Internal sulfonamide derivatives and uses thereof
By designing sulfonamide derivative compounds, the problem that existing anti-hepatitis B drugs cannot completely cure the disease was solved, and significant inhibition and safe treatment effects on the hepatitis B virus were achieved.
Patent Information
- Application Number
- CN202180043987.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-09-30
- Filing Date
- 2021-04-21
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2041-04-21
AI Technical Summary
There is currently a lack of effective drugs for the treatment of hepatitis B. Existing drugs cannot completely cure the disease and have side effects, requiring long-term medication. It is urgent to develop more effective and safe anti-hepatitis B drugs.
Provided is a class of sulfonamide derivative compounds or pharmaceutically acceptable salts thereof, which, through specific structural design, have significant anti-hepatitis B virus inhibitory effects and good pharmacokinetic properties.
The compound shows significant anti-hepatitis B virus inhibitory effect, has ideal in vitro pharmacokinetic experimental results and good liver-blood ratio distribution, providing a more effective and safe treatment option.
Smart Images

Figure CN115702152B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a class of internal sulfonamide derivatives, and the use in the preparation of drugs for treating related diseases. Specifically relates to the compound shown in formula (II) or its pharmaceutically acceptable salt. BACKGROUND
[0002] Hepatitis B is caused by hepatitis B virus invasion caused by inflammation of the liver disease mainly, and can cause multiple organ damage of an infectious disease, which is easy to develop into liver fibrosis, cirrhosis and liver cancer, is the direct cause of 80% of global primary liver cancer. It is widely prevalent in countries around the world, according to reports, about 257 million people worldwide infected with hepatitis B virus, about 887,000 people die of hepatitis B virus infection related diseases each year; China is the hardest hit area of hepatitis B virus infection, the total number of infections is about 70 million, 1 million new cases each year, 330,000 deaths.
[0003] Hepatitis B is a worldwide medical problem, there is no specific treatment for hepatitis B in the world, the first-line drugs for hepatitis B are mainly nucleoside and interferon drugs, but these drugs cannot be completely cured, and long-term medication is needed, and there are many problems such as renal insufficiency, lactic acid moderate, therefore, it is imperative to develop a new type of anti-hepatitis B drug that provides more effective and safe for patients. SUMMARY
[0004] The present application provides a compound represented by formula (III) or a pharmaceutically acceptable salt thereof,
[0005]
[0006] wherein,
[0007] each R1 is independently selected from halogen, OH, CN, NH2, C 1-3 alkyl and C 1-3 alkoxy, said C 1-3 alkyl and C 1-3 alkoxy is optionally substituted with 1, 2 or 3 halogens;
[0008] m is selected from 0, 1, 2 and 3;
[0009] when R2 is selected from -COOH, T is selected from NCH3 and CH;
[0010] or, when R2 is selected from H, T is selected from CH;
[0011] L1 is selected from -O(CH2) n -, -(CH2) n - and -CH=CH-;
[0012] each n is independently selected from 1, 2, 3, 4, 5 and 6;
[0013] Ring A is selected from phenyl and pyridyl;
[0014] Ring B does not exist, that is, L1 is directly connected to ring C;
[0015] Or ring B is selected from cyclohexyl, piperidinyl, piperazinyl, phenyl and 5-6 membered heteroaryl, wherein the cyclohexyl, piperidinyl, piperazinyl, phenyl and 5-6 membered heteroaryl are optionally substituted by 1, 2 or 3 R a replace;
[0016] Ring C is selected from 5-6 membered heteroaryl, wherein the 5-6 membered heteroaryl is optionally substituted by 1 or 2 R b replace;
[0017] Each R a 、R b are independently selected from halogen, OH, CN, NH2, C 1-3 Alkyl and C 1-3 Alkoxy, the C 1-3 Alkyl and C 1-3 The alkoxy group is optionally substituted with 1, 2 or 3 halogens;
[0018] The 5-6 membered heteroaryl group contains 1, 2 or 3 heteroatoms or heteroatom groups independently selected from O, S, N and NH.
[0019] In some embodiments of the present invention, each of the above R1 is independently selected from F, Cl, Br, C 1-3 Alkyl and C 1-3 Alkoxy, the C 1-3 Alkyl and C 1-3 The alkoxy group is optionally substituted with 1, 2 or 3 halogens, and the other variables are as defined herein.
[0020] In some embodiments of the present invention, each of the above R1 is independently selected from F, Cl, Br, CH3, CF3, OCH3 and OCF3, and other variables are as defined in the present invention.
[0021] In some embodiments of the present invention, the above L1 is selected from -OCH2-, -(CH2) n - and -CH=CH-, and other variables are as defined in the present invention.
[0022] In some embodiments of the present invention, the above-mentioned L1 is selected from -OCH2-, -CH2-, -(CH2)2-, -(CH2)3-, -(CH2)5- and -CH=CH-, and other variables are as defined in the present invention.
[0023] In some embodiments of the present invention, the above R a and R bare independently selected from F, Cl, Br, CH3 and OCH3, said CH3 and OCH3 are optionally substituted with 1, 2 or 3 F, and other variables are as defined herein.
[0024] In some embodiments of the present invention, the above R a and R b are independently selected from F and Cl, and other variables are as defined in the present invention.
[0025] In some embodiments of the present invention, the ring B is selected from the group consisting of: absence, cyclohexyl, piperidinyl, piperazinyl, phenyl, imidazolyl and pyridinyl, wherein the cyclohexyl, piperidinyl, piperazinyl, phenyl, imidazolyl and pyridinyl are optionally replaced by 1, 2 or 3 R a Substitution, other variables are as defined in the present invention.
[0026] In some embodiments of the present invention, the ring B is selected from the group consisting of absent, phenyl, imidazolyl and pyridyl, and other variables are as defined herein.
[0027] In some embodiments of the present invention, the ring B is selected from the group consisting of: Other variables are as defined in the present invention.
[0028] In some embodiments of the present invention, the ring C is selected from thienyl, thiazolyl, imidazolyl and pyridyl, and the ring C is selected from thienyl, thiazolyl, imidazolyl and pyridyl, and is optionally substituted by 1 or 2 R b Substitution, other variables are as defined in the present invention.
[0029] In some embodiments of the present invention, the ring C is selected from thienyl, thiazolyl, imidazolyl and pyridyl, and other variables are as defined herein.
[0030] In some embodiments of the present invention, the above-mentioned compound or a pharmaceutically acceptable salt thereof is selected from:
[0031]
[0032] R1, R2, L1, m, Ring A, Ring B and Ring C are as defined herein.
[0033] In some embodiments of the present invention, the above-mentioned compound or a pharmaceutically acceptable salt thereof is selected from:
[0034]
[0035] wherein R1, R2, L1, m and ring B are as defined in the present invention;
[0036] T1 is selected from CH and N;
[0037] T2 and T3 are independently selected from CH and N, and T2 and T3 are not N at the same time.
[0038] The present invention provides a compound represented by formula (I) or a pharmaceutically acceptable salt thereof,
[0039]
[0040] in,
[0041] Each R1 is independently selected from halogen, OH, CN, NH2, C 1-3 Alkyl and C 1-3 Alkoxy, the C 1-3 Alkyl and C 1-3 The alkoxy group is optionally substituted with 1, 2 or 3 halogens;
[0042] m is selected from 0, 1, 2 and 3;
[0043] L1 is selected from -O(CH2) n -、-(CH2) n - and -CH=CH-;
[0044] Each n is independently selected from 1, 2, 3, 4, 5 and 6;
[0045] Ring A is selected from phenyl and pyridyl;
[0046] Ring B does not exist, that is, L1 is directly connected to ring C;
[0047] Or ring B is selected from phenyl and 5-6 membered heteroaryl, wherein the phenyl and 5-6 membered heteroaryl are optionally substituted by 1, 2 or 3 R a replace;
[0048] Ring C is selected from 5-6 membered heteroaryl, said 5-6 membered heteroaryl being optionally substituted by 1, 2 or R b replace;
[0049] Each R a 、R b are independently selected from halogen, OH, CN, NH2, C 1-3 Alkyl and C 1-3 Alkoxy, the C 1-3 Alkyl and C 1-3 The alkoxy group is optionally substituted with 1, 2 or 3 halogens;
[0050] The 5-6 membered heteroaryl group contains 1, 2 or 3 heteroatoms or heteroatom groups independently selected from O, S and N.
[0051] In some embodiments of the present invention, each of the above R1 is independently selected from F, Cl, Br, C 1-3 Alkyl and C 1-3alkyl and C 1-3 alkyl and C 1-3 alkoxy is optionally substituted with 1, 2, or 3 halo, and other variables are as defined herein.
[0052] In some embodiments of the present application, each R1is independently selected from F, Cl, Br, CH3, CF3, OCH3, and OCF3, and other variables are as defined herein.
[0053] In some embodiments of the present application, L1is selected from -OCH2-, -(CH2) n - and -CH=CH-, and other variables are as defined herein.
[0054] In some embodiments of the present application, L1is selected from -OCH2-, -CH2-, -(CH2)2-, -(CH2)3-, -(CH2)5-, and -CH=CH-, and other variables are as defined herein.
[0055] In some embodiments of the present application, each R a , R b is independently selected from F, Cl, Br, CH3, and OCH3, said CH3and OCH3are optionally substituted with 1, 2, or 3 F, and other variables are as defined herein.
[0056] In some embodiments of the present application, ring B is selected from absent, phenyl, imidazolyl, and pyridyl, and other variables are as defined herein.
[0057] In some embodiments of the present application, ring B is selected from absent, and other variables are as defined herein.
