Phosphoenolpyruvate carboxylase mutants and uses thereof
By introducing specific mutations into phosphoenolpyruvate carboxylase, the problem of low efficiency of the phosphoenolpyruvate carboxylase complementation pathway in Corynebacterium glutamicum was solved, thereby improving the production efficiency of glutamic acid, glutamine, and proline.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-07-28
- Publication Date
- 2026-03-31
AI Technical Summary
In the existing technology, the phosphoenolpyruvate carboxylase recombinant pathway of Corynebacterium glutamicum is inefficient, which affects the synthesis and metabolism of amino acids.
The activity and efficiency of phosphoenolpyruvate carboxylase can be improved by introducing specific mutations, such as E27D, Q34R, Y85H, I180L, K303E, T360A, A408S, Q542R, R634K, and R840H, into the amino acid sequence.
It significantly increased the yield of glutamic acid, glutamine, and proline, thereby improving the production efficiency of amino acids.
Smart Images

Figure BDA0003185039540000051 
Figure BDA0003185039540000061
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to a phosphoenolpyruvate carboxylase mutant and its applications. Background Technology
[0002] The tricarboxylic acid cycle is a metabolic pathway that is ubiquitous in aerobic organisms. Some of its intermediate products are prerequisites for the synthesis of important organic compounds in organisms. For example, oxaloacetic acid (OAA) is the carbon skeleton for the synthesis of aspartic acid group amino acids, and α-ketoglutarate is the carbon skeleton for the synthesis of glutamate group amino acids. When intermediate products of the tricarboxylic acid cycle are used to synthesize organic compounds, organisms will initiate a replenishment pathway to ensure that the tricarboxylic acid cycle can function normally.
[0003] Corynebacterium glutamicum exhibits two complementation pathways: one is the catalysis of phosphoenolpyruvate carboxylase (PEPC, encoded by ppc) to oxaloacetate (OAA) from phosphoenolpyruvate (PEP), and the other is the catalysis of pyruvate carboxylase (PC, encoded by pyc) to oxaloacetate from pyruvate. These two complementation pathways have a significant impact on the amino acid metabolism of the strain. Summary of the Invention
[0004] To address the problems existing in the prior art, the present invention provides a phosphoenolpyruvate carboxylase mutant and its application.
[0005] In a first aspect, the present invention provides a phosphoenolpyruvate carboxylase mutant, wherein the phosphoenolpyruvate carboxylase mutant is obtained by any one or more of the following mutations in the amino acid sequence of phosphoenolpyruvate carboxylase:
[0006] The following mutations occurred at positions: position 27: glutamic acid to aspartic acid; position 34: glutamine to arginine; position 85: tyrosine to histidine; position 180: isoleucine to leucine; position 303: lysine to glutamic acid; position 360: threonine to alanine; position 408: alanine to serine; position 542: glutamine to arginine; position 634: arginine to lysine; and position 840: arginine to histidine.
[0007] Furthermore, the amino acid sequence of the phosphoenolpyruvate carboxylase includes the sequence shown in SEQ ID NO.1 (encoded by the nucleotide sequence shown in SEQ ID NO.3).
[0008] Further, the amino acid sequence of the phosphoenolpyruvate carboxylase mutant, as shown in SEQ ID NO.2, is encoded by the nucleotides shown in SEQ ID NO.4. This invention is further used to encode the nucleic acid of the phosphoenolpyruvate carboxylase mutant.
[0009] Secondly, the present invention provides a recombinant microorganism in which the amino acid sequence of phosphoenolpyruvate carboxylase undergoes any one or more of the following mutations:
[0010] The following mutations occurred at positions: position 27: glutamic acid to aspartic acid; position 34: glutamine to arginine; position 85: tyrosine to histidine; position 180: isoleucine to leucine; position 303: lysine to glutamic acid; position 360: threonine to alanine; position 408: alanine to serine; position 542: glutamine to arginine; position 634: arginine to lysine; and position 840: arginine to histidine.
[0011] Furthermore, the amino acid sequence of the phosphoenolpyruvate carboxylase mutant includes the sequence shown in SEQ ID NO. 1.
[0012] Furthermore, the microorganism is Corynebacterium glutamicum, Escherichia coli, or Bacillus flavus.
[0013] The starting strain MHZ-0112-8 used in the preferred embodiment of the present invention is a glutamic acid-producing bacterium, which is deposited at the China General Microbiological Culture Collection Center with accession number CGMCC No.11941 and published in Chinese Patent CN202011285971.7.
[0014] The starting strain MHZ-0513-3 is a glutamine-producing bacterium, deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 13405, and published in Chinese patent CN201611250325.0.
[0015] The originating strain MHZ-0701 is a proline-producing bacterium, deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 13757, and published in Chinese patent CN201710385500.5.
[0016] The present invention further provides the application of the phosphoenolpyruvate carboxylase mutant or the nucleic acid in increasing the amino acid yield of the strain.
[0017] Furthermore, the strain is *Corynebacterium glutamicum*, *Escherichia coli*, or *Brucharia flavomarginata*; and / or,
[0018] The amino acid is one or more selected from glutamic acid, glutamine, proline, ornithine, arginine, citrulline, or hydroxyproline.
[0019] The present invention further provides the application of the recombinant microorganism in the production of amino acids; preferably, its application in the production of one or more of glutamic acid, glutamine, proline, ornithine, arginine, citrulline or hydroxyproline.
[0020] The beneficial effects of this invention are as follows:
[0021] This invention provides a phosphoenolpyruvate carboxylase mutant, which includes mutations at multiple sites. When this mutant is applied to a strain, it is found that the production of glutamic acid, glutamine, and proline is significantly increased when these mutations occur.
