are used for various treatments, whether using a single agent or in combination. Figure 14 The results shown indicate that the combination of antibiotics and IKB206 is effective at doses below the MIC of the test compound.

[0339] In addition, at certain test concentrations, a synergistic effect was observed, with a reduction of at least 2 log units in live cells after 17 hours of treatment compared to the control, consistent with CLSI guidelines.

[0340] Overall, the initial checkerboard experiments indicated a synergistic effect of carbapenem antibiotics. These results were confirmed by a time-kill assay of Escherichia coli ATCC 25922 strain, which showed synergistic effects of meropenem and imipenem with IKB206. tags They exhibit a clear synergistic effect when combined.

[0341] References:

[0342] (1)Farber,L.Antibiotics in Food Preservation.Annu.Rev.Microbiol.1959.13:125–140.

[0343] (2)Davies,J.y Davies,D.Origins and evolution of antibiotic resistance.Microbiol.Mol.Biol.Rev.MMBR.2010.74:417–4335.

[0344] (3)Frankel,R.B.;Kalmijn,A.J.;Amann,R.;Ludwig,W.;Petersen,N.;Arakaki,A.;Matsunaga,T.;Bleil,U.;Kirschvink,J.L.;Sievert,S.M.;et al.Sampling theAntibiotic Resistome.Science.2006.311:374–378.

[0345] (4)Tenover,F.C.Mechanisms of antimicrobial resistance in bacteria.Am.J.Infect.Control.2006.34:S3–S10.

[0346] (5)Starrels,J.L.;Barg,F.K.;Metlay,J.P.Populations at Risk Patternsand Determinants of Inappropriate Antibiotic Use in Injection DrugUsers.J.Gen.Intern.Med.2009.24:263–269.

[0347] (6)Manjusha Lekshmi 1,Parvathi Ammini 2,Sanath Kumar 1and ManuelF.Varela 3.The Food Production Environment and the Development ofAntimicrobial Resistance in Human Pathogens of AnimalOrigin.Microorganism.2017.5:11.

[0348] (7)Smith,K.E.;Besser,J.M.;Hedberg,C.W.;Leano,F.T.;Bender,J.B.;Wicklund,J.H.;Johnson,B.P.;Moore,K.A.;Osterholm,M.T.Quinolone-resistantCampylobacter jejuni infections in Minnesota,1992–1998.InvestigationTeam.N.Engl.J.Med.1999.340:1525–1532.

[0349] (8)WHO.The World Is Running Out of Antibiotics,WHO ReportConfirms.2017.Available online:http: / / www.who.int / mediacentre / news / releases / 2017 / running-out-antibiotics / en / (accessed on 3 January 2018).

[0350] (9)O’Neill,J.Tackling Drug-Restistant Infections Globally:FinalReport and Recommendations.2016.Available online:https: / / amr-review.org / sites / default / files / 160525_Final%20paper_with%20cover.pdf(accessed on 1March 2018).

[0351] (10)Adeyi,O.O.;Baris,E.;Jonas,O.B.;Irwin,A.;Berthe,F.C.J.;Le Gall,F.G.;Marquez,P.V.;Nikolic,I.A.;Plante,C.A.;Schneidman,M.;et al.Drug-ResistantInfections:A Threat to Our Economic Future;Final Report;World Bank Group:Washington,DC,USA,2017.

[0352] (11)Antilles N,Blanco A,CamprubíQ,Jove R y Biarnés M.Analysis of antimicrobial resistance of E.coli strains isolated from birds in from 1998 to 2013 Poultry Health Center of Catalonia and Aragon (CESAC) Reus, Tarragona,

[0353] (12)Czaplewski,L.;Bax,R.;Clokie,M.;Dawson,M.;Fairhead,H.;Fischetti,VA;Foster,S.;Gilmore,BF;Hancock,RE;Harper,D.;et al. portfolio review.Lancet Infect.Dis.2016.16:239–251.

[0354] (13)Hermoso JA,García JLand García P.Taking aim on bacterialpathogens:from phage therapy to enzybiotics.Curr.Opin.Microbiol.2007.10:461–472.

[0355] (14)Fischetti VA,Nelson D.and Schuch R.Reinventing phage therapy:are the parts greater than the sum?Nat.Biotechnol.2006.24:1508–11.

[0356] (15)Pires,D.P.;Oliveira,H.;Melo,L.D.;Sillankorva,S.and Azeredo,J.Bacteriophage-encoded depolymerases:Their diversity and biotechnological applications.Appl.Microbiol.Biotechnol.2016.100,2141–2151.

[0357] (16)Nelson D.,Loomis L.and Fischetti V.A.Prevention and eliminationcolonization of mice by group A streptococci by using a bacteriophage lyticenzyme.Proc.Natl.Acad.Sci.USA.2001.98:4107-4112.