[0058] In some embodiments of the present application, ring C is selected from thienyl, imidazolyl, and pyridyl, said ring C is optionally substituted with 1 or 2 R b , and other variables are as defined herein.
[0059] In some embodiments of the present application, ring C is selected from thienyl, imidazolyl, and pyridyl, and other variables are as defined herein.
[0060] In some embodiments of the present application, the compound or a pharmaceutically acceptable salt thereof is selected from:
[0061]
[0062] wherein R1, L1, m, and ring B are as defined in any one of the present application.
[0063] The present application provides a compound represented by formula (I) or a pharmaceutically acceptable salt thereof,
[0064]
[0065] in,
[0066] Each R1 is independently selected from halogen, OH, CN, NH2, C 1-3 Alkyl and C 1-3 Alkoxy, the C 1-3 Alkyl and C 1-3 The alkoxy group is optionally substituted with 1, 2 or 3 halogens;
[0067] m is selected from 0, 1, 2 and 3;
[0068] L1 is selected from -O(CH2) n -、-(CH2) n - and -CH=CH-;
[0069] Each n is independently selected from 1, 2, 3, 4, 5 and 6;
[0070] Ring A is selected from phenyl and pyridyl;
[0071] Ring B does not exist, that is, L1 is directly connected to ring C;
[0072] Or ring B is selected from cyclohexyl, piperidinyl, phenyl and 5-6 membered heteroaryl, wherein the cyclohexyl, piperidinyl, phenyl and 5-6 membered heteroaryl are optionally substituted by 1, 2 or 3 R a replace;
[0073] Ring C is selected from 5-6 membered heteroaryl, said 5-6 membered heteroaryl being optionally substituted by 1, 2 or R b replace;
[0074] Each R a 、R b are independently selected from halogen, OH, CN, NH2, C 1-3 Alkyl and C 1-3 Alkoxy, the C 1-3 Alkyl and C 1-3 The alkoxy group is optionally substituted with 1, 2 or 3 halogens;
[0075] The 5-6 membered heteroaryl group contains 1, 2 or 3 heteroatoms or heteroatom groups independently selected from O, S and N.
[0076] In some embodiments of the present invention, each of the above R1 is independently selected from F, Cl, Br, C 1-3 Alkyl and C 1-3 Alkoxy, the C 1-3 Alkyl and C 1-3 The alkoxy group is optionally substituted with 1, 2 or 3 halogens, and the other variables are as defined herein.
[0077] In some embodiments of the application, each R1is independently selected from F, Cl, Br, CH3, CF3, OCH3, and OCF3, and the other variables are as defined in the application.
[0078] In some embodiments of the application, L1is selected from -OCH2-, -(CH2) n - and -CH=CH-, and the other variables are as defined in the application.
[0079] In some embodiments of the application, L1is selected from -OCH2-, -CH2-, -(CH2)2-, -(CH2)3-, -(CH2)5-, and -CH=CH-, and the other variables are as defined in the application.
[0080] In some embodiments of the application, each R a , R b is independently selected from F, Cl, Br, CH3, and OCH3, said CH3and OCH3are optionally substituted with 1, 2, or 3 F, and the other variables are as defined in the application.
[0081] In some embodiments of the application, each R a , R b is independently selected from F, Cl, and the other variables are as defined in the application.
[0082] In some embodiments of the application, ring B is selected from absent, cyclohexyl, piperidinyl, phenyl, imidazolyl, and pyridinyl, said cyclohexyl, piperidinyl, phenyl, imidazolyl, and pyridinyl are optionally substituted with 1, 2, or 3 R a , and the other variables are as defined in the application.
[0083] In some embodiments of the application, ring B is selected from absent, phenyl, imidazolyl, and pyridinyl, and the other variables are as defined in the application.
[0084] In some embodiments of the application, ring B is selected from absent, and the other variables are as defined in the application.
[0085] In some embodiments of the application, ring C is selected from thienyl, thiazolyl, imidazolyl, and pyridinyl, said ring C is optionally substituted with 1 or 2 R b , and the other variables are as defined in the application.
[0086] In some embodiments of the application, ring C is selected from thienyl, thiazolyl, imidazolyl, and pyridinyl, and the other variables are as defined in the application.
[0087] In some embodiments of the present invention, the above-mentioned compound or a pharmaceutically acceptable salt thereof is selected from:
[0088]
[0089] wherein R1, L1, m and ring B are as defined in any one of the present invention;
[0090] T1 is selected from CH and N;
[0091] T2 and T3 are independently selected from CH and N, and T2 and T3 are not N at the same time.
[0092] The present invention provides a compound represented by formula (II) or a pharmaceutically acceptable salt thereof,
[0093]
[0094] in,
[0095] Each R1 is independently selected from halogen, OH, CN, NH2, C 1-3 Alkyl and C 1-3 Alkoxy, the C 1-3 Alkyl and C 1-3 The alkoxy group is optionally substituted with 1, 2 or 3 halogens;
[0096] m is selected from 0, 1, 2 and 3;
[0097] R2 is selected from H and -COOH;
[0098] L1 is selected from -(CH2) n -, the -(CH2) n - optionally substituted with 1, 2 or 3 halogens;
[0099] Each n is independently selected from 0, 1, 2, 3, 4, 5 and 6;
[0100] Ring A is selected from phenyl and pyridyl;
[0101] Ring B does not exist, that is, L1 is directly connected to ring C;
[0102] Or ring B is selected from C 3-6 Cycloalkyl, phenyl and 5-6 membered heteroaryl, the C 3-6 Cycloalkyl, phenyl and 5-6 membered heteroaryl are optionally substituted by 1, 2 or 3 R a replace;
[0103] Ring C is selected from 5-6 membered heteroaryl, said 5-6 membered heteroaryl being optionally substituted by 1, 2 or 3 R b replace;
[0104] Each R a 、Rb are independently selected from halogen, OH, CN, NH2, C 1-3 Alkyl and C 1-3 Alkoxy, the C 1-3 Alkyl and C 1-3 The alkoxy group is optionally substituted with 1, 2 or 3 halogens;
[0105] The 5-6 membered heteroaryl group contains 1, 2 or 3 heteroatoms or heteroatom groups independently selected from O, S and N.
[0106] In some embodiments of the present invention, each of the above R1 is independently selected from F, Cl, Br, C 1-3 Alkyl and C 1-3 Alkoxy, the C 1-3 Alkyl and C 1-3 The alkoxy group is optionally substituted with 1, 2 or 3 halogens, and the other variables are as defined herein.
[0107] In some embodiments of the present invention, each of the above R1 is independently selected from F, Cl, Br, CH3, CF3, OCH3 and OCF3, and other variables are as defined in the present invention.
[0108] In some embodiments of the present invention, the above L1 is selected from absent, -CH2-, -(CH2)2- and -(CH2)3-, and other variables are as defined in the present invention.
[0109] In some embodiments of the present invention, the above R a 、R b are independently selected from F, Cl, Br, CH3 and OCH3, said CH3 and OCH3 are optionally substituted with 1, 2 or 3 F, and other variables are as defined herein.
[0110] In some embodiments of the present invention, the ring B is selected from the group consisting of: absence, cyclohexyl, phenyl, imidazolyl and pyridyl, wherein the cyclohexyl, phenyl, imidazolyl and pyridyl are optionally replaced by 1, 2 or 3 R a Substitution, other variables are as defined in the present invention.
[0111] In some embodiments of the present invention, the ring B is selected from the group consisting of: Other variables are as defined in the present invention.
[0112] In some embodiments of the present invention, the ring C is selected from thienyl, imidazolyl and pyridyl, and the thienyl, imidazolyl and pyridyl are optionally substituted by 1 or 2 R b Substitution, other variables are as defined in the present invention.
[0113] In some embodiments of the present invention, the ring C is selected from Other variables are as defined in the present invention.
[0114] In some embodiments of the present invention, the above-mentioned compound or a pharmaceutically acceptable salt thereof is selected from:
[0115]
[0116] wherein R1, R2, L1, m and ring B are as defined in any one of the present invention.
[0117] Some other solutions of the present invention are obtained by arbitrarily combining the above variables.
[0118] The present invention also provides the following compounds or pharmaceutically acceptable salts thereof, which are selected from:
[0119]
[0120]
[0121] The present invention also provides the following compounds or pharmaceutically acceptable salts thereof, which are selected from:
[0122]
[0123]
[0124] The present invention also provides use of the above-mentioned compound or a pharmaceutically acceptable salt thereof in the preparation of a drug for treating core protein regulator-related diseases.
[0125] Technical Effects
[0126] As a new type of anti-hepatitis B drug, the compound of the present invention has a significant inhibitory effect on HBV, has relatively ideal in vitro pharmacokinetic experimental results and a better liver-blood ratio distribution.
[0127] Definition and Description
[0128] Unless otherwise indicated, the following terms and phrases used herein are intended to have the following meanings. A particular term or phrase should not be construed as indefinite or unclear unless specifically defined, but rather should be understood in accordance with its ordinary meaning. When a trade name appears in this document, it is intended to refer to the corresponding commercial product or its active ingredient.
[0129] The term "pharmaceutically acceptable" as used herein refers to those compounds, materials, compositions and / or dosage forms which, within the scope of sound medical judgment, are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response or other problems or complications, commensurate with a reasonable benefit / risk ratio.