[0022] Specifically, compared with MHZ-0112-8 / pXMJ19-ppc, strain MHZ-0112-8 / pXMJ19-ppc10 increased glutamate production from 35.8 g / L to 39.9 g / L, representing an 11.5% increase in acid production. Transforming plasmids pXMJ19-ppc10 and pXMJ19-ppc into Corynebacterium glutamicum MHZ-0513-3, strain MHZ-0513-3 / pXMJ19-ppc10, compared with MHZ-0513-3 / pXMJ19-ppc, increased glutamine production from 28.8 g / L to 32.3 g / L, representing a 12.2% increase in acid production. Transforming plasmid pXM... Transformation of J19-ppc10 and pXMJ19-ppc into Corynebacterium glutamicum MHZ-0701 resulted in a 6% increase in proline production, from 38.3 g / L to 40.6 g / L, compared to MHZ-0701 / pXMJ19-ppc. This indicates that point mutations in ppc10, such as E27D, Q34R, Y85H, I180L, K303E, T360A, A408S, Q542R, R634K, and R840H, are beneficial for glutamic acid production.
[0023] The phosphoenolpyruvate carboxylase mutant provided by this invention can not only promote the production of glutamate, but also promote the production of glutamate derivatives such as glutamine and proline. Obviously, this mutation can be applied to other host bacteria such as Corynebacterium glutamicum and Escherichia coli to produce other glutamate derivatives, such as ornithine, arginine, citrulline, and hydroxyproline. Detailed Implementation
[0024] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.
[0025] The primer names and sequences involved in the examples are shown in Table 1 (SEQ ID NO.5-8).
[0026] Table 1 Primer sequences
[0027] Primers The sequence (from top to bottom) is as follows: P1 TGTGAGCGGATAACAATTTCA P2 TTCTGATTTAATCTGTATCAGGCTGA ppc-F TCCCcccgggATGACTGATTTTTTACCGATGACATCA ppc-R TCCCcccgggCTAGCCGGAGTTGCGCAGCGCAGTGGAAAGA
[0028] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0029] Example 1: Construction of a phosphoenolpyruvate mutant library
[0030] 1. This invention first employs error-prone PCR to construct a phosphoenolpyruvate mutant library. The error-prone PCR system used in this invention is as follows: 5 μL of 10× error-prone PCR buffer (100 mmol / L Tris-HCl pH 8.3, 500 mmol / L KCl, 1% Triton, 20 mmol / L MgCl2, 5 μL of 10× dNTP mixture (1 mmol / L dGTP, 1 mmol / L dATP, 5 mmol / L dCTP, 5 mmol / L dTTP) is added to every 50 μL of the system; 50 pmol each of primers ppc-F / ppc-R, 10 ng of DNA template (MHZ-0112-8 genome), and 5 μL of 5 mmol / L Mn2. 2+ 2.5 μL of 15 U / μL Taq DNA polymerase, 5 μL of 25 mmol / L Mg 2+ Add sterile ultrapure water to a total volume of 50 μL. The error-prone PCR program is as follows: 95℃ for 5 min; 94℃ for 1 min, 55℃ for 1 min, 72℃ for 1 min 30 s, 30 cycles; 72℃ for 10 min. Use the recovered PCR gel product from the first run as a template for the next round of error-prone PCR. Repeat this process for a total of 5 rounds of error-prone PCR to finally obtain the ppc gene containing multiple different mutations.
[0031] 2. Construction of ppc expression plasmid: The obtained ppc mutant fragment was purified using an agarose gel extraction kit (Tiangen), then digested with XmaI. Simultaneously, pXMJ19 was digested with XmaI and dephosphorylated with FastAP. The fragment was ligated to the vector using T4 DNA ligase (TransGen Biotech), transformed into Trans1T1 competent cells (TransGenBiotech), and kanamycin-resistant clones were selected. XmaI digestion confirmed the presence of the pXMJ19 fragment. Further sequencing using P1 / P2 primers (Invitrogen) confirmed the correct insertion. The resulting plasmid was named pXMJ19-ppcX, where X = 1, 2, 3…n.
[0032] Example 2: Construction and Glutamic Acid Production Performance of MHZ-0112-8 / pXMJ19-ppcX Mutant Strain
[0033] In this embodiment, plasmid pXMJ19-ppcX was electroporated to MHZ-0112-8 to obtain strain MHZ-0112-8 / pXMJ19-ppcX, which was then subjected to shake-flask fermentation to detect the glutamic acid yield.
[0034] 1. Method for verifying glutamic acid production through fermentation: The strain stored in glycerol tubes at -80℃ was inoculated onto agar slant medium for activation. After culturing at 31.5℃ for 24 hours, mycelial growth occurred. Mycelial growth was picked from the freshly activated slant and inoculated into seed culture medium. The culture was then incubated at 31.5℃ with shaking at 220 rpm until the mid-to-late logarithmic growth stage (approximately 12 hours) to obtain seed culture. 10% of this seed culture was inoculated into a 500ml shake flask containing 20ml of fermentation medium and incubated at 31.5℃ with shaking. After complete sugar consumption, the concentration of L-glutamic acid accumulated in the culture medium was measured. The results are shown in Table 2 (OD). 600 The turbidity of the culture medium diluted 100 times at 600 nm indicates the cell mass, and Glu (g / L) indicates the amount of accumulated L-glutamate.
[0035] 2. The culture medium formula is as follows:
[0036] Slant culture medium: yeast powder 5g / L, beef extract 10g / L, peptone 10g / L, sodium chloride 10g / L, agar powder 2.5g / L, pH 7.0-7.2, sterilized at 121℃ and 0.1MPa for 30min;
[0037] Seed culture medium: glucose 25 g / L, urea 3 g / L, K2HPO4·3H2O 2.2 g / L, MgSO4·7H2O 0.9 g / L, corn steep liquor 33 mL / L, soybean meal hydrolysate 22 mL / L, pH 7.0-7.2, sterilized at 121℃ and 0.1 MPa for 15 min;
[0038] Fermentation medium: glucose 60 g / L, ammonium sulfate 15 g / L, KH2PO4 1 g / L, MgSO4·7H2O 0.4 g / L, FeSO4·7H2O 1 mg / L, MnSO4·4-5H2O 1 mg / L, VB1 200 μg / L, biotin 300 μg / L, soybean hydrolysate 0.48 g / L. The pH was adjusted to 7.2-7.5 with NaOH. The mixture was sterilized at 121℃ and 0.1 MPa for 15 min, and then 1.0 g of heat-sterilized calcium carbonate was added.