[0358] (17)Yoong P.,Schuch R.,Nelson D.and Fischetti V.A.Identification of abroadly active phage lytic enzyme with lethal activity against antibiotic-resistant Enterococcus faecalis and Enterococcus faecium.JBacteriol.2004.186:4808-4812.

[0359] (18)Zimmer M.,Vukov N.,Scherer S.and Loessner M.J.:The mureinhydrolase of the bacteriophage3626 dual lysis system is active against alltested Clostridium perfringens strains.Appl.Environ.Microbiol.2002.68:5311-5317.

[0360] (19)Cheng Q.,Nelson D.,Zhu S.and Fischetti V.A.:Removal of group Bstreptococci colonizing the vagina and oropharynx of mice with abacteriophage lytic enzyme.Antimicrob.Agents Chemother.2005.49:111-117.

[0361] (20)McCullers J.A., A.,Iverson A.R.,Loeffler J.M.and FischettiVA:Novel strategy to prevent otitis media caused by colonizing Streptococcuspneumoniae.PLoS Pathog.2007.3:e28.

[0362] (21)Schmelcher M.;Tchang V.S.and Loessner M.J.Domain shuffling andmodule engineering of Listeria phage endolysins for enhanced lytic activityand binding affinity.Microb.Biotechnol.2011.4,651–662.

[0363] (22)Díez-Martínez,R.;De Paz H.D.;García-Fernández,E.;Bustamante,N.;Euler,C.W.;Fischetti,V.A.;Menendez,M.and García,P.A novel chimeric phagelysin with high in vitro and in vivo bactericidal activity againstStreptococcus pneumoniae.J.Antimicrob.Chemother.2015.70,1763–1773.

[0364] (23)Becker S.C.;Foster-Frey J.;Stodola A.J.;Anacker D.and DonovanD.M.Differentially conserved staphylococcal SH3b_5 cell wall binding domainsconfer increased staphylolytic and streptolytic activity to a streptococcalprophage endolysin domain.Gene.2009.443:32–41.

[0365] (24)Yang H.;Linden S.B.;Wan J.;Yu J.;Nelson D.C.and Wei,H.Achimeolysin with extended-spectrum streptococcal host range found by aninduced lysis-based rapid screening method.Sci.Rep.2015.5,17257.

[0366] (25)Yang H.;Bi Y.;Shang X.;Wang M.;Linden S.B.;Li Y.;Nelson D.C.andWei H.Antibiofilm activities of a novel chimeolysin against Streptococcusmutans under physiological and cariogenic conditions.Antimicrob.AgentsChemother.2016.60:7436–7443.

[0367] (26)Briers Y.and Lavigne R.Breaking barriers:Expansion of the use ofendolysins as novel antibacterials against Gram-negative bacteria.FutureMicrobiol.2015.10:377–390.

[0368] (27)Briers Y.,Walmagh M.,Van Puyenbroeck V.et al.Engineeredendolysin-based‘Artilysins’to combat multidrug-resistant Gram-negativepathogens.MBio.2014.5(4):e 01379–e 01414.

[0369] (28)Wang,S.,Gu,J.,Lv,M.,Guo,Z.,Yan,G.,et al.The antibacterialactivity of E.coli bacteriophage lysin Lysep3 is enhanced by fusing theBacillus amyloliquefaciens bacteriophage endolysin binding domain D8 to theC-terminal region.J Microbiol.2017.55(5):403-408.

[0370] (29)Heselpoth,R.D.,Euler,C.W.,Schuch,R.y Fischetti,V.A.Lysocins:Bioengineered Antimicrobials that Deliver Lysins Across the Outer Membrane ofGram-Negative Bacteria.2019.Antimicrob.Agents Chemother.doi:10.1128 / AAC.00342-19

[0371] (30)Loessner,M.J.,Kramer,K.,Ebel,F.y Scherer,S.C-terminal domains ofListeria monocytogenes bacteriophage murein hydrolases determine specificrecognition and high-affinity binding to bacterial cell wall carbohydrates.Mol.Microbiol.2002.44:335–349.

[0372] (31)Schmelcher,M.,Shabarova,T.,Eugster,M.R.,Eichenseher,F.,Tchang,V.S.,Banz,M.,et al.Rapid multiplex detection and differentiation of Listeriacells by use of fluorescent phage endolysin cell wall binding domains.Appl.Environ.Microbiol.2010.76:5745–5756.

[0373] (32)Tikhe,C.,and Husseneder,C.Whole genome sequencing andcharacterization of Enterobacter phage Arya isolated from the termitegut.Direct submission National Center for Biotechnology Information,NIH.2016

[0374] (33)Morita,M.,Tanji,Y.,Orito,Y.,Mizoguchi,K.,Soejima,A.and Unno,H.Functional analysis of antibacterial activity of Bacillus amyloliquefaciensphage endolysin against Gram-negative bacteria.FEBS Letters.2001.500:56-59.