[0130] The term "pharmaceutically acceptable salt" refers to salts of the compounds of the present invention, prepared by reacting the compounds of the present invention with relatively nontoxic acids or bases. When the compounds of the present invention contain relatively acidic functional groups, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of base in neat solution or in a suitable inert solvent. Pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amine, or magnesium salts, or similar salts. When the compounds of the present invention contain relatively basic functional groups, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of acid in neat solution or in a suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include inorganic acid salts such as hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, bicarbonate, phosphoric acid, monohydrogen phosphate, dihydrogen phosphate, sulfuric acid, bisulfate, hydroiodic acid, phosphorous acid, and the like; and organic acid salts such as acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, suberic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-toluenesulfonic acid, citric acid, tartaric acid, and methanesulfonic acid, as well as salts of amino acids (such as arginine) and organic acids such as glucuronic acid. Certain specific compounds of the present invention contain both basic and acidic functional groups and can be converted into either base or acid addition salts.
[0131] Pharmaceutically acceptable salts of the present invention can be synthesized by conventional chemical methods from parent compounds containing acid radicals or bases. Generally, such salts are prepared by reacting these compounds in free acid or base form with a stoichiometric amount of a suitable base or acid in water or an organic solvent or a mixture of the two.
[0132] Unless otherwise indicated, the term "isomer" is intended to include geometric isomers, cis-trans isomers, stereoisomers, enantiomers, optical isomers, diastereomers and tautomers.
[0133] The compounds of the present invention may exist in specific geometric or stereoisomeric forms. The present invention contemplates all such compounds, including cis- and trans-isomers, (-)- and (+)-enantiomers, (R)- and (S)-enantiomers, diastereomers, (D)-isomers, (L)-isomers, and racemic mixtures and other mixtures thereof, such as enantiomerically or diastereomerically enriched mixtures, all of which are within the scope of the present invention. Additional asymmetric carbon atoms may be present in substituents such as alkyl groups. All such isomers and mixtures thereof are encompassed within the scope of the present invention.
[0134] Unless otherwise indicated, the term "enantiomer" or "optical isomer" refers to stereoisomers that are mirror images of one another.
[0135] Unless otherwise indicated, the term "cis-trans isomers" or "geometric isomers" arises from the inability to rotate freely about double bonds or single bonds forming ring carbon atoms.
[0136] Unless otherwise indicated, the term "diastereomer" refers to stereoisomers that have two or more chiral centers and that are not mirror images of each other.
[0137] Unless otherwise indicated, "(+)" indicates dextrorotatory, "(-)" indicates levorotatory, and "(±)" indicates racemic.
[0138] Unless otherwise specified, use a solid wedge key. and dotted wedge key To indicate the absolute configuration of a stereocenter, use a straight solid bond and straight dashed bond Indicate the relative configuration of stereocenters with a wavy line Indicates a wedge-shaped solid key or dotted wedge key Or use a wavy line Indicates a straight solid bond and straight dashed key
[0139] The compounds of the present invention may exist in specific forms. Unless otherwise indicated, the term "tautomer" or "tautomeric form" refers to isomers with different functional groups that are in dynamic equilibrium at room temperature and can quickly convert into each other. If tautomerism is possible (such as in solution), a chemical equilibrium of tautomers can be achieved. For example, proton tautomers (also known as prototropic tautomers) include interconversions that occur through proton migration, such as keto-enol isomerization and imine-enamine isomerization. Valence isomers (valencetautomers) include interconversions that occur through the reorganization of some bonding electrons. A specific example of keto-enol tautomerization is the interconversion between two tautomers of pentane-2,4-dione and 4-hydroxypent-3-ene-2-one.
[0140] Unless otherwise indicated, the terms "enriched in one isomer", "isomerically enriched", "enriched in one enantiomer" or "enantiomerically enriched" mean that the content of one isomer or enantiomer is less than 100%, and the content of that isomer or enantiomer is greater than or equal to 60%, or greater than or equal to 70%, or greater than or equal to 80%, or greater than or equal to 90%, or greater than or equal to 95%, or greater than or equal to 96%, or greater than or equal to 97%, or greater than or equal to 98%, or greater than or equal to 99%, or greater than or equal to 99.5%, or greater than or equal to 99.6%, or greater than or equal to 99.7%, or greater than or equal to 99.8%, or greater than or equal to 99.9%.
[0141] Unless otherwise indicated, the term "isomer excess" or "enantiomeric excess" refers to the difference between the relative percentages of two isomers or two enantiomers. For example, if the content of one isomer or enantiomer is 90% and the content of the other isomer or enantiomer is 10%, the isomer or enantiomeric excess (ee value) is 80%.
[0142] Optically active (R)- and (S)-isomers, as well as D and L isomers, can be prepared by chiral synthesis or chiral reagents or other conventional techniques. If one enantiomer of a compound of the present invention is desired, it can be prepared by asymmetric synthesis or derivatization with a chiral auxiliary, wherein the resulting diastereomeric mixture is separated and the auxiliary group is cleaved to provide the pure desired enantiomer. Alternatively, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), a diastereomeric salt is formed with an appropriate optically active acid or base, and then the diastereoisomers are resolved by conventional methods known in the art, and then the pure enantiomer is recovered. In addition, the separation of enantiomers and diastereomers is typically accomplished by using chromatography, which employs a chiral stationary phase and is optionally combined with a chemical derivatization method (e.g., carbamate formation from an amine).
[0143] The compounds of the present invention may contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute the compound. For example, the compounds may be labeled with radioactive isotopes, such as tritium ( 3 H), iodine-125( 125 I) or C-14( 14 C). For example, deuterated drugs can be formed by replacing hydrogen with heavy hydrogen. The bond between deuterium and carbon is stronger than the bond between ordinary hydrogen and carbon. Compared with non-deuterated drugs, deuterated drugs have advantages such as reduced toxic side effects, increased drug stability, enhanced efficacy, and prolonged drug biological half-life. All isotopic variations of the compounds of the present invention, whether radioactive or not, are included within the scope of this invention.
[0144] Unless otherwise specified, the term “C1-3 "Alkyl" is used to represent a straight or branched chain saturated hydrocarbon group consisting of 1 to 3 carbon atoms. 1-3 Alkyl groups include C 1-2 and C 2-3 Alkyl, etc.; it can be monovalent (such as methyl), divalent (such as methylene) or polyvalent (such as methine). 1-3 Examples of alkyl groups include, but are not limited to, methyl (Me), ethyl (Et), propyl (including n-propyl and isopropyl), and the like.
[0145] Unless otherwise specified, the term “C 1-3 "Alkoxy" refers to those alkyl groups containing 1 to 3 carbon atoms which are attached to the rest of the molecule via an oxygen atom. The C 1-3 Alkoxy groups include C 1-2 、C 2-3 , C3 and C2 alkoxy, etc. 1-3 Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy (including n-propoxy and isopropoxy), and the like.
[0146] Unless otherwise specified, the terms "5-6 membered heteroaromatic ring" and "5-6 membered heteroaryl" are used interchangeably in the present invention. The term "5-6 membered heteroaryl" refers to a monocyclic group with a conjugated π electron system consisting of 5 to 6 ring atoms, wherein 1, 2, 3 or 4 ring atoms are heteroatoms independently selected from O, S and N, and the rest are carbon atoms. The nitrogen atom is optionally quaternized, and the nitrogen and sulfur heteroatoms are optionally oxidized (i.e., NO and S(O) p , p is 1 or 2). 5-6 membered heteroaryl can be connected to the rest of the molecule through a heteroatom or a carbon atom. The 5-6 membered heteroaryl includes 5-membered and 6-membered heteroaryl. Examples of the 5-6 membered heteroaryl include, but are not limited to, pyrrolyl (including N-pyrrolyl, 2-pyrrolyl and 3-pyrrolyl, etc.), pyrazolyl (including 2-pyrazolyl and 3-pyrazolyl, etc.), imidazolyl (including N-imidazolyl, 2-imidazolyl, 4-imidazolyl and 5-imidazolyl, etc.), oxazolyl (including 2-oxazolyl, 4-oxazolyl and 5-oxazolyl, etc.), triazolyl (1H-1,2,3-triazolyl, 2H-1,2,3-triazolyl, 1H-1,2,4-triazolyl) and 4H-1,2,4-triazolyl, etc.), tetrazolyl, isoxazolyl (3-isoxazolyl, 4-isoxazolyl and 5-isoxazolyl, etc.), thiazolyl (including 2-thiazolyl, 4-thiazolyl and 5-thiazolyl, etc.), furyl (including 2-furyl and 3-furyl, etc.), thienyl (including 2-thienyl and 3-thienyl, etc.), pyridyl (including 2-pyridyl, 3-pyridyl and 4-pyridyl, etc.), pyrazinyl or pyrimidinyl (including 2-pyrimidinyl and 4-pyrimidinyl, etc.).
[0147]
[0046] The terms "halo" or "halogen," by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom.
[0148] The terms "optional" or "optionally" mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
[0149] The term "substituted" means that any one or more hydrogen atoms on a particular atom are replaced by a substituent, which may include deuterium and hydrogen variants, as long as the valence state of the particular atom is normal and the substituted compound is stable. When the substituent is oxygen (i.e., =O), it means that two hydrogen atoms are replaced. Oxygen substitution does not occur on aromatic groups. The term "optionally substituted" means that it may be substituted or unsubstituted, and unless otherwise specified, the type and number of substituents can be any on the basis of chemical achievable.
[0150] When any variable (e.g., R) occurs more than once in a compound's composition or structure, its definition at each occurrence is independent. Thus, for example, if a group is substituted with 0-2 Rs, the group may be optionally substituted with up to two Rs, with each occurrence of R being an independent choice. Furthermore, combinations of substituents and / or their variants are permissible only if such combinations result in stable compounds.
[0151] When the number of a linking group is 0, such as -(CRR)0-, it means that the linking group is a single bond.