[0039] Table 2. Detection of glutamic acid content in mutant strains.
[0040]
[0041]
[0042] The results showed that the glutamic acid production of strain MHZ-0112-8 / pXMJ19-ppc10 was significantly increased. Compared with MHZ-0112-8 / pXMJ19-ppc, the glutamic acid content increased from 35.8 g / L to 39.9 g / L, and the acid production increased by 11.5%, indicating that the expression of the ppc10 mutation significantly increased the glutamic acid production of the strain.
[0043] The present invention further sequenced the plasmid pXMJ19-ppc10, and the results showed that its amino acid mutation sites were E27D, Q34R, Y85H, I180L, K303E, T360A, A408S, Q542R, R634K and R840H.
[0044] Example 3: Construction of the MHZ-0513-3 / pXMJ19-ppc10 mutant strain and its performance in producing glutamine.
[0045] In this embodiment, the plasmid pXMJ19-ppc10 selected in Example 2 was transformed into glutamine-producing bacteria MHZ-0513-3 to construct strain MHZ-0513-3 / pXMJ19-ppc10, which was then subjected to shake-flask fermentation, and the glutamine content was detected.
[0046] 1. Method for verifying glutamine yield through fermentation: The strain stored in glycerol tubes at -80℃ was inoculated into the above-mentioned slant medium for activation. After culturing at 33℃ for 24 hours, mycelial growth occurred. Mycelial growth was picked from the freshly activated slant and inoculated into the above-mentioned seed medium. The culture was carried out at 33℃ with shaking at 100 rpm until the mid-to-late logarithmic growth stage, and the culture time was 5 hours to obtain the seed solution. The seed solution was inoculated at a 10% inoculation rate into a 500 ml shake flask containing 20 ml of fermentation medium and cultured at 33℃ with shaking at 150 rpm for 48 hours. The results are shown in Table 3 (OD). 562 The turbidity of the culture medium at 562 nm indicates the cell mass, and Gln (g / L) indicates the amount of accumulated L-glutamine.
[0047] 2. The culture medium formula is as follows:
[0048] Slant culture medium: brain heart extract 37g / L, agar 1.8%, sterilized at 121℃ and 0.1MPa for 20min;
[0049] The seed culture medium consisted of: glucose 50 g / L, urea 5 g / L, KH2PO4 2.0 g / L, MgSO4·7H2O 1.0 g / L, corn steep liquor 30 g / L, and pH 7.0.
[0050] The fermentation medium was: glucose 90 g / L, (NH4)2SO4 40 g / L, KH2PO4 2.0 g / L, MgSO4·7H2O 1.0 g / L, corn steep liquor 10 g / L, CaCO3 50 g / L, pH 7.0.
[0051] Table 3. Detection of glutamine content in mutant strains.
[0052] strain OD562 Gln(g / L) Acid production increase rate % MHZ-0513-3 43.4±0.09 28.5±0.01 -- MHZ-0513-3 / pXMJ19-ppc 43.2±0.21 28.8±0.03 -- MHZ-0513-3 / pXMJ19-ppc10 43.1±0.11 32.3±0.09 12.2%
[0053] Compared with MHZ-0513-3 / pXMJ19-ppc, strain MHZ-0513-3 / pXMJ19-ppc10 showed an increase in glutamine content from 28.8 g / L to 32.3 g / L and an increase in acid production of 12.2%. This indicates that the mutation of the ppc gene to ppc10 not only improves glutamic acid production but also promotes glutamine production.
[0054] Example 4: Construction of the MHZ-0701 / pXMJ19-ppc10 mutant strain and its performance in producing proline.
[0055] In this embodiment, plasmid pXMJ19-ppc10 was further transformed into proline-producing bacteria MHZ-0701 to construct strain MHZ-0701 / pXMJ19-ppc10, which was then subjected to shake-flask fermentation, and the proline content was detected.
[0056] 1. The culture medium formula is as follows:
[0057] Seed activation medium: 1% yeast extract, 1% peptone, 0.5% sodium chloride, 0.5% glucose, 2% agar, pH 7.2.
[0058] Seed culture medium: corn steep liquor 2.5%, glucose 1.0%, ammonium sulfate 0.4%, magnesium sulfate 0.05%, potassium dihydrogen phosphate 0.1%, urea 0.1%, CaCO3 0.5%, pH 7.2.
[0059] Fermentation medium: corn steep liquor 0.6%, glucose 12.0%, ammonium sulfate 3.7%, magnesium sulfate 0.05%, potassium dihydrogen phosphate 0.1%, CaCO3 4%, VH 70μg / L, VB1·HCl 80μg / L, pH 7.2.
[0060] 2. The cultivation process is as follows:
[0061] (1) Seed culture: Pick 1 slant seed of MHZ-0701, MHZ-0701 / pXMJ19-ppc, and MHZ-0701 / pXMJ19-ppc10 and loop them into a 500mL Erlenmeyer flask containing 20mL of seed culture medium. Culture at 33℃ and 220r / min for 16-22h.
[0062] (2) Fermentation culture: 2 mL of seed culture was inoculated into a 500 mL Erlenmeyer flask containing 20 mL of fermentation culture medium and cultured at 33 °C and 220 r / min for 72 h.
[0063] (3) Centrifuge 1 mL of fermentation broth (12000 rpm, 2 min), collect the supernatant, and use HPLC to detect the L-proline content in the fermentation broth of the engineered bacteria and the control bacteria. The concentrations are shown in Table 4 below:
[0064] Table 4. Detection of proline content in mutant strains
[0065] strain Pro(g / L) Acid production increase rate % MHZ-0701 38.1±0.06 -- MHZ-0701 / pXMJ19-ppc 38.3±0.12 -- MHZ-0701 / pXMJ19-ppc10 40.6±0.07 6.0%
[0066] Compared with strain MHZ-0701 / pXMJ19-ppc, strain MHZ-0701 / pXMJ19-ppc10 increased proline production from 38.3 g / L to 40.6 g / L, and acid production increased by 6.0%.