[0375] (34)Proietti,P.C.,Castellini,C.,Pedrazzoli,M.,Dal Bosco,A.andFranciosini,M.Bacterial Counts and Characterization of Intestinal Flora inOrganic and Conventional Chickens.World’s Poultry Science Association(WPSA),Beekbergen,the Netherlands.2006.

[0376] (35)OECD GUIDELINES FOR TESTING OF CHEMICALS:Fish Embryo AcuteToxicity(FET)Test,in 236.

[0377] (36)David A and Pancharatna K.Effects of acetaminophen(paracetamol)inthe embryonic development of zebrafish,Danio rerio.J Appl Toxicol.2009 7:597-602.

[0378] (37)Fischetti,V.,Nelson,D.and Schuch,R.Reinventing phage therapy:arethe parts greater than the sum?Nat Biotechnology.2006.24(12):1508-11.

[0379] (38)Vázquez,R.,García,E.and García,P.Phage Lysins for FightingBacterial Respiratory Infections:A New Generation of Antimicrobials.FrontImmunol.2018.9:2252.

[0380] (39) C.Engineering of Phage-Derived Lytic Enzymes:ImprovingTheir Potential as Antimicrobials.Antibiotics.2018.7,29.

[0381] (40)Orito Y.,Morita,M.,Hori,K.,Unno,H.and Tanji,Y.Bacillusamyloliquefaciens phage endolysin can enhance permeability of Pseudomonasaeruginosa outer membrane and induce cell lysis.Appl MicrobiolBiotechnol.2004.65(1):105-9.

[0382] (41)Hojckova,K.,Stano,M.y Klucar,L.phiBIOTICS:catalogue oftherapeutic enzybiotics,relevant research studies and practicalapplications.BMC Microbiol.2013.13:53.

[0383] (42)Letrado P.,Corsini,B.,Díez-Martínez,R.,Bustamante,N.,Yuste,J.E.and García,P.Bactericidal synergism between antibiotics and phageendolysin Cpl-711 to kill multidrug-resistant pneumococcus.FutureMicrobiol.2018.13(11):1215-1223.

[0384] (43)Vázquez,R.,Domenech,M.,Iglesias-Bexiga,M.,Menéndez,M.and García,P.Csl2,a novel chimeric bacteriophage lysin to fight infections caused byStreptococcus suis,an emerging zoonotic pathogen.Sci Rep.2017.7(1):16506.

[0385] (44)Hooper,L.V.,Littman,D.R.and Macpherson,A.J.Interactions betweenthe microbiota and the immune system.Science.2012.336(6086):1268–1273.

[0386] (45)Ley,R.E.,Turnbaugh,P.J.,Klein,S.and Gordon,J.I.Microbial ecology:human gut microbes associated with obesity.Nature.2006.444:1022.

[0387] (46)Cani,P.D.and Delzenne,N.M.The role of the gut microbiota inenergy metabolism and metabolic disease.Curr Pharm Des.2009.15:1546–1558.

[0388] (47)Claus,S.P.,Ellero,S.L.,Berger,B.,Krause,L.,Bruttin,A.,etal.Colonization-induced host-gut microbial metabolic interaction.MolBio.2011.2:e00271–e00210.

[0389] (48)Spor,A.,Koren,O.and Ley,R.Unravelling the effects of theenvironment and host genotype on the gut microbiome.Nat Rev Microbiol.2011.9:279.

[0390] (49)Schulfer A.F.,Battaglia,T.,Alvarez,Y.,Bijnens,L.,Ruiz,V.E.,etal.Intergenerational transfer of antibiotic-perturbed microbiota enhancescolitis in susceptible mice.Nat Microbiol.2018.3:234.

[0391] (50)Le Roy,C.I.,Woodward,W.J.,Ellis,R.J.,La Ragione,R.M.and Claus,S.P.Antibiotic treatment triggers gut dysbiosis and modulates metabolism in achicken model of gastro-intestinal infection.BMC Vet Res.2019.25(1):37.

[0392] (51)Kelley L.A,Mezulis S,Yates C.M,Wass M.N,Sternberg M.J.The Phyre2web portal for protein modeling,prediction and analysis.Nat Protoc.2015 Jun;10(6):845-58.doi:10.1038 / nprot.2015.053.