[0152] When one of the variables is selected from a single bond, it means that the two groups it connects are directly connected. For example, when L in ALZ represents a single bond, it means that the structure is actually AZ.
[0153] When a substituent is vacant, it means that the substituent is not present, for example, when X in AX is vacant, it means that the structure is actually A. When the listed linking group does not specify its connection direction, its connection direction is arbitrary, for example, The connecting group L is -MW-, in which case -MW- can connect ring A and ring B in the same direction as the reading order from left to right to form You can also connect ring A and ring B in the opposite direction of reading from left to right to form Combinations of linkers, substituents, and / or variations thereof are permissible only if such combinations result in stable compounds.
[0154] The compounds of the present invention can be prepared by a variety of synthetic methods well known to those skilled in the art, including the specific embodiments listed below, embodiments formed by combining them with other chemical synthesis methods, and equivalent substitutions well known to those skilled in the art. Preferred embodiments include but are not limited to the examples of the present invention.
[0155] The structures of the compounds of the present invention can be confirmed by conventional methods well known to those skilled in the art. If the present invention relates to the absolute configuration of the compounds, the absolute configuration can be confirmed by conventional techniques in the art. For example, single crystal X-ray diffraction (SXRD) is used to collect diffraction intensity data on the cultured single crystal using a Bruker D8 venture diffractometer, using CuKα radiation as the light source and scanning mode: After scanning and collecting relevant data, the crystal structure is further analyzed using the direct method (Shelxs97) to confirm the absolute configuration.
[0156] The solvents used in the present invention are commercially available. The present invention uses the following abbreviations: aq represents water; eq represents equivalent; M represents mol / L; DCM represents dichloromethane; PE represents petroleum ether; DMF represents N,N-dimethylformamide; DMSO represents dimethyl sulfoxide; EtOAc represents ethyl acetate; EtOH represents ethanol; MeOH represents methanol; CBz represents benzyloxycarbonyl, which is a protecting group for amines; Boc represents tert-butyloxycarbonyl, which is an amine protecting group; rt represents room temperature; O / N represents overnight; THF represents tetrahydrofuran; Boc2O represents di-tert-butyl dicarbonate; TFA represents trifluoroacetic acid; DIPEA represents diisopropylethylamine; SOCl2 represents thionyl chloride; mp represents melting point; IPA represents isopropyl alcohol.
[0157] Compounds are named according to the conventional nomenclature in the art or using The software named the commercially available compounds using the supplier's catalog name. DETAILED DESCRIPTION
[0158] The present invention is described in detail below by way of examples, but is not intended to limit the present invention in any way. While the present invention has been described in detail herein, and specific embodiments thereof have been disclosed, it will be apparent to those skilled in the art that various changes and modifications can be made to the specific embodiments of the present invention without departing from the spirit and scope of the present invention.
[0159] Example 1
[0160]
[0161] Synthesis route
[0162]
[0163] Step 1: Synthesis of compound 1-b
[0164] In a dry flask, compound 1-a (100 g, 487.63 mmol, 1 eq) was dissolved in MeOH (1 L). Sodium methoxide methanol solution (5 M, 195.05 mL, 2 eq) and dimethyl oxalate (86.38 g, 731.45 mmol, 1.5 eq) were added and stirred at 70°C for 16 hours. The reaction mixture was cooled and filtered directly. 1 L of water was added to the filter cake, and the mixture was homogenized and stirred for 1 hour before filtering. 1 L of methyl tert-butyl ether was added to the resulting filter cake, stirred for 1 hour, and then filtered. The filter cake was dried under reduced pressure to yield compound 1-b, which was used directly in the next step without further processing.
[0165] 1 H NMR (400MHz, DMSO-d6) δppm 7.33, 7.10 (d, J = 3.6Hz, 1H), 7.18-7.16 (m, 1H), 6.11, 5.14 (s, 1H), 3.66, 3.56 (s, 3H).
[0166] Step 2: Synthesis of compound 1-c
[0167] Compound 1-b (44 g, 151.14 mmol, 1 eq), sulfonamide (23.24 g, 241.83 mmol, 14.44 mL, 1.6 eq), and hydrochloric acid / methanol solution (4 M, 440.00 mL, 11.64 eq) were added to a dry flask and stirred at 70°C for 16 hours. The reaction mixture was filtered to obtain the crude product. The crude product was then homogenized in 1 L of methanol for 2 hours, filtered, and the filter cake was dried under reduced pressure to obtain compound 1-c.
[0168] 1 H NMR (400MHz, DMSO-d6) δppm 10.88 (br s, 1H), 7.80 (d, J = 4Hz 1H), 7.32 (d, J = 4Hz 1H), 6.79 (s, 1H), 3.85 (s, 3H).
[0169] Step 3: Synthesis of compound 1-d
[0170] Into a three-necked flask, was placed sodium hydride (5.13 g, 128.13 mmol, 60% purity, 1.5 eq) and DMF (150 mL) under nitrogen protection. The mixture was cooled to 0 °C, and a solution of compound 1-c (30 g, 85.42 mmol, 1 eq) in DMF (200 mL) was added dropwise. After the addition was completed, the mixture was stirred at 0 °C for another 30 min, and iodomethane (36.37 g, 256.27 mmol, 15.95 mL, 3 eq) was added dropwise. After the addition was completed, the mixture was stirred at 50 °C for 12 h. The reaction mixture was slowly added to dilute hydrochloric acid (500 mL, 0.5 M), and a large amount of yellow solid was precipitated. The solid was collected by filtration, and the filter cake was washed with water (50 mL x 2). Methanol (100 mL) was added to the filter cake, and the mixture was stirred for 1 h before being filtered. The filter cake was dried under reduced pressure to give compound 1-d. MS m / z (ESI): 364.9 [M+1] + .
[0171] 1 H NMR (400 MHz, CDCl3) δ ppm 7.59 (d, J = 4.0 Hz, 1H), 7.17 (d, J = 4.0 Hz, 1H), 6.96 (s, 1H), 4.01 (s, 3H), 3.67 (s, 3H).
[0172] Step 4: Synthesis of compound 1-f
[0173] Into a three-necked flask, was placed compound 1-e (9.57 g, 65.71 mmol, 3 eq) and dichloromethane (80 mL) under nitrogen protection. Trimethylaluminum solution in toluene (2 M, 32.86 mL, 3 eq) was added dropwise at 0 °C. After the addition was completed, the mixture was stirred at 0 °C for 30 min, and a solution of compound 1-d (8 g, 21.90 mmol, 1 eq) in dichloromethane (100 mL) was added dropwise. The mixture was stirred at 25 °C for 1 h. The reaction mixture was slowly added to cold 1 M dilute hydrochloric acid (150 mL), and the mixture was separated. The aqueous phase was extracted with dichloromethane (50 mL x 2), and the combined organic phase was washed with dilute hydrochloric acid (100 mL, 1 M) and saturated brine (150 mL x 2), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. Methanol (50 mL) was added to the residue, and the mixture was stirred for 30 min before being filtered. The filter cake was dried under reduced pressure to give compound 1-f. MS m / z (ESI): 477.9 [M+1] + .
[0174] 1H NMR(400MHz,DMSO-d6)δppm 11.33(br s,1H),8.11(d,J=4.1Hz,1H),7.98(dd,J=2.4,6.8Hz,1H),7.66-7.61(m,1H),7.53-7.49(m,2H),7.19(s,1H),3.46(s,3H).
[0175] Step 5: Synthesis of compound 1-g
[0176] Compound 1-f (5 g, 10.44 mmol, 1 eq) and ethanol (75 mL) were added to a round-bottom flask, and sodium borohydride (790.19 mg, 20.89 mmol, 2 eq) was added at 0°C. The mixture was stirred at 25°C for 30 minutes. The reaction solution was concentrated under reduced pressure. Ethyl acetate (150 mL) was added to the residue, and dilute hydrochloric acid (1 M, 50 mL) was slowly added. After stirring until clarified, the liquid was separated. The organic phase was washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. Methanol (30 mL) was added to the residue, stirred for 15 minutes, and filtered. The filter cake was rinsed with methanol (10 mL × 2) and dried under reduced pressure to obtain compound 1-g. MS m / z (ESI): 504.1 [M+23] + .
[0177] 1 H NMR(400MHz,CD3COCD3)δppm 9.78(br s,1H),8.07(dd,J=1.6,6.5Hz,1H),7.73-7.62(m,1H),7.31(t,J=9.1Hz,1H),7.08(dd,J=3.5,16.8Hz,2H),6.48(br d,J=8.9Hz,1H),5.00-4.83(m,1H),4.61(br dd,J=4.1,10.6Hz,1H),2.76(s,3H),2.32-2.24(m,2H).
[0178] Step 6: Synthesis of compound 1-i
[0179] Under nitrogen, compound 1-g (100.00 mg, 207.14 μmol, 1 eq), 1-h (72.12 mg, 248.56 μmol, 1.2 eq), 1,4-dioxane (3 mL), and water (0.3 mL) were added to a thumb flask. Sodium carbonate (109.77 mg, 1.04 mmol, 5 eq) and Pd(dppf)Cl2 (15.16 mg, 20.71 μmol, 0.1 eq) were then added. After nitrogen replacement three times, the mixture was stirred at 90°C for 16 hours. The reaction mixture was diluted with water (15 mL) and ethyl acetate (15 mL), adjusted to pH 1-2 with 1 M dilute hydrochloric acid, stirred for 5 minutes, and filtered. The aqueous phase of the filtrate was extracted with ethyl acetate (15 mL x 2). The combined organic phases were washed with saturated brine (30 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was separated by flash column chromatography (petroleum ether:ethyl acetate = 100:0 to 70:30) to obtain compound 1-i. MS m / z (ESI): 566.1 [M+1] + .