[0067] The results from the above examples show that the point mutations E27D, Q34R, Y85H, I180L, K303E, T360A, A408S, Q542R, R634K, and R840H in phosphoenolpyruvate carboxylase are beneficial to the synthesis and production of glutamic acid, glutamine, and proline. Obviously, this mutation can be applied to other host bacteria such as Corynebacterium glutamicum and Escherichia coli to produce other glutamic acid derivatives, such as ornithine, arginine, citrulline, and hydroxyproline.
[0068] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Meihua (Shanghai) Biotechnology Co., Ltd. <120> A phosphoenolpyruvate carboxylase mutant and its application <130> KHP211117887.6 <160> 8 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 919 <212> PRT <213> Artificial Sequence <400> 1 Met Thr Asp Phe Leu Arg Asp Asp Ile Arg Phe Leu Gly Gln Ile Leu 1 5 10 15 Gly Glu Val Ile Ala Glu Gln Glu Gly Gln Glu Val Tyr Glu Leu Val 20 25 30 Glu Gln Ala Arg Leu Thr Ser Phe Asp Ile Ala Lys Gly Asn Ala Glu 35 40 45 Met Asp Ser Leu Val Gln Val Phe Asp Gly Ile Thr Pro Ala Lys Ala 50 55 60 Thr Pro Ile Ala Arg Ala Phe Ser His Phe Ala Leu Leu Ala Asn Leu 65 70 75 80 Ala Glu Asp Leu Tyr Asp Glu Glu Leu Arg Glu Gln Ala Leu Asp Ala 85 90 95 Gly Asp Thr Pro Pro Asp Ser Thr Leu Asp Ala Thr Trp Leu Lys Leu 100 105 110 Asn Glu Gly Asn Val Gly Ala Glu Ala Val Ala Asp Val Leu Arg Asn 115 120 125 Ala Glu Val Ala Pro Val Leu Thr Ala His Pro Thr Glu Thr Arg Arg 130 135 140 Arg Thr Val Phe Asp Ala Gln Lys Trp Ile Thr Thr His Met Arg Glu 145 150 155 160 Arg His Ala Leu Gln Ser Ala Glu Pro Thr Ala Arg Thr Gln Ser Lys 165 170 175 Leu Asp Glu Ile Glu Lys Asn Ile Arg Arg Arg Ile Thr Ile Leu Trp 180 185 190 Gln Thr Ala Leu Ile Arg Val Ala Arg Pro Arg Ile Glu Asp Glu Ile 195 200 205 Glu Val Gly Leu Arg Tyr Tyr Lys Leu Ser Leu Leu Glu Glu Ile Pro 210 215 220 Arg Ile Asn Arg Asp Val Ala Val Glu Leu Arg Glu Arg Phe Gly Glu 225 230 235 240 Gly Val Pro Leu Lys Pro Val Val Lys Pro Gly Ser Trp Ile Gly Gly 245 250 255 Asp His Asp Gly Asn Pro Tyr Val Thr Ala Glu Thr Val Glu Tyr Ser 260 265 270 Thr His Arg Ala Ala Glu Thr Val Leu Lys Tyr Tyr Ala Arg Gln Leu 275 280 285 His Ser Leu Glu His Glu Leu Ser Leu Ser Asp Arg Met Asn Lys Val 290 295 300 Thr Pro Gln Leu Leu Ala Leu Ala Asp Ala Gly His Asn Asp Val Pro 305 310 315 320 Ser Arg Val Asp Glu Pro Tyr Arg Arg Ala Val His Gly Val Arg Gly 325 330 335 Arg Ile Leu Ala Thr Thr Ala Glu Leu Ile Gly Glu Asp Ala Val Glu 340 345 350 Gly Val Trp Phe Lys Val Phe Thr Pro Tyr Ala Ser Pro Glu Glu Phe 355 360 365 Leu Asn Asp Ala Leu Thr Ile Asp His Ser Leu Arg Glu Ser Lys Asp 370 375 380 Val Leu Ile Ala Asp Asp Arg Leu Ser Val Leu Ile Ser Ala Ile Glu 385 390 395 400 Ser Phe Gly Phe Asn Leu Tyr Ala Leu Asp Leu Arg Gln Asn Ser Glu 405 410 415 Ser Tyr Glu Asp Val Leu Thr Glu Leu Phe Glu Arg Ala Gln Val Thr 420 425 430 Ala Asn Tyr Arg Glu Leu Ser Glu Ala Glu Lys Leu Glu Val Leu Leu 435 440 445 Lys Glu Leu Arg Ser Pro Arg Pro Leu Ile Pro His Gly Ser Asp Glu 450 455 460 Tyr Ser Glu Val Thr Asp Arg Glu Leu Gly Ile Phe Arg Thr Ala Ser 465 470 475 480 Glu Ala Val Lys Lys Phe Gly Pro Arg Met Val Pro His Cys Ile Ile 485 490 495 Ser Met Ala Ser Ser Val Thr Asp Val Leu Glu Pro Met Val Leu Leu 500 505 510 Lys Glu Phe Gly Leu Ile Ala Ala Asn Gly Asp Asn Pro Arg Gly Thr 515 520 525 Val Asp Val Ile Pro Leu Phe Glu Thr Ile Glu Asp Leu Gln Ala Gly 530 535 540 Ala Gly Ile Leu Asp Glu Leu Trp Lys Ile Asp Leu Tyr Arg Asn Tyr 545 550 555 560 Leu Leu Gln Arg Asp Asn Val Gln Glu Val Met Leu Gly Tyr Ser Asp 565 570 575 Ser Asn Lys Asp Gly Gly Tyr Phe Ser Ala Asn Trp Ala Leu Tyr Asp 580 585 590 Ala Glu Leu Gln Leu Val Glu Leu Cys Arg Ser Ala Gly Val Lys Leu 595 600 605 Arg Leu Phe His Gly Arg Gly Gly Thr Val Gly Arg Gly Gly Gly Pro 610 615 620 Ser Tyr Asp Ala Ile Leu Ala Gln Pro Arg Gly Ala Val Gln Gly Ser 