[0393] (52)Waterhouse,A.,Bertoni,M.,Bienert,S.,Studer,G.,Tauriello,G.,Gumienny,R.,Heer,F.T.,de Beer,T.A.P.,Rempfer,C.,Bordoli,L.,Lepore,R.,Schwede,T.SWISS-MODEL:homology modelling of protein structures and complexes.NucleicAcids Res.46(W1),W296-W303(2018)

[0394] (53)Daopin,S.,Alber,T.,Baase,W.A.,Wozniak,J.A.,Matthews,B.W.Structural and thermodynamic analysis of the packing of two alpha-helicesin bacteriophage T4 lysozyme.(1991)J Mol Biol 221:647-667

[0395] (54)Babu K,Arulandu A,Sankaran K.The structure of DLP12 endolysinexhibiting alternate loop conformation and comparative analysis with otherendolysins.Proteins.2018 Feb;86(2):210-217.Doi:10.1002 / prot.25428.Epub 2017Dec 1.

[0396] (55)Mooers,B.H.,Matthews,B.W.Extension to 2268 atoms of directmethods in the ab initio determination of the unknown structure ofbacteriophage P22 lysozyme.(2006)Acta Crystallogr D Biol Crystallogr 62:165-176

[0397] (56)Sykilinda NN,Nikolaeva AY,Shneider MM,Mishkin DV,Patutin AA,PopovVO,Boyko KM,Klyachko NL,Miroshnikov KA Structure of an Acinetobacter Broad-Range Prophage Endolysin Reveals a C-Terminalα-Helix with the Proposed Rolein Activity against Live Bacterial Cells.Viruses.2018 Jun 6;10(6):309.doi:10.3390 / v10060309.

[0398] (57)Schmelcher M,Donovan DM,Loessner MJ.;Bacteriophage endolysins asnovel antimicrobials.Future Microbiol.2012;7(10):1147–1171.

[0399] (58)Minogue TD,Daligault HA,Davenport KW,Bishop-Lilly KA,Broomall SM,Bruce DC,Chain PS,Chertkov O,Coyne SR,Freitas T,Frey KG,Gibbons HS,Jaissle J,Redden CL,Rosenzweig CN,Xu Y,Johnson SL.Complete Genome Assembly ofEscherichia coli ATCC 25922,a Serotype O6 Reference Strain.GenomeAnnounc.2014 Sep-Oct;2(5):e00969-14.

[0400] (59)Nelson DC,Schmelcher M,Rodriguez-Rubio L,Klumpp J,Pritchard DG,Dong S,Donovan DM.,Endolysins as antimicrobials,Adv Virus Res.2012;83:299-365.

[0401] (60)Vaara M.Agents that increase the permeability of the outermembrane.Microbiol Rev.56(3):395-441(1992).

[0402] (61)Studier FW.Protein production by auto-induction in high densityshaking cultures.

[0403] Protein Expr Purif.2005 May;41(1):207-34.doi:10.1016 / j.pep.2005.01.016

[0404] (62)Santin and Cascales.Measure of peptidoglycan hydrolaseactivity.Methods Mol Biol.1615:151-158(2017).

[0405] (63)European Centre for Disease Prevention and Control.Surveillanceof antimicrobial resistance in Europe–Annual report of the EuropeanAntimicrobial Resistance Surveillance Network(EARS-Net)2017.Stockholm:ECDC;2018.

[0406] (64)Moody JA.Synergism testing:broth microdilution checkerboard andbroth macrodilution methods.In:Isenberg HD,editor.Clinical MicrobiologyProcedures Handbook.American Society for Microbiology;DCUSA:1992.pp.5.18.1–28.

[0407] (65)Moellering EG.,Jr.Antimicrobial combinations.In:Lorian V,editor.Antibiotics in Laboratory Medicine.The Williams&Wilkins Co.;MDUSA:1996.pp.330–396

[0408] (66)Pettersen,E.F.;Goddard,T.D.;Huang,C.C.;Couch,G.S.;Greenblatt,D.M.;Meng,E.C.;Ferrin,T.E.UCSF Chimera—A visualization system forexploratory research and analysis.J.Comput.Chem.2004,25,1605–1612.

[0409] (67)Peter M Hawkey,Roderic E Warren,David M Livermore,Cliodna A MMcNulty,David A Enoch,Jonathan A Otter,A Peter R Wilson.Treatment ofinfections caused by multidrug-resistant Gram-negative bacteria:report of theBritish Society for Antimicrobial Chemotherapy / Healthcare Infection Society / British Infection Association Joint Working Party.Journal of AntimicrobialChemotherapy,Volume 73,Issue suppl_3,1 March 2018,Pages iii2–iii78.

[0410] (68)Huttner A.and Gambillara V.The development and early clinicaltesting of the ExPEC4V conjugate vaccine against uropathogenic Escherichiacoli.Clin Microbiol Infect.2018 Oct;24(10):1046-1050.

[0411] (69)Wong JE,Midtgaard SR,Gysel K,Thygesen MB, KK,Jensen KJ,Stougaard J,Thirup S,Blaise M An intermolecular binding mechanism involvingmultiple LysM domains mediates carbohydrate recognition by an endopeptidase.