[0180] 1 H NMR (400MHz, CDCl3) δppm 8.04(s,1H),7.81(br d,J=6.4Hz,1H),7.55(br d,J=7.9Hz,2H),7.40(br d,J=8.8Hz,1H),7.33(br d,J=8.0Hz,2H),7.22-7.15(m,2H),7.08(d,J=3.5Hz,1H),4.97(br s,1H),4.68(br d,J=9.5Hz,1H),4.48(br d,J=6.1Hz,1H),4.19(q,J=7.1Hz,2H),3.65(s,2H),2.85(s,3H),2.47-2.38(m,1H),2.34-2.22(m,1H),1.29(br t,J=7.0Hz,3H).
[0181] Step 7: Synthesis of Compound 1
[0182] Compound 1-i (30 mg, 53.00 μmol, 1.0 eq) and ethanol (1 mL) were added to a thumb flask, followed by a solution of sodium hydroxide (10.60 mg, 264.99 μmol, 5 eq) in water (0.2 mL). The mixture was stirred at 25°C for 1 hour. The reaction mixture was adjusted to pH 1-2 with 1 M dilute hydrochloric acid and extracted with ethyl acetate (20 mL x 3). The combined organic phases were washed with saturated brine (30 mL x 2), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to yield compound 1. MS m / z (ESI): 537.7 [M+1] +.
[0183] 1 H NMR (400 MHz, DMSO-d6) δ ppm 10.64 (s, 1 H), 7.99 (dd, J=2.5, 6.8 Hz, 1 H), 7.74 (br d, J=9.3 Hz, 1 H), 7.62 - 7.55 (m, 3 H), 7.45 - 7.35 (m, 2 H), 7.31 (d, J=8.3 Hz, 2 H), 7.15 (d, J=3.8 Hz, 1 H), 4.81 (br s, 1 H), 4.33 (dd, J=2.4, 11.7 Hz, 1 H), 3.58 (s, 2 H), 2.63 (s, 3 H), 2.36 - 2.12 (m, 2 H).
[0184] Step 8: Synthesis of compounds 2 and 3
[0185] Compound 1 (450 mg, 836.41 pmol, 1 eq) was separated by chiral supercritical chromatography (DAICEL CHIRALPAK AD (250 mm*30 mm, 10 pm); mobile phase: 0.1% NH 3. H2O IPA; flow rate: 80 mL / min) to give compound P1 (retention time: 1.360 min) which was purified by preparative high performance liquid chromatography (acetic acid / acetonitrile) to give compound 2; and compound P2 (retention time: 2.028 min) which was further purified by preparative high performance liquid chromatography (acetic acid / acetonitrile) to give compound 3.
[0186] Compound 2:
[0187] MS m / z (ESI): 560.5 [M+23] + .
[0188] 1 H NMR (400 MHz, DMSO-d6) δ ppm 10.61 (s, 1 H), 7.99 (dd, J=2.4, 6.8 Hz, 1 H), 7.85 - 7.70 (m, 1 H), 7.62 - 7.54 (m, 3 H), 7.46 - 7.37 (m, 2 H), 7.31 (d, J=8.3 Hz, 2 H), 7.15 (d, J=3.5 Hz, 1 H), 4.81 (br d, J=10.6 Hz, 1 H), 4.33 (dd, J=2.6, 11.7 Hz, 1 H), 3.59 (s, 2 H), 2.63 (s, 3 H), 2.33 - 2.09 (m, 2 H).
[0189] Compound 3:
[0190] MS m / z (ESI): 560.1 [M+23] + .
[0191] 1 H NMR (400 MHz, DMSO-d6) δ ppm 10.62 (s, 1 H), 7.99 (dd, J=2.6, 6.8 Hz, 1 H), 7.62 - 7.55 (m, 3 H), 7.45 - 7.37 (m, 2 H), 7.30 (d, J=8.1 Hz, 2 H), 7.15 (d, J=3.4 Hz, 1 H), 4.81 (br d, J=11.0 Hz, 1 H), 4.33 (dd, J=2.6, 11.6 Hz, 1 H), 3.57 (s, 2 H), 2.63 (s, 3 H), 2.35 - 2.12 (m, 2 H).
[0192] Example 2
[0193]
[0194] Synthetic route
[0195]
[0196] Step 1: synthesis of compound 4-b
[0197] NaH (494.87 mg, 12.37 mmol, 60% purity, 1.2 eq) was added to DMF (20 mL) under nitrogen protection, the reaction was cooled to 0 °C, and then 4-a (2 g, 10.31 mmol, 1 eq) was slowly added. The reaction was stirred at 0 °C for 0.5 h, and then ethyl 4-bromobutyrate (2.21 g, 11.34 mmol, 1.63 mL, 1.1 eq) was added. The reaction was slowly warmed to 25 °C and stirred for 1 h. The reaction was quenched with saturated aqueous ammonium chloride solution (50 mL), extracted with ethyl acetate (50 mL x 2), and the combined organic phase was washed with water (20 mL) and saturated brine (20 mL) successively, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (SiO2, ethyl acetate: petroleum ether = 30%-100%) to give compound 4-b.
[0198] MS m / z (ESI): 308.9 [M+1] + .
[0199] 1H NMR (400MHz, CDCl3) δppm 1.28(t,J=7.03Hz,3H),2.10(q,J=7.03Hz,2H),2.25-2.38(m,2H),4.03(t,J=6.9 0Hz, 2H), 4.16 (q, J = 7.03Hz, 2H), 7.02 (d, J = 1.25Hz, 1H), 7.38 (d, J = 0.75Hz, 1H).
[0200] Step 2: Synthesis of compound 4-c
[0201] Under nitrogen protection, compound 1-g (500 mg, 1.04 mmol, 1 eq), bis-pinacol boronate (657.49 mg, 2.59 mmol, 2.5 eq), potassium acetate (508.21 mg, 5.18 mmol, 5 eq), and 1,4-dioxane (10 mL) were added to a round-bottom flask. The nitrogen atmosphere was purged three times, and then Pd(dppf)Cl2.CH2Cl2 (42.29 mg, 51.78 μmol, 0.05 eq) was added. After purging the nitrogen atmosphere three times, the mixture was stirred at 90°C for 12 hours. The reaction solution was filtered through celite, and the filter cake was rinsed with ethyl acetate (20 mL). The filtrate was concentrated under reduced pressure to obtain crude compound 4-c. MS m / z (ESI): 552.0 [M+23] + .
[0202] Step 3: Synthesis of compound 4-d
[0203] Under nitrogen, compound 4-c (150 mg, 283.10 μmol, 1.0 eq), 4-b (95.95 mg, 311.41 μmol, 1.1 eq), potassium carbonate (117.38 mg, 849.31 μmol, 3 eq), and Pd(dppf)Cl2.CH2Cl2 (46.24 mg, 56.62 μmol, 0.2 eq) were added to 1,4-dioxane (8 mL) and H2O (2 mL). The reaction solution was stirred at 100°C for 2 hours. Water (20 mL) was added to the reaction solution, and the mixture was extracted with ethyl acetate (30 mL x 2). The organic phases were combined, washed sequentially with water (20 mL) and saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (methanol:dichloromethane = 0-10%) to afford compound 4-d, which was used directly in the next step. MS m / z(ESI):584.1[M+1] + .
[0204] Step 4: Synthesis of compound 4
[0205] Compound 4-d (150 mg, 256.81 μmol, 1 eq) and sodium hydroxide (51.36 mg, 1.28 mmol, 5 eq) were added to methanol (5 mL) and water (5 mL), and the reaction solution was stirred at 25°C for 1 hour. The reaction solution was adjusted to pH 3-4 with 1M dilute hydrochloric acid, water (20 mL) was added, and extraction was performed with ethyl acetate (30 mL × 2). The organic phases were combined, washed sequentially with water (10 mL) and saturated brine (10 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by preparative liquid chromatography (acetic acid / acetonitrile) to obtain compound 4. MS m / z (ESI): 556.2 [M+1] + .
[0206] 1 H NMR (400MHz, DMSO-d6) δppm 10.59 (s, 1H), 7.98 (br d, J = 4.6Hz, 1H), 7.73-7.63 (m, 2H), 7.55 (s, 2H), 7.41 (br t, J = 9.1Hz, 1H), 7.11 (br d,J=3.1Hz,1H),7.04(brs,1H),4.76(br t,J=8.8Hz,1H),4.30(br d,J=11.4Hz,1H),3.99(br t,J=6.6Hz,2H),2.62(s,3H),2.25-2.13(m,4H),2.00-1.92(m,2H).
[0207] Example 3
[0208]
[0209] Synthesis route
[0210]
[0211] Step 1: Synthesis of compound 5-b
[0212] Under nitrogen, cuprous chloride (35.33 mg, 356.83 μmol, 8.53 μL, 0.03 eq), sodium tert-butoxide (114.31 mg, 1.19 mmol, 0.1 eq), Xantphos (206.47 mg, 356.83 μmol, 0.03 eq), and tetrahydrofuran (30 mL) were added to a three-necked flask and stirred at 25°C for 30 minutes. Bis-pinacol boronate (3.32 g, 13.08 mmol, 1.1 eq) was then added. After stirring for 10 minutes, compound 5-a (1 g, 11.89 mmol, 990.10 μL, 1 eq) and MeOH (1.52 g, 47.58 mmol, 1.93 mL, 4 eq) were added. The mixture was stirred at 25°C for 16 hours. The reaction mixture was filtered, and the filter cake was washed with ethyl acetate (10 mL). The filtrate was concentrated under reduced pressure to obtain compound 5-b, which was directly used in the next reaction.