625 630 635 640 Val Arg Ile Thr Glu Gln Gly Glu Ile Ile Ser Ala Lys Tyr Gly Asn 645 650 655 Pro Glu Thr Ala Arg Arg Asn Leu Glu Ala Leu Val Ser Ala Thr Leu 660 665 670 Glu Ala Ser Leu Leu Asp Val Ser Glu Leu Thr Asp His Gln Arg Ala 675 680 685 Tyr Asp Ile Met Ser Glu Ile Ser Glu Leu Ser Leu Lys Lys Tyr Ala 690 695 700 Ser Leu Val His Glu Asp Gln Gly Phe Ile Asp Tyr Phe Thr Gln Ser 705 710 715 720 Thr Pro Leu Gln Glu Ile Gly Ser Leu Asn Ile Gly Ser Arg Pro Ser 725 730 735 Ser Arg Lys Gln Thr Ser Ser Val Glu Asp Leu Arg Ala Ile Pro Trp 740 745 750 Val Leu Ser Trp Ser Gln Ser Arg Val Met Leu Pro Gly Trp Phe Gly 755 760 765 Val Gly Thr Ala Leu Glu Gln Trp Ile Gly Glu Gly Glu Gln Ala Thr 770 775 780 Gln Arg Ile Ala Glu Leu Gln Thr Leu Asn Glu Ser Trp Pro Phe Phe 785 790 795 800 Thr Ser Val Leu Asp Asn Met Ala Gln Val Met Ser Lys Ala Glu Leu 805 810 815 Arg Leu Ala Lys Leu Tyr Ala Asp Leu Ile Pro Asp Thr Glu Val Ala 820 825 830 Glu Arg Val Tyr Ser Val Ile Arg Glu Glu Tyr Phe Leu Thr Lys Lys 835 840 845 Met Phe Cys Val Ile Thr Gly Ser Asp Asp Leu Leu Asp Asp Asn Pro 850 855 860 Leu Leu Ala Arg Ser Val Gln Arg Arg Tyr Pro Tyr Leu Leu Pro Leu 865 870 875 880 Asn Val Ile Gln Val Glu Met Met Arg Arg Tyr Arg Lys Gly Asp Gln 885 890 895 Ser Glu Gln Val Ser Arg Asn Ile Gln Leu Thr Met Asn Gly Leu Ser 900 905 910 Thr Ala Leu Arg Asn Ser Gly 915 <210> 2 <211> 919 <212> PRT <213> Artificial Sequence <400> 2 Met Thr Asp Phe Leu Arg Asp Asp Ile Arg Phe Leu Gly Gln Ile Leu 1 5 10 15 Gly Glu Val Ile Ala Glu Gln Glu Gly Gln Asp Val Tyr Glu Leu Val 20 25 30 Glu Arg Ala Arg Leu Thr Ser Phe Asp Ile Ala Lys Gly Asn Ala Glu 35 40 45 Met Asp Ser Leu Val Gln Val Phe Asp Gly Ile Thr Pro Ala Lys Ala 50 55 60 Thr Pro Ile Ala Arg Ala Phe Ser His Phe Ala Leu Leu Ala Asn Leu 65 70 75 80 Ala Glu Asp Leu His Asp Glu Glu Leu Arg Glu Gln Ala Leu Asp Ala 85 90 95 Gly Asp Thr Pro Pro Asp Ser Thr Leu Asp Ala Thr Trp Leu Lys Leu 100 105 110 Asn Glu Gly Asn Val Gly Ala Glu Ala Val Ala Asp Val Leu Arg Asn 115 120 125 Ala Glu Val Ala Pro Val Leu Thr Ala His Pro Thr Glu Thr Arg Arg 130 135 140 Arg Thr Val Phe Asp Ala Gln Lys Trp Ile Thr Thr His Met Arg Glu 145 150 155 160 Arg His Ala Leu Gln Ser Ala Glu Pro Thr Ala Arg Thr Gln Ser Lys 165 170 175 Leu Asp Glu Leu Glu Lys Asn Ile Arg Arg Arg Ile Thr Ile Leu Trp 180 185 190 Gln Thr Ala Leu Ile Arg Val Ala Arg Pro Arg Ile Glu Asp Glu Ile 195 200 205 Glu Val Gly Leu Arg Tyr Tyr Lys Leu Ser Leu Leu Glu Glu Ile Pro 210 215 220 Arg Ile Asn Arg Asp Val Ala Val Glu Leu Arg Glu Arg Phe Gly Glu 225 230 235 240 Gly Val Pro Leu Lys Pro Val Val Lys Pro Gly Ser Trp Ile Gly Gly 245 250 255 Asp His Asp Gly Asn Pro Tyr Val Thr Ala Glu Thr Val Glu Tyr Ser 260 265 270 Thr His Arg Ala Ala Glu Thr Val Leu Lys Tyr Tyr Ala Arg Gln Leu 275 280 285 His Ser Leu Glu His Glu Leu Ser Leu Ser Asp Arg Met Asn Glu Val 290 295 300 Thr Pro Gln Leu Leu Ala Leu Ala Asp Ala Gly His Asn Asp Val Pro 305 310 315 320 Ser Arg Val Asp Glu Pro Tyr Arg Arg Ala Val His Gly Val Arg Gly 325 330 335 Arg Ile Leu Ala Thr Thr Ala Glu Leu Ile Gly Glu Asp Ala Val Glu 340 345 350 Gly Val Trp Phe Lys Val Phe Ala Pro Tyr Ala Ser Pro Glu Glu Phe 355 360 365 Leu Asn Asp Ala Leu Thr Ile Asp His Ser Leu Arg Glu Ser Lys Asp 370 375 380 Val Leu Ile Ala Asp Asp Arg Leu Ser Val Leu Ile Ser Ala Ile Glu 385 390 395 400 Ser Phe Gly Phe Asn Leu Tyr Ser Leu Asp Leu Arg Gln Asn Ser Glu 405 410 415 Ser Tyr Glu Asp Val Leu Thr Glu Leu Phe Glu Arg Ala Gln Val Thr 420 425 430 Ala Asn Tyr Arg Glu Leu Ser Glu Ala Glu Lys Leu Glu Val Leu Leu 435 440 445 Lys Glu Leu Arg Ser Pro Arg Pro Leu Ile Pro His Gly Ser Asp Glu 450 455 460 Tyr Ser Glu Val Thr Asp Arg Glu Leu Gly Ile Phe Arg Thr Ala Ser 465 470 475 480 Glu Ala Val Lys Lys Phe Gly Pro Arg Met Val Pro His Cys Ile Ile 485 490 495 Ser Met Ala Ser Ser Val Thr Asp Val Leu Glu Pro Met