[0412] (70)Rennell D,Bouvier SE,Hardy LW,Poteete AR.Systematic Mutation ofBacteriophage T4 Lysozyme.J MolBiol1991;222:67-88.

[0413] (71)Kuroki R,Weaver LH,Matthews BW.Structure-based design of alysozyme with altered catalytic activity.Nat Struct Biol1995;2:1007-1011

[0414] (72)Kuroki R,Weaver LH,Matthews BW.Structural basis of the conversionof T4 lysozyme into a transglycosidase by reengineering the active site.ProcNatl Acad Sci USA 1999;96:8949-8954.

[0415] (73)Xu M,Arockiasamy A,Struck DK,Swanson S,Sacchettini JC,YoungR.Disulfide isomerization after membrane release of its SAR domain activatesP1 lysozyme.Science 2005;307:113-117

[0416] (74)Maciejewska B, K,Espaillat A, M,Rembacz KP,Cava F,Dubin G,Drulis-Kawa Z Modular endolysin of Burkholderia AP3 phage has thelargest lysozyme-like catalytic subunit discovered to date and no catalyticaspartate residue.Sci Rep.2017 Nov 6;7(1):14501.doi:10.1038 / s41598-017-14797-9.

[0417] (75)Sun Q,Kuty GF,Arockiasamy A,Xu M,Young R,SacchettiniJC.Regulation of a muralytic enzyme by dynamic membrane topology.Nat StructMol Biol.2009 Nov;16(11):1192-4.doi:10.1038 / nsmb.1681.Epub 2009 Nov 1.

[0418] (76)Masi,M.,Réfregiers,M.,Pos,K.et al.Mechanisms of envelopepermeability and antibiotic influx and efflux in Gram-negative bacteria.NatMicrobiol 2,17001(2017).