[0213] 1 H NMR (400MHz, CDCl3) δppm 6.83-6.73(m,1H),6.70-6.57(m,1H),3.77(s,3H),1.29(s,12H).
[0214] Step 2: Synthesis of compound 5-c
[0215] Under nitrogen protection, compound 1-g (500 mg, 1.04 mmol, 1 eq), compound 5-b (439.23 mg, 2.07 mmol, 2 eq), sodium carbonate (329.31 mg, 3.11 mmol, 3 eq), 1,4-dioxane (10 mL), and water (2 mL) were added to a thumb flask, followed by the addition of Pd(PPh3)4 (59.84 mg, 51.78 μmol, 0.05 eq). After nitrogen replacement three times, the mixture was stirred at 80°C for 16 hours. The reaction solution was concentrated under reduced pressure. The residue was isolated by flash column chromatography (petroleum ether:ethyl acetate = 100:0 to 70:30) to obtain compound 5-c. MS m / z (ESI): 487.9 [M+1] + .
[0216] Step 3: Synthesis of compound 5
[0217] Into a three-necked flask, was placed compound 5-c (400 mg, 819.75 μmol, 1 eq) and methanol (10 mL), then a solution of sodium hydroxide (163.95 mg, 4.10 mmol, 5 eq) in water (2 mL) was added at 0 °C. The mixture was stirred at 25 °C for 12 h. The reaction was adjusted to pH = 1-2 with 1 M dilute hydrochloric acid, 10 mL of water was added, a large amount of white solid was precipitated, and was filtered. The filter cake was separated by preparative high performance liquid chromatography (acetic acid / acetonitrile) to give compound 5.
[0218] MS m / z (ESI): 474.3 [M+1] + .
[0219] 1 H NMR (400 MHz, CD3COCD3) δ ppm 9.81 (s, 1H), 8.08 (dd, J = 2.5, 6.8 Hz, 1H), 7.78 (d, J = 15.6 Hz, 1H), 7.72-7.65 (m, 1H), 7.39 (d, J = 3.8 Hz, 1H), 7.32 (t, J = 8.9 Hz, 1H), 7.24 (d, J = 3.8 Hz, 1H), 6.53 (d, J = 8.8 Hz, 1H), 6.23 (d, J = 15.8 Hz, 1H), 5.05-4.90 (m, 1H), 4.64 (dd, J = 4.1, 10.7 Hz, 1H), 2.77 (s, 3H), 2.37-2.25 (m, 2H).
[0220] Step 4: Synthesis of compound 6
[0221] Into a hydrogenation flask, was placed compound 5 (80 mg, 168.80 μmol, 1 eq) and tetrahydrofuran (10 mL), then Pd / C (10 mg, 168.80 μmol, 10% purity, 1 eq) was added, after three times of hydrogen replacement, the mixture was stirred at 25 °C under H2(50 psi) for 16 h. The reaction mixture was filtered through celite, and the filter cake was rinsed with tetrahydrofuran (10 mL x 3). The combined organic phase was concentrated under reduced pressure. To the residue was added methanol (5 mL), stirred for 1 h, filtered, and the filter cake was rinsed with methanol (5 mL) and dried under reduced pressure to give compound 6. MS m / z (ESI): 476.1 [M+1] + .
[0222] 1H NMR (400MHz, DMSO-d6) δppm 10.80 (br s, 1H), 8.00 (dd, J = 2.5, 6.8Hz, 1H), 7.67 (br s,1H),7.59(td,J=4.3,7.2Hz,1H),7.40(t,J=9.2Hz,1H),6.89(d,J=3.0Hz,1H),6.72(d,J=3.3Hz,1H),4.68(br d,J=10.5Hz,1H),4.25(br d,J=10.3Hz,1H),2.95(br t,J=7.5Hz,2H),2.59(s,3H),2.31(br t,J=7.4Hz,2H),2.21-2.05(m,2H).
[0223] Example 4
[0224]
[0225] Synthesis route
[0226]
[0227] Step 1: Synthesis of compound 7-b
[0228] Compound 1-g (100 mg, 207.14 μmol, 1 eq) was dissolved in 1,4-dioxane (4 mL). 7-a (57.20 mg, 207.14 μmol, 1 eq) and potassium phosphate (2 M, 310.70 μL, 3 eq) were added. The atmosphere was purged with nitrogen three times. Tetrakistriphenylphosphine palladium (14.36 mg, 12.43 μmol, 0.06 eq) was added under nitrogen protection, and the atmosphere was purged with nitrogen three times. The reaction solution was stirred at 90°C for 13 hours. The reaction solution was cooled to room temperature and filtered. The filtrate was concentrated to remove the solvent, and ethyl acetate (50 mL) was added. The mixture was washed with saturated brine (30 mL x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was purified by flash column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to obtain compound 7-b.
[0229] 1H NMR (400MHz, CDCl3) δppm 8.43 (s, 1H), 7.79 (dd, J = 2.6, 6.4Hz, 1H), 7.49-7.38 (m, 3H), 7.33 (t, J = 7.7Hz, 1H), 7.22 (br d,J=7.5Hz,1H),7.17(d,J=3.8Hz,1H),7.11(t,J=8.8Hz,1H),7.03(d,J=3.5Hz,1H),5.01-4.96(m,1H),4.92(ddd ,J=3.3,7.3,11.0Hz,1H),4.53(dd,J=3.1,11.9Hz,1H),3.72(s,3H),3.66(s,2H),2.80(s,3H),2.39-2.25(m,2H).
[0230] Step 2: Synthesis of compound 7
[0231] Compound 7-b (88 mg, 159.41 μmol, 1 eq) was dissolved in methanol (14 mL), and a solution of sodium hydroxide (31.88 mg, 797.05 μmol, 5 eq) in water (14 mL) was added. The reaction mixture was stirred at 25°C for 13 hours. The reaction mixture was concentrated to remove the methanol, and the pH was adjusted to 2-3 with 1M dilute hydrochloric acid. A solid precipitated and was filtered. The filter cake was washed with water (8 mL x 5) and dried under reduced pressure to yield compound 7. MS m / z (ESI): 427.9 [M-109]. 1 H NMR(400MHz, DMSO-d6)δppm 10.61(s,1H),7.98(dd,J=2.4,6.9Hz,1H),7.76(br d,J=9.0Hz,1H),7.60-7.50(m,3H),7.45-7.32(m,3H),7.20(br d,J=7.5Hz,1H),7.15(d,J=3.5Hz,1H),4.81(br t,J=9.2Hz,1H),4.32(dd,J=2.6,11.7Hz,1H),3.61(s,2H),2.63(s,3H),2.33-2.10(m,2H).
[0232] Example 5
[0233]
[0234] Synthesis route
[0235]
[0236] Step 1: Synthesis of compound 8-b
[0237] Compound 8-a (500 mg, 2.17 mmol, 1 eq), bis-pinacol boronate (827.85 mg, 3.26 mmol, 1.5 eq), potassium acetate (639.88 mg, 6.52 mmol, 3 eq), and Pd(dppf)Cl2 (79.51 mg, 108.67 μmol, 0.05 eq) were dissolved in 1,4-dioxane (20 mL) and the atmosphere was purged with nitrogen three times. The reaction mixture was stirred at 90°C for 14 hours. The reaction mixture was filtered through celite, the filter cake was washed with ethyl acetate (15 mL x 2), and the filtrates were combined and concentrated. Compound 8-b was obtained, which was used directly in the next reaction.
[0238] MS m / z(ESI):196.0[M+1] + .
[0239] Step 2: Synthesis of compound 8-c
[0240] Compound 8-b (50 mg, 103.57 μmol, 1 eq) was dissolved in 1,4-dioxane (4 mL), followed by the addition of compound 1-g (71.75 mg, 367.99 μmol, 3.55 eq) and aqueous potassium phosphate (2 M, 155.35 μL, 3 eq). The atmosphere was purged with nitrogen three times, and tetrakistriphenylphosphine palladium (7.18 mg, 6.21 μmol, 0.06 eq) was added. The reaction mixture was stirred at 90°C for 13 hours. The reaction mixture was cooled to room temperature and filtered. The filtrate was concentrated to remove the solvent, and ethyl acetate (50 mL) was added. The mixture was washed with saturated brine (30 mL x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 1 / 1) to afford compound 8-c.
[0241] 1 H NMR (400MHz, CDCl3) δppm 10.59(s,1H),8.79(s,1H),8.04-7.95(m,2H),7.77(d,J=9.5Hz,1H),7.52(d,J=3.8Hz,1H),7.44-7.37(m,2H),7.20(d,J=3.5Hz,1H),4.83(br t,J=10.2Hz,1H),4.33(br d,J=11.0Hz,1H),3.88(s,2H),3.63(s,3H),2.63(s,3H),2.34-2.10(m,2H).
[0242] Step 3: Synthesis of compound 8
[0243] Compound 8-c (20 mg, 36.16 μmol, 1 eq) was dissolved in methanol (4 mL), and a solution of sodium hydroxide (7.23 mg, 180.82 μmol, 5 eq) in water (4 mL) was added. The reaction mixture was stirred at 25°C for 13 hours. The reaction mixture was concentrated to remove methanol, and the pH was adjusted to 4-5 with 1 M dilute hydrochloric acid. The mixture was filtered to obtain compound 8. MS m / z (ESI): 539.1 [M+1] + .