Val Leu Leu 500 505 510 Lys Glu Phe Gly Leu Ile Ala Ala Asn Gly Asp Asn Pro Arg Gly Thr 515 520 525 Val Asp Val Ile Pro Leu Phe Glu Thr Ile Glu Asp Leu Arg Ala Gly 530 535 540 Ala Gly Ile Leu Asp Glu Leu Trp Lys Ile Asp Leu Tyr Arg Asn Tyr 545 550 555 560 Leu Leu Gln Arg Asp Asn Val Gln Glu Val Met Leu Gly Tyr Ser Asp 565 570 575 Ser Asn Lys Asp Gly Gly Tyr Phe Ser Ala Asn Trp Ala Leu Tyr Asp 580 585 590 Ala Glu Leu Gln Leu Val Glu Leu Cys Arg Ser Ala Gly Val Lys Leu 595 600 605 Arg Leu Phe His Gly Arg Gly Gly Thr Val Gly Arg Gly Gly Gly Pro 610 615 620 Ser Tyr Asp Ala Ile Leu Ala Gln Pro Lys Gly Ala Val Gln Gly Ser 625 630 635 640 Val Arg Ile Thr Glu Gln Gly Glu Ile Ile Ser Ala Lys Tyr Gly Asn 645 650 655 Pro Glu Thr Ala Arg Arg Asn Leu Glu Ala Leu Val Ser Ala Thr Leu 660 665 670 Glu Ala Ser Leu Leu Asp Val Ser Glu Leu Thr Asp His Gln Arg Ala 675 680 685 Tyr Asp Ile Met Ser Glu Ile Ser Glu Leu Ser Leu Lys Lys Tyr Ala 690 695 700 Ser Leu Val His Glu Asp Gln Gly Phe Ile Asp Tyr Phe Thr Gln Ser 705 710 715 720 Thr Pro Leu Gln Glu Ile Gly Ser Leu Asn Ile Gly Ser Arg Pro Ser 725 730 735 Ser Arg Lys Gln Thr Ser Ser Val Glu Asp Leu Arg Ala Ile Pro Trp 740 745 750 Val Leu Ser Trp Ser Gln Ser Arg Val Met Leu Pro Gly Trp Phe Gly 755 760 765 Val Gly Thr Ala Leu Glu Gln Trp Ile Gly Glu Gly Glu Gln Ala Thr 770 775 780 Gln Arg Ile Ala Glu Leu Gln Thr Leu Asn Glu Ser Trp Pro Phe Phe 785 790 795 800 Thr Ser Val Leu Asp Asn Met Ala Gln Val Met Ser Lys Ala Glu Leu 805 810 815 Arg Leu Ala Lys Leu Tyr Ala Asp Leu Ile Pro Asp Thr Glu Val Ala 820 825 830 Glu Arg Val Tyr Ser Val Ile His Glu Glu Tyr Phe Leu Thr Lys Lys 835 840 845 Met Phe Cys Val Ile Thr Gly Ser Asp Asp Leu Leu Asp Asp Asn Pro 850 855 860 Leu Leu Ala Arg Ser Val Gln Arg Arg Tyr Pro Tyr Leu Leu Pro Leu 865 870 875 880 Asn Val Ile Gln Val Glu Met Met Arg Arg Tyr Arg Lys Gly Asp Gln 885 890 895 Ser Glu Gln Val Ser Arg Asn Ile Gln Leu Thr Met Asn Gly Leu Ser 900 905 910 Thr Ala Leu Arg Asn Ser Gly 915 <210> 3 <211> 2760 <212> DNA <213> Artificial Sequence <400> 3 atgactgatt ttttacgcga tgacatcagg ttcctcggtc aaatcctcgg tgaggtaatt 60 gcggaacaag aaggccagga ggtttatgaa ctggtcgaac aagcgcgcct gacttctttt 120 gatatcgcca agggcaacgc cgaaatggat agcctggttc aggttttcga cggcattact 180 ccagccaagg caacaccgat tgctcgcgca ttttcccact tcgctctgct ggctaacctg 240 gcggaagacc tctacgatga agagcttcgt gaacaggctc tcgatgcagg cgacacccct 300 ccggacagca ctcttgatgc cacctggctg aaactcaatg agggcaatgt tggcgcagaa 360 gctgtggccg atgtgctgcg caatgctgag gtggcgccgg ttctgactgc gcacccaact 420 gagactcgcc gccgcactgt ttttgatgcg caaaagtgga tcaccaccca catgcgtgaa 480 cgccacgctt tgcagtctgc ggagcctacc gctcgtacgc aaagcaagtt ggatgagatc 540 gagaagaaca tccgccgtcg catcaccatt ttgtggcaga ccgcgttgat tcgtgtggcc 600 cgcccacgta tcgaggacga gatcgaagta gggctgcgct actacaagct gagccttttg 660 gaagagattc cacgtatcaa ccgtgatgtg gctgttgagc ttcgtgagcg tttcggcgag 720 ggtgttcctt tgaagcccgt ggtcaagcca ggttcctgga ttggtggaga ccacgacggt 780 aacccttatg tcaccgcgga aacagttgag tattccactc accgcgctgc ggaaaccgtg 840 ctcaagtact atgcacgcca gctgcattcc ctcgagcatg agctcagcct gtcggaccgc 900 atgaataagg tcaccccgca gctgcttgcg ctggcagatg cagggcacaa cgacgtgcca 960 agccgcgtgg atgagcctta tcgacgcgcc gtccatggcg ttcgcggacg tatcctcgcg 1020 acgacggccg agctgatcgg cgaggacgcc gttgagggcg tgtggttcaa ggtctttact 1080 ccatacgcat ctccggaaga attcttaaac gatgcgttga ccattgatca ttctctgcgt 1140 gaatccaagg acgttctcat tgccgatgat cgtttgtctg tgctgatttc tgccatcgag 1200 agctttggat tcaaccttta cgcactggat ctgcgccaaa actccgaaag ctacgaggac 1260 gtcctcaccg agcttttcga acgcgcccaa gtcaccgcaa actaccgcga gctgtctgaa 1320 gcagagaagc ttgaggtgct gctgaaggaa ctgcgcagcc ctcgtccgct gatcccgcac 1380 ggttcagatg aatacagcga ggtcaccgac cgcgagctcg gcatcttccg caccgcgtcg 1440 gaggctgtta agaaattcgg gccacggatg gtgcctcact gcatcatctc catggcatca 1500 tcggtcaccg atgtgctcga gccgatggtg