[0419] (77)Düring,K.,Porsch,P.,Mahn,A.,Brinkmann,O.and Gieffers,W.(1999)FEBSLett.449,93-100. sequence list <110> Trum Therapy Ltd <120> Novel recombinant lysin and its use in the treatment of Gram-negative bacterial infections <130> 906 002 <160> 9 <170> PatentIn version 3.5 <210> 1 <211> 163 <212> PRT <213> Arya, an Enterobacterial bacteriophage <220> <221> MISC_FEATURE <222> (1)..(163) <223> endolysin <400> 1 Met Lys Thr Ser Pro Asn Gly Ile Ala Val Thr Lys Tyr Phe Glu Ser 1 5 10 15 Phe Glu Ala Arg Ala Tyr Pro Asp Pro Ala Thr Gly Gly Lys Pro Tyr 20 25 30 Thr Ile Gly Phe Gly Thr Thr Val Tyr Pro Ser Gly Ala Pro Val Arg 35 40 45 Leu Gly Asp Val Cys Thr Lys Glu Gln Ala Glu Lys Tyr Leu Gln Asn 50 55 60 Asp Leu Ala Lys Phe Glu Lys Ile Val Ser Asp Ala Val Arg Val Pro 65 70 75 80 Leu Asn Gln Gly Gln Phe Asp Ala Leu Val Ser Phe Thr Tyr Asn Leu 85 90 95 Gly Pro Ala Asn Leu Arg Ser Ser Thr Leu Leu Lys Lys Leu Asn Ala 100 105 110 Gly Asp Tyr Ala Gly Ala Ala Lys Glu Phe Pro Arg Trp Asn Arg Ala 115 120 125 Asn Gly Lys Val Met Lys Gly Leu Thr Arg Arg Arg Ala Ala Glu Gln 130 135 140 Cys Leu Phe Glu Gly Met Gly Gly Ala Ser Ala Ile Glu Arg Gly Val 145 150 155 160 Ala Ala Ala <210> 2 <211> 116 <212> PRT <213> Bacillus amyloliquefaciens phage <220> <221> MISC_FEATURE <222> (1)..(116) <223> Cellular osmotic domain (D8) <400> 2 Asn Ser Gly Thr Pro Lys Asn Val Ser Arg Gly Thr Ser Ser Thr Lys 1 5 10 15 Thr Thr Pro Lys Tyr Lys Val Lys Asn Gly Asp Asn Leu Thr Lys Ile 20 25 30 Ala Lys Lys His Asn Thr Thr Val Ala Thr Leu Leu Lys Leu Asn Pro 35 40 45 Gly Ile Lys Asp Pro Asn Met Ile Arg Val Gly Gln Thr Leu Asn Val 50 55 60 Thr Gly Ser Gly Gly Lys Thr His Lys Val Lys Ser Gly Asp Thr Leu 65 70 75 80 Ser Lys Ile Ala Val Asp Asn Lys Thr Thr Val Ser Lys Leu Met Asn 85 90 95 Leu Asn Pro Glu Ile Thr Asn Pro Asn His Ile Lys Val Gly Gln Thr 100 105 110 Ile Arg Leu Ser 115 <210> 3 <211> 279 <212> PRT <213> Artificial Sequence <220> <223> Chimeric endolysin (SEQ ID NO:1 + SEQ ID NO:2) <220> <221> MISC_FEATURE <222> (1)..(179) <400> 3 Met Lys Thr Ser Pro Asn Gly Ile Ala Val Thr Lys Tyr Phe Glu Ser 1 5 10 15 Phe Glu Ala Arg Ala Tyr Pro Asp Pro Ala Thr Gly Gly Lys Pro Tyr 20 25 30 Thr Ile Gly Phe Gly Thr Thr Val Tyr Pro Ser Gly Ala Pro Val Arg 35 40 45 Leu Gly Asp Val Cys Thr Lys Glu Gln Ala Glu Lys Tyr Leu Gln Asn 50 55 60 Asp Leu Ala Lys Phe Glu Lys Ile Val Ser Asp Ala Val Arg Val Pro 65 70 75 80 Leu Asn Gln Gly Gln Phe Asp Ala Leu Val Ser Phe Thr Tyr Asn Leu 85 90 95 Gly Pro Ala Asn Leu Arg Ser Ser Thr Leu Leu Lys Lys Leu Asn Ala 100 105 110 Gly Asp Tyr Ala Gly Ala Ala Lys Glu Phe Pro Arg Trp Asn Arg Ala 115 120 125 Asn Gly Lys Val Met Lys Gly Leu Thr Arg Arg Arg Ala Ala Glu Gln 130 135 140 Cys Leu Phe Glu Gly Met Gly Gly Ala Ser Ala Ile Glu Arg Gly Val 145 150 155 160 Ala Ala Ala Asn Ser Gly Thr Pro Lys Asn Val Ser Arg Gly Thr Ser 165 170 175 Ser Thr Lys Thr Thr Pro Lys Tyr Lys Val Lys Asn Gly Asp Asn Leu 180 185 190 Thr Lys Ile Ala Lys Lys His Asn Thr Thr Val Ala Thr Leu Leu Lys 195 200 205 Leu Asn Pro Gly Ile Lys Asp Pro Asn Met Ile Arg Val Gly Gln Thr 210 215 220 Leu Asn Val Thr Gly Ser Gly Gly Lys Thr His Lys Val Lys Ser Gly 225 230 235 240 Asp Thr Leu Ser Lys Ile Ala Val Asp Asn Lys Thr Thr Val Ser Lys 245 250 255 Leu Met Asn Leu Asn Pro Glu Ile Thr Asn Pro Asn His Ile Lys Val 260 265 270 Gly Gln Thr Ile Arg Leu Ser 275 <210> 4 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> thrombin cleavage site <220> <221> MISC_FEATURE <222> (1)..(6) <400> 4 Leu Val Pro Arg Gly Ser 1 5 <210> 5 <211> 329 <212> PRT <213> Artificial Sequence <220> <223> Chimeric endolysin (IKB207) <220> <221> MISC_FEATURE <222> (1)..(329) <400> 5 Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln His Met Asp Ser 1 5 10 15 Pro Asp Leu Gly Thr Leu Val Pro Arg Gly Ser Met Ala Ile Ser Asp 20 25 30 Pro Met Lys Thr Ser Pro Asn Gly Ile Ala Val Thr Lys Tyr Phe Glu 35 40 45 Ser Phe Glu Ala Arg Ala Tyr Pro Asp Pro Ala Thr Gly Gly Lys Pro 50 55 60 Tyr Thr Ile Gly Phe Gly Thr Thr Val Tyr Pro Ser Gly Ala Pro Val 65 70 75 80 Arg Leu Gly Asp Val Cys Thr Lys Glu Gln Ala Glu Lys Tyr Leu Gln 85 90 95 Asn Asp Leu Ala Lys Phe Glu Lys Ile Val Ser Asp Ala Val Arg Val 100 105 110 Pro Leu Asn Gln Gly Gln Phe Asp Ala Leu Val Ser Phe Thr Tyr Asn 115 120 125 Leu Gly Pro Ala Asn Leu Arg Ser Ser Thr Leu Leu Lys Lys Leu Asn 130 135 140 Ala Gly Asp Tyr Ala Gly Ala Ala Lys Glu Phe Pro Arg Trp Asn Arg 145 150 155 160 Ala Asn Gly Lys Val Met Lys Gly Leu Thr Arg Arg