[0244] 1 H NMR (400MHz, DMSO-d6) δppm 10.72 (s, 1H), 8.73 (d, J = 1.5Hz, 1H), 8.01-7.89 (m, 2H), 7.79 (br s,1H),7.61-7.53(m,1H),7.47(d,J=3.8Hz,1H),7.43-7.35(m,2H),7.18(d,J=3.8Hz,1H),4.82(br d,J=10.8Hz,1H),4.36-4.26(m,1H),3.66(s,2H),2.62(s,3H),2.35-2.11(m,2H).
[0245] Example 6
[0246]
[0247] Synthesis route
[0248]
[0249] Step 1: Synthesis of compound 9-b
[0250] Compound 9-a (4.9 g, 21.21 mmol, 1 eq) was dissolved in methanol (100 mL), and concentrated sulfuric acid (416.01 mg, 4.24 mmol, 226.09 μL, 0.2 eq) was added. The reaction solution was stirred at 80°C for 2 hours. The reaction solution was directly concentrated under reduced pressure and dissolved in dichloromethane (100 mL). The solution was then washed with water (100 mL × 1), followed by 1M sodium carbonate aqueous solution (100 mL × 1) and saturated brine (100 mL × 1), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether:ethyl acetate = 100:0 to 5:1) to obtain compound 9-b.
[0251] 1 H NMR (400MHz, CDCl3) δppm 7.45-7.39(m,2H), 6.85-6.78(m,2H), 4.63(s,2H), 3.83(s,3H).
[0252] Step 2: Synthesis of compound 9-c
[0253] Compound 9-b (2 g, 8.16 mmol, 1 eq) was dissolved in 1,4-dioxane (30 mL), bis(pinacolato)diboron (2.28 g, 8.98 mmol, 1.1 eq) and potassium carbonate (1.69 g, 12.24 mmol, 1.5 eq) were added, and the mixture was replaced with nitrogen three times, then Pd(dppf)Cl 2( 59.71 mg, 81.61 μmol, 0.01 eq) was added, and the mixture was stirred at 90 °C for 12 h. The reaction solution was diluted with ethyl acetate (30 mL), washed with saturated aqueous sodium chloride solution (30 mL x 3), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was separated by flash column chromatography (petroleum ether: ethyl acetate = 100:0 to 5:1) to obtain compound 9-c.
[0254] 1 H NMR (400 MHz, CDCl3) δ ppm 7.78 (d, J = 8.5 Hz, 2H), 6.92 (d, J = 8.8 Hz, 2H), 4.68 (s, 2H), 3.83 (s, 3H), 1.35 (s, 12H).
[0255] Step 3: Synthesis of compound 9
[0256] Compound 1-g (780 mg, 1.62 mmol, 1 eq) was dissolved in 1,4-dioxane (20 mL) and water (5 mL), and compound 9-c (471.99 mg, 1.62 mmol, 1 eq) and sodium carbonate (256.86 mg, 2.42 mmol, 1.5 eq) were added at 20 °C, and the mixture was replaced with nitrogen three times, then Pd(PPh3)4 (18.67 mg, 16.16 μmol, 0.01 eq) was added. The mixture was stirred at 90 °C for 12 h. The reaction solution was adjusted to pH = 3-4 with 1M aqueous hydrochloric acid solution, then extracted with ethyl acetate (20 mL x 2), and the combined organic phase was washed with saturated aqueous sodium chloride solution (20 mL x 1), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was separated by preparative high performance liquid chromatography (acetic acid / acetonitrile) to obtain compound 9. MS m / z (ESI): 444.0 [M-109]. 1H NMR (400MHz, CD3OD) δppm7.92 (dd, J=2.6, 6.7Hz, 1H), 7.61-7.54 (m, 3H), 7.27-7.2 1(m,1H),7.20-7.16(m,1H),7.09(d,J=3.0Hz,1H),6.98(d,J=8.8Hz,2H),5.07(br d,J=9.5Hz,1H),4.71(s,2H),4.48-4.36(m,1H),2.80-2.70(m,3H),2.41-2.23(m,2H).
[0257] Example 7
[0258]
[0259] Synthesis route
[0260]
[0261] Step 1: Synthesis of compound 10-b
[0262] 10-a (3.02 g, 3 eq) and dichloromethane (45 mL) were added to a three-necked flask. The reaction solution was cooled to 0°C, and trimethylaluminum (2 M, 3 eq) was added dropwise. The mixture was stirred for 30 minutes, followed by the addition of 1-d (2.5 g, 1 eq). The reaction solution was stirred at 25°C for 1 hour. The reaction solution was cooled to room temperature and then slowly poured into ice water (50 mL). The mixture was stirred for 5 minutes, and the pH was adjusted to 3-4 with 1 M aqueous hydrochloric acid. A yellow solid precipitated and was filtered. The filter cake was added with methanol (50 mL), stirred, filtered, and concentrated under reduced pressure to dryness to obtain compound 10-b. MS m / z (ESI): 479.8 [M+1] + ;
[0263] 1 H NMR (400MHz, DMSO-d6) δppm 11.47 (s, 1H), 8.10 (d, J = 4.0Hz, 1H), 7.61 (dd, J = 6.4, 9.6Hz, 2H), 7.51 (d, J = 4.0Hz, 1H), 7.20 (s, 1H), 3.48-3.38 (m, 3H).
[0264] Step 2: Synthesis of compound 10-c
[0265] 10-b (2.2 g) and ethanol (50 mL) were added to an eggplant-shaped flask, and the reaction solution was cooled to 0°C and sodium borohydride (348.86 mg, 2.0 eq) was added. The reaction solution was stirred at 25°C for 1 hour. The reaction solution was cooled to room temperature and then concentrated under reduced pressure to a residue. The residue was added with MeOH (30 mL) and water (20 mL) and stirred. The pH was adjusted to 3-4 with 1M aqueous hydrochloric acid. A white solid precipitated and was filtered. The filter cake was washed with methanol (20 mL) and concentrated under reduced pressure to dryness to obtain compound 10-c.
[0266] 1 H NMR(400MHz,DMSO-d6)δppm 10.62(s,1H),7.62(d,J=6.8Hz,1H),7.48(dd,J=6.4,10.0Hz,2H),7.03(d,J=3.6Hz,1H),6.90(d,J=4.0Hz,1 H),4.6-4.60(m,1H),4.23(dd,J=2.5,11.8Hz,1H),2.42-2.38(m,3H),2.14-2.05(m,1H),2.02-1.90(m,1H).
[0267] Step 3: Synthesis of compound 10
[0268] Compound 10-c (0.5 g, 1.03 mmol, 1 eq), 1-h (300.00 mg, 1 eq), potassium phosphate (650 mg, 2.97 eq), 1,4-dioxane (15 mL), and water (3 mL) were added to an eggplant-shaped flask. The reaction mixture was purged with nitrogen, and then Pd(PPh3)4 (43 mg, 0.03 eq) was added. The reaction mixture was heated to 90°C and stirred for 1 hour. After the reaction mixture cooled to 20°C, ethanol (4 mL) and a solution of sodium hydroxide (200 mg, 4.89 eq) in water (1 mL) were added. The reaction mixture was stirred at 20°C for 1 hour. Water (10 mL) was added to the reaction mixture, and the aqueous phase was extracted with dichloromethane (20 mL x 2). The combined organic phases were washed with saturated brine (15 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. Methanol (10 mL) and water (5 mL) were added to the residue, stirred for 20 minutes, and filtered to obtain compound 10. MS m / z (ESI): 540.1 [M+1] + ;
[0269] 1H NMR(400MHz,DMSO-d6)δppm 9.86(s,1H),6.86(d,J=9.2Hz,1H),6.77-6.67(m,4H),6.50(d,J=3.6Hz,1H),6.42(d,J=8.0Hz,2H),6.26(d,J=3 .6Hz,1H),3.97–3.88(m,1H),3.52-3.45(m,1H),2.71(s,2H),1.74(s,3H),1.41-1.34(m,1H),1.32-1.20(m,1H).
[0270] Example 8
[0271]
[0272] Synthesis route
[0273]
[0274] Step 1: Synthesis of compound 11-b
[0275] Compound 11-a (2 g, 7.38 mmol, 1 eq) was dissolved in 1,4-dioxane (30 mL), and diboronic acid pinacol ester (2.06 g, 8.11 mmol, 1.1 eq) and potassium carbonate (1.53 g, 11.06 mmol, 1.5 eq) were added. The atmosphere was purged with nitrogen three times, followed by the addition of Pd(dppf)Cl2 (53.97 mg, 73.76 μmol, 0.01 eq). The atmosphere was purged with nitrogen three times again, and the mixture was stirred at 90°C for 12 hours. The reaction mixture was directly concentrated under reduced pressure, diluted with ethyl acetate (30 mL), washed with saturated sodium chloride solution (30 mL × 1), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (gradient elution: petroleum ether:ethyl acetate = 100:0 to 5:1) to obtain compound 11-b. MS m / z (ESI): 319.1 [M+1] + .
[0276] 1H NMR (400MHz, CDCl3) δppm 7.76(d,J=7.8Hz,2H),7.22(d,J=7.8Hz,2H),4.14(q,J=7.0Hz,2H),2.69(t,J=7.7Hz ,2H),2.33(t,J=7.4Hz,2H),1.97(t,J=7.5Hz,2H),1.36(s,12H),1.29-1.25(m,3H).