ttgctcaagg aattcggact catcgcagcc 1560 aacggcgaca acccacgcgg caccgtcgat gtcatcccac tgttcgaaac catcgaagat 1620 ctccaggccg gcgccggaat cctcgacgaa ctgtggaaaa ttgatctcta ccgcaactac 1680 ctcctgcagc gcgacaacgt ccaggaagtc atgctcggtt actccgattc caacaaggat 1740 ggcggatatt tctccgcaaa ctgggcgctt tacgacgcgg aactgcagct cgtcgaacta 1800 tgccgatcag ccggggtcaa gcttcgcctg ttccacggcc gtggtggcac cgtcggccgc 1860 ggtggcggac cttcctacga cgcgattctt gcccagccca ggggggctgt ccaaggttcc 1920 gtgcgcatca ccgagcaggg cgagatcatc tccgctaagt acggcaaccc cgaaaccgcg 1980 cgccgaaacc tcgaagccct ggtctcagcc acgcttgagg catcgcttct cgacgtctcc gaactcaccg atcaccaacg cgcgtacgac atcatgagtg agatctctga gctcagcttg aagaagtacg cctccttggt gcacgaggat caaggcttca tcgattactt cacccagtcc acgccgctgc aggagattgg atccctcaac atcggatcca ggccttcctc acgcaagcag acctcctcgg tggaagattt gcgagccatc ccatgggtgc tcagctggtc acagtctcgt 2280 gtcatgctgc caggctggtt tggtgtcgga accgcattag agcagtggat tggcgaaggg 2340 2400. gagcaggcca cccaacgcat tgccgagctg caaacactca atgagtcctg gccatttttc acctcagtgt tggataacat ggctcaggtg atgtccaagg cagagctgcg tttggcaaag ctctacgcag acctgatccc agatacgga gtagccgagc gagtctattc cgtcatccgc gaggagtact tcctgaccaa gagatgttc tgcgtaatca ccggctctga tgatctgctt gatgacaacc cacttctcgc acgctctgtc cagcgccgat acccctacct gcttccactc 2640 aacgtgatcc aggtagat gatgcgacgc taccgaaaag gcgaccaaag cgagcaagtg tcccgcaaca ttcagctgac catgaacggt ctttccactg cgctgcgcaa ctccggctag 2760 <210> 4 <211> 2760 <212> DNA <213> Artificial Sequence <400> 4 atgactgatt ttttacgcga tgacatcagg ttcctcggtc aaatcctcgg tgaggtaatt 60 gcggaacaag aaggccagga cgtttatgaa ctggtcgaac gagcgcgcct gacttctttt 120 gatatcgcca agggcaacgc cgaaatggat agcctggttc aggttttcga cggcattact 180 ccagccaagg caacaccgat tgctcgcgca ttttcccact tcgctctgct ggctaacctg 240 gcggaagacc tccacgatga agagcttcgt gaacaggctc tcgatgcagg cgacacccct 300 ccggacagca ctcttgatgc cacctggctg aaactcaatg agggcaatgt tggcgcagaa 360 gctgtggccg atgtgctgcg caatgctgag gtggcgccgg ttctgactgc gcacccaact 420 gagactcgcc gccgcactgt ttttgatgcg caaaagtgga tcaccaccca catgcgtgaa 480 cgccacgctt tgcagtctgc ggagcctacc gctcgtacgc aaagcaagtt ggatgagctc 540 gagaagaaca tccgccgtcg catcaccatt ttgtggcaga ccgcgttgat tcgtgtggcc 600 cgcccacgta tcgaggacga gatcgaagta gggctgcgct actacaagct gagccttttg 660 gaagagattc cacgtatcaa ccgtgatgtg gctgttgagc ttcgtgagcg tttcggcgag 720 ggtgttcctt tgaagcccgt ggtcaagcca ggttcctgga ttggtggaga ccacgacggt 780 aacccttatg tcaccgcgga aacagttgag tattccactc accgcgctgc ggaaaccgtg 840 ctcaagtact atgcacgcca gctgcattcc ctcgagcatg agctcagcct gtcggaccgc 900 atgaatgagg tcaccccgca gctgcttgcg ctggcagatg cagggcacaa cgacgtgcca 960 agccgcgtgg atgagcctta tcgacgcgcc gtccatggcg ttcgcggacg tatcctcgcg 1020 acgacggccg agctgatcgg cgaggacgcc gttgagggcg tgtggttcaa ggtctttgct 1080 ccatacgcat ctccggaaga attcttaaac gatgcgttga ccattgatca ttctctgcgt 1140 gaatccaagg acgttctcat tgccgatgat cgtttgtctg tgctgatttc tgccatcgag 1200 agctttggat tcaaccttta cagtctggat ctgcgccaaa actccgaaag ctacgaggac 1260 gtcctcaccg agcttttcga acgcgcccaa gtcaccgcaa actaccgcga gctgtctgaa 1320 gcagagaagc ttgaggtgct gctgaaggaa ctgcgcagcc ctcgtccgct gatcccgcac 1380 ggttcagatg aatacagcga ggtcaccgac cgcgagctcg gcatcttccg caccgcgtcg 1440 gaggctgtta agaaattcgg gccacggatg gtgcctcact gcatcatctc catggcatca 1500 tcggtcaccg atgtgctcga gccgatggtg ttgctcaagg aattcggact catcgcagcc 1560 aacggcgaca acccacgcgg caccgtcgat gtcatcccac tgttcgaaac catcgaagat 1620 ctccgggccg gcgccggaat cctcgacgaa ctgtggaaaa ttgatctcta ccgcaactac 1680 ctcctgcagc gcgacaacgt ccaggaagtc atgctcggtt actccgattc caacaaggat 1740 ggcggatatt tctccgcaaa ctgggcgctt tacgacgcgg aactgcagct cgtcgaacta 1800 tgccgatcag ccggggtcaa gcttcgcctg ttccacggcc gtggtggcac cgtcggccgc 1860 ggtggcggac cttcctacga cgcgattctt gcccagccca agggggctgt ccaaggttcc 1920 gtgcgcatca ccgagcaggg cgagatcatc tccgctaagt acggcaaccc cgaaaccgcg 1980 cgccgaaacc tcgaagccct