Arg Ala Ala Glu 165 170 175 Gln Cys Leu Phe Glu Gly Met Gly Gly Ala Ser Ala Ile Glu Arg Gly 180 185 190 Val Ala Ala Ala Asn Ser Gly Thr Pro Lys Asn Val Ser Arg Gly Thr 195 200 205 Ser Ser Thr Lys Thr Thr Pro Lys Tyr Lys Val Lys Asn Gly Asp Asn 210 215 220 Leu Thr Lys Ile Ala Lys Lys His Asn Thr Thr Val Ala Thr Leu Leu 225 230 235 240 Lys Leu Asn Pro Gly Ile Lys Asp Pro Asn Met Ile Arg Val Gly Gln 245 250 255 Thr Leu Asn Val Thr Gly Ser Gly Gly Lys Thr His Lys Val Lys Ser 260 265 270 Gly Asp Thr Leu Ser Lys Ile Ala Val Asp Asn Lys Thr Thr Val Ser 275 280 285 Lys Leu Met Asn Leu Asn Pro Glu Ile Thr Asn Pro Asn His Ile Lys 290 295 300 Val Gly Gln Thr Ile Arg Leu Ser Leu Gly Thr Leu Val Pro Arg Gly 305 310 315 320 Ser Leu Glu His His His His His His 325 <210> 6 <211> 489 <212> DNA <213> Artificial Sequence <220> <223> Polynucleotide encoding SEQ ID NO:1 <220> <221> misc_feature <222> (1)..(4)89 <400> 6 atgaaaacct ctccaaatgg tatcgccgtt accaagtact tcgaatcatt tgaagcccgc 60 gcataccctg accccgccac tggcggtaaa ccatacacga ttggcttcgg aaccactgtc 120 tacccgtctg gcgcacccgt ccgtttaggg gatgtgtgta cgaaagaaca ggccgagaaa 180 tatttacaaa atgacttggc gaaattcgag aagattgtat ctgacgcagt gcgcgttccc 240 cttaatcaag gtcagtttga cgcgttagtg tcatttacgt ataacttagg acccgccaat 300 ttgcgcagca gtaccctgtt aaaaaagttg aacgctgggg actatgcggg ggccgctaaa 360 gagtttccgc gttggaaccg tgcaaacggt aaagtgatga aaggtttgac acgtcgccgc 420 gcggcagaac aatgtttgtt tgaagggatg ggaggcgcga gcgcgattga acgtggtgta 480 gccgctgca 489 <210> 7 <211> 348 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> SEQ ID NO:2 of the sequence of the sequence <220> <221> misc_feature <222> (1)..(348) <400> 7 aacagtggga caccaaaga tgtttcccgc ggaacctcgt ccacgaagac aacacctaag 120. 120. 120. 120. 120. 120. 120. 120. 120. 120. 120 gcgacattgc tgaaacttaa tccagggatc aaagacccca acatgattcg tgtagggcag actttaaatg ttacagggtc cggtgggaaa actcataaag tcaagtcggg tgacacactg agtaaaatcg cagttgataa tagcgact gttagcaagt tgatgaatct taacccgga atcactatc ctaaccatat caaagtcggc cagacaatcc gtttgagc <210> 8 <211> 837 <212> DNA <213> Artificial Sequence <220> <223> Polynucleotide sequence encoding SEQ ID NO:3 <220> <221> misc_feature <222> (1)..(837) <400> 8 atgaaaacct ctccaaatgg tatcgccgtt accaagtact tcgaatcatt tgaagcccgc 60 gcataccctg accccgccac tggcggtaaa ccatacacga ttggcttcgg aaccactgtc 120 tacccgtctg gcgcacccgt ccgtttaggg gatgtgtgta cgaaagaaca ggccgagaaa 180 tatttacaaa atgacttggc gaaattcgag aagattgtat ctgacgcagt gcgcgttccc 240 cttaatcaag gtcagtttga cgcgttagtg tcatttacgt ataacttagg acccgccaat 300 ttgcgcagca gtaccctgtt aaaaaagttg aacgctgggg actatgcggg ggccgctaaa 360 gagtttccgc gttggaaccg tgcaaacggt aaagtgatga aaggtttgac acgtcgccgc 420 gcggcagaac aatgtttgtt tgaagggatg ggaggcgcga gcgcgattga acgtggtgta 480 gccgctgcaa acagtgggac accaaagaat gtttcccgcg gaacctcgtc cacgaagaca 540 acacctaagt ataaggtaaa aaatggtgac aacttaacta aaatcgcgaa gaaacataat 600 actacagtag cgacattgct gaaacttaat ccagggatca aagaccccaa catgattcgt 660 gtagggcaga ctttaaatgt tacagggtcc ggtgggaaaa ctcataaagt caagtcgggt 720 gacacactga gtaaaatcgc agttgataat aagacgactg ttagcaagtt gatgaatctt 780 aacccggaaa tcactaatcc taaccatatc aaagtcggcc agacaatccg tttgagc 837 <210> 9 <211> 987 <212> DNA <213> Artificial Sequence <220> <223> Polynucleotide encoding SEQ ID NO:5 <220> <221> misc_feature <222> (1)..(987) <400> 9 atgaaagaaa ccgctgctgc taaattcgaa cgccagcaca tggacagccc agatctgggt 60 accctggtgc cacgcggttc catggcgata tcggatccga tgaaaacctc tccaaatggt 120 atcgccgtta ccaagtactt cgaatcattt gaagcccgcg cataccctga ccccgccact 180 ggcggtaaac catacacgat tggcttcgga accactgtct acccgtctgg cgcacccgtc 24%, cgtttagggg atgtgtgtac gaaagaacag gccgagaaat atttacaaaa tgacttggcg 300 aaattcgaga agattgtatc tgacgcagtg cgcgttcccc ttaatcaagg tcagtttgac 360 gcgttagtgt catttacgta taacttagga cccgccaatt tgcgcagcag taccctgtta 420 aaaaagttga acgctgggga ctatgcgggg gccgctaaag agtttccgcg ttggaaccgt 480 gcaaacggta aagtgatgaa aggtttgaca cgtcgccgcg cggcagaaca atgtttgttt 540 gaagggatgg gaggcgcgag cgcgattgaa cgtggtgtag ccgctgcaaa cagtgggaca 600 ccaaagaatg tttcccgcgg aacctcgtcc acgaagacaa cacctaagta taaggtaaaa 660 aatggtgaca acttaactaa aatcgcgaag aaacataata ctacagtagc gacattgctg 720 aaacttaatc cagggatcaa agaccccaac atgattcgtg tagggcagac tttaaatgtt 780 acagggtccg gtgggaaaac tcataaagtc aagtcgggtg acacactgag taaaatcgca 840 gttgataata agacgactgt tagcaagttg atgaatctta acccggaaat cactaatcct 900 aaccatatca aagtcggcca gacaatccgt ttgagcctgg gtaccctggt gccacgcggt 960 tccctcgagc accaccacca ccaccac 987

Claims

1. A chimeric protein consisting of the amino acid sequence SEQ ID NO: 3 or the amino acid sequence SEQ ID NO:

5.

2. A polynucleotide consisting of the nucleic acid sequence consisting of SEQ ID NO: 8 or the nucleic acid sequence consisting of SEQ ID NO:

9.

3. A vector comprising the polynucleotide according to claim 2.

4. A host cell comprising the vector according to claim 3.

5. A method of producing the chimeric protein according to claim 1, wherein the method comprises: i. introducing the vector according to claim 3 into a suitable host cell; ii. culturing the host cell under conditions suitable for expression of the protein; iii. isolating and / or purifying the protein.

6. A composition comprising: the chimeric protein according to claim 1, the polynucleotide according to claim 2, the vector according to claim 3 or the host cell according to claim 4.

7. The composition of claim 6, wherein, The composition is a pharmaceutical composition and further comprises a pharmaceutically acceptable carrier, vehicle or excipient.

8. A kit comprising: the chimeric protein according to claim 1, the polynucleotide according to claim 2, the vector according to claim 3, the host cell according to claim 4 or the composition according to claim 6 or 7.

9. Use of the chimeric protein according to claim 1, or the composition according to claim 6 or 7, for the manufacture of a medicament for the therapeutic treatment of a Gram-negative bacterial infection, wherein the Gram-negative bacteria is one or more selected from the group consisting of Acinetobacter, Pseudomonas, Escherichia, Klebsiella, Citrobacter and Serratia.

10. Use according to claim 9, wherein, The protein or the pharmaceutical composition is used in combination with one or more antibiotics.

11. Use according to claim 10, wherein, The one or more antibiotics is selected from the group consisting of carbapenems, imipenem and meropenem.

12. The use according to claim 9, wherein, The Gram-negative bacteria is one or more selected from the group consisting of Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Citrobacter freundii and Serratia marcescens.

13. An in vitro method of inhibiting the growth of, reducing the population of or killing Gram-negative bacteria, the method comprising contacting the bacteria with the chimeric protein according to claim 1 or the composition according to claim 6 or 7, wherein the Gram-negative bacteria is one or more selected from the group consisting of Acinetobacter, Pseudomonas, Escherichia, Klebsiella, Citrobacter and Serratia.

14. The in vitro method of inhibiting the growth, reducing the population, or killing Gram-negative bacteria according to claim 13, wherein, The Gram-negative bacteria is one or more selected from the group consisting of Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Citrobacter freundii and Serratia marcescens.

15. Use of the chimeric protein according to claim 1 or the composition according to claim 6 or 7 as a material disinfectant and / or surface disinfectant.

Images