ggtctcagcc acgcttgagg catcgcttct cgacgtctcc gaactcaccg atcaccaacg cgcgtacgac atcatgagtg agatctctga gctcagcttg aagaagtacg cctccttggt gcacgaggat caaggcttca tcgattactt cacccagtcc acgccgctgc aggagattgg atccctcaac atcggatcca ggccttcctc acgcaagcag acctcctcgg tggaagattt gcgagccatc ccatgggtgc tcagctggtc acagtctcgt 2280 gtcatgctgc caggctggtt tggtgtcgga accgcattag agcagtggat tggcgaaggg 2340 2400. gagcaggcca cccaacgcat tgccgagctg caaacactca atgagtcctg gccatttttc acctcagtgt tggataacat ggctcaggtg atgtccaagg cagagctgcg tttggcaaag ctctacgcag acctgatccc agatacgga gtagccgagc gagtctattc cgtcatccac gaggagtact tcctgaccaa gagatgttc tgcgtaatca ccggctctga tgatctgctt gatgacaacc cacttctcgc acgctctgtc cagcgccgat acccctacct gcttccactc 2640 aacgtgatcc aggtagat gatgcgacgc taccgaaaag gcgaccaaag cgagcaagtg tcccgcaaca ttcagctgac catgaacggt ctttccactg cgctgcgcaa ctccggctag 2760 <210> 5 <211> twenty one <212> DNA <213> Artificial Sequence <400> 5 tgtgagcgga taacaatttc a 21 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <400> 6 ttctgattta atctgtatca ggctga 26 <210> 7 <211> 38 <212> DNA <213> Artificial Sequence <400> 7 tccccccggg atgactgatt ttttacgcga tgacatca 38 <210> 8 <211> 41 <212> DNA <213> Artificial Sequence <400> 8 tccccccggg ctagccggag ttgcgcagcg cagtggaaag a 41
Claims
1. A phosphoenolpyruvate carboxylase mutant, characterized in that, The phosphoenolpyruvate carboxylase mutant is mutated from the amino acid sequence of phosphoenolpyruvate carboxylase as follows: the 27th is mutated from glutamic acid to aspartic acid, the 34th is mutated from glutamine to arginine, the 85th is mutated from tyrosine to histidine, the 180th is mutated from isoleucine to leucine, the 303th is mutated from lysine to glutamic acid, the 360th is mutated from threonine to alanine, the 408th is mutated from alanine to serine, the 542th is mutated from glutamine to arginine, the 634th is mutated from arginine to lysine, and the 840th is mutated from arginine to histidine; the amino acid sequence of the phosphoenolpyruvate carboxylase is shown as SEQ ID NO.
1.
2. A nucleic acid, characterized in that, The nucleic acid is used for encoding the phosphoenolpyruvate carboxylase mutant of claim 1.
3. A recombinant microorganism, characterized in that, The amino acid sequence of the phosphoenolpyruvate carboxylase in the recombinant microorganism is mutated as follows: the 27th is mutated from glutamic acid to aspartic acid, the 34th is mutated from glutamine to arginine, the 85th is mutated from tyrosine to histidine, the 180th is mutated from isoleucine to leucine, the 303th is mutated from lysine to glutamic acid, the 360th is mutated from threonine to alanine, the 408th is mutated from alanine to serine, the 542th is mutated from glutamine to arginine, the 634th is mutated from arginine to lysine, and the 840th is mutated from arginine to histidine; the amino acid sequence of the phosphoenolpyruvate carboxylase is shown as SEQ ID NO.
1. The microorganism is Corynebacterium glutamicum.
4. The phosphoenolpyruvate carboxylase mutant of claim 1 or the nucleic acid of claim 2 is used for improving the amino acid yield of Corynebacterium glutamicum. The amino acid is glutamic acid, glutamine or proline.
5. The recombinant microorganism of claim 3 is used for producing amino acid; and the amino acid is glutamic acid, glutamine or proline.
Citation Information
Patent Citations
Strain for producing L-glutamine and method for producing L-glutamine
CN106701649A
A strain of Corynebacterium glutamicum, its construction method and application
CN107227283B
Corynebacterium glutamicum for high-yield production of glutamic acid and application of corynebacterium glutamicum
CN112322594A
Recombinant strain and application thereof
CN105695383A
Corynebacterium glutamicum and its construction method and application
CN107227283A