[0277] Step 2: Synthesis of compound 11-c
[0278] Compound 1-g (200 mg, 414.27 μmol, 1 eq) was dissolved in 1,4-dioxane (10 mL) and water (2 mL), compound 11-b (131.83 mg, 414.27 μmol, 1 eq) and sodium carbonate (65.86 mg, 621.41 μmol, 1.5 eq) were added, and nitrogen was replaced for three times, then Pd(PPh3)4(4.79 mg, 4.14 μmol, 0.01 eq) was added. Nitrogen was replaced for three times again. The reaction solution was stirred at 90 °C for 12 hours. The reaction solution was diluted with ethyl acetate (20 mL), washed with saturated sodium chloride aqueous solution (20 mL x 2), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 100:0 to 5:1) to obtain compound 11-c.
[0279] 1 H NMR (400 MHz, DMSO-d6) δ ppm 11.96 (br s, 4 H), 10.59 (s, 1 H), 7.99 (dd, J=2.4, 6.9 Hz, 1 H), 7.73 (br d, J=9.5 Hz, 1 H), 7.62-7.52 (m, 3 H), 7.41 (t, J=9.2 Hz, 1 H), 7.36 (d, J=3.8 Hz, 1 H), 7.24 (d, J=8.3 Hz, 2 H), 7.14 (d, J=3.5 Hz, 1 H), 4.81 (br t, J=9.7 Hz, 1 H), 4.33 (dd, J=2.6, 11.7 Hz, 1 H), 4.04 (quin, J=7.1 Hz, 3 H), 2.68-2.56 (m, 6 H), 2.34-2.13 (m, 5 H), 1.92 (s, 10 H), 1.87-1.78 (m, 3 H), 1.18 (t, J=7.0 Hz, 6 H).
[0280] Step 3: Synthesis of compound 11
[0281] Compound 11-c (200 mg, 336.63 μmol, 1 eq) was dissolved in a mixture of methanol (3 mL) and water (3 mL), and sodium hydroxide (80.79 mg, 2.02 mmol, 6 eq) was added. The reaction mixture was stirred at 50 °C for 12 hours. The reaction was adjusted to pH = 3-4 with 2M hydrochloric acid, and directly concentrated under reduced pressure. The crude product was separated by high performance liquid chromatography (acetic acid / acetonitrile) to obtain compound 11.
[0282] 1H NMR (400 MHz, CD3OD) δ ppm 7.92 (dd, J = 2.5, 6.8 Hz, 1H), 7.63 - 7.52 (m, 3H), 7.29 - 7.20 (m, 4H), 7.11 (d, J = 3.0 Hz, 1H), 4.96 - 4.92 (m, 1H), 4.46 - 4.38 (m, 1H), 2.76 (s, 3H), 2.69 (t, J = 7.5 Hz, 2H), 2.33 (q, J = 6.9 Hz, 4H), 2.01 - 1.88 (m, 2H).
[0283] Example 9
[0284]
[0285] Synthetic route
[0286]
[0287] Step 1: synthesis of compound 12-b
[0288] Under nitrogen protection, cuprous chloride (4.71 mg, 47.56 μmol, 1.14 μL, 0.03 eq), sodium tert-butoxide (15.24 mg, 158.54 μmol, 0.1 eq), Xantphos (27.52 mg, 47.56 μmol, 0.03 eq) and tetrahydrofuran (4 mL) were added into a three-neck flask, stirred at 25 °C for 30 min, then bis(pinacolato)diboron (442.85 mg, 1.74 mmol, 1.1 eq) was added, stirred for 10 min, then 12-a (200 mg, 1.59 mmol, 1 eq) and methanol (203.19 mg, 6.34 mmol, 256.62 μL, 4 eq) were added. The mixture was stirred at 25 °C for 16 h. The reaction solution was filtered with celite, the filter cake was washed with ethyl acetate (6 mL x 3), the filtrate was combined and concentrated to give compound 12-b.
[0289] 1 H NMR (400 MHz, CD3OD) δ ppm 7.92 (dd, J = 2.5, 6.8 Hz, 1H), 7.63 - 7.52 (m, 3H), 7.29 - 7.20 (m, 4H), 7.11 (d, J = 3.0 Hz, 1H), 4.96 - 4.92 (m, 1H), 4.46 - 4.38 (m, 1H), 2.76 (s, 3H), 2.69 (t, J = 7.5 Hz, 2H), 2.33 (q, J = 6.9 Hz, 4H), 2.01 - 1.88 (m, 2H).
[0290] Step 2: synthesis of compound 12-c
[0291] Compound 1-g (300 mg, 621.41 μmol, 1 eq) was dissolved in 1,4-dioxane (12 mL). 12-b (394.79 mg, 1.55 mmol, 2.5 eq) and aqueous potassium phosphate (2 M, 932.11 μL, 3 eq) were added. The atmosphere was purged with nitrogen three times. Tetrakistriphenylphosphine palladium (43.08 mg, 37.28 μmol, 0.06 eq) was added under nitrogen, and the atmosphere was purged with nitrogen three times. The reaction mixture was stirred at 90°C for 15 hours. The reaction mixture was cooled to room temperature and filtered. The filtrate was concentrated under reduced pressure, ethyl acetate (50 mL) was added, and the mixture was washed with saturated brine (30 mL x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 1 / 1, with 0.1% acetic acid added to the ethyl acetate) to afford compound 12-c.
[0292] 1 H NMR (400MHz, CDCl3) δppm 8.16(s,1H),7.84-7.76(m,1H),7.43-7.35(m,1H),7.14(t,J=8.8Hz,1H),7.03-6.73(m,2H),6.50-5.96(m,1H),4.94-4 .83(m,1H),4.65-4.51(m,2H),3.74-3.64(m,3H),2.81(s,3H),2.54-2.32(m,4H),2.28-2.15(m,2H),1.97-1.77(m,2H).
[0293] Step 3: Synthesis of compound 12-d
[0294] Compound 12-c (110 mg, 207.53 μmol, 1 eq) was dissolved in methanol (45 mL). Under argon, wet Pd(OH)2 (100 mg, 20% purity) was added. The system was purged with argon three times and then with hydrogen three times. The reaction mixture was stirred at 30°C under H2 (20 psi) for 16 hours. The reaction mixture was filtered through celite, the filter cake was washed with methanol (25 mL x 3), and the filtrates were combined and concentrated. The crude product was purified by flash column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 1 / 1, with 0.1% acetic acid added to ethyl acetate) to afford compound 12-d.
[0295] 1H NMR (400MHz, CDCl3) δppm 8.18(s,1H),7.81(dd,J=2.6,6.4Hz,1H),7.39(td,J=3.3,8.8Hz,1H),7.18-7.10(m,1H),6.89(d,J=3.3Hz,1H),6.70-6.63(m,1H ),4.95-4.84(m,1H),4.63-4.54(m,2H),3.67(s,3H),2.84-2.72(m,5H),2.40-2.16(m,4H),1.73-1.66(m,2H),1.44-1.24(m,4H).
[0296] Step 4: Synthesis of compound 12
[0297] Compound 12-d (50 mg, 93.98 μmol, 1 eq) was dissolved in methanol (8 mL), and a solution of sodium hydroxide (18.80 mg, 469.88 μmol, 5 eq) in water (8 mL) was added. The reaction mixture was stirred at 25°C for 6 hours. The reaction mixture was concentrated to remove the methanol, and the pH was adjusted to 3-4 with 1M dilute hydrochloric acid. The mixture was filtered, and the filter cake was washed with water (3 mL x 3) and dried under reduced pressure to obtain the crude product. The crude product was purified by preparative HPLC (acetic acid / acetonitrile) to obtain compound 12. MS m / z (ESI): 518.0 [M+1] + .
[0298] 1 H NMR(400MHz,DMSO-d6)δppm 10.56(s,1H),7.97(dd,J=2.5,6.8Hz,1H),7.68-7.51(m,2H),7.44-7.36(m,1H),6.92(d,J=3.5Hz,1H),6.76-6.70(m,1H),4.70(br d,J=11.0Hz,1H),4.27(dd,J=3.1,11.4Hz,1H),2.74(t,J=7.4Hz,2H),2.59(s,3H),2.22-2.05(m,4H),1.64-1.46(m,4H),1.36-1.22(m,2H).
[0299] Example 10
[0300]
[0301] Synthesis route:
[0302]
[0303] Step 1: Synthesis of compound 13-c
[0304] Under nitrogen, n-butyllithium (2.5M, 80.28 mL, 1.2 eq) was added to tetrahydrofuran (240 mL). The reaction mixture was cooled to -78°C, and a solution of compound 13-a (20 g, 167.26 mmol, 1 eq) in tetrahydrofuran (80 mL) was slowly added dropwise. After stirring at -78°C for 0.5 hr, a solution of compound 13-b (20.70 g, 200.72 mmol, 21.34 mL, 1.2 eq) in tetrahydrofuran (80 mL) was added dropwise. The reaction mixture was slowly warmed to 25°C and stirred for 1 hour. Water (100 mL) was added dropwise to the reaction mixture, and the mixture was concentrated under reduced pressure to remove most of the tetrahydrofuran. Saturated aqueous ammonium chloride (200 mL) was then added, and the mixture was extracted with ethyl acetate (600 mL x 2). The combined organic phases were washed sequentially with water (200 mL) and saturated brine (200 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 1 / 1) to obtain compound 13-c. MS m / z (ESI): 161.8 [M+1] + .
[0305] 1 H NMR (400MHz, DMSO-d6) δppm 8.58-8.48 (m, 1H), 2.57 (s, 3H).
[0306] Step 2: Synthesis of compound 13-d
[0307] Under nitrogen, LiHMDS (1M, 168.13 mL, 1.3 eq) was added to tetrahydrofuran (210 mL). The reaction mixture was cooled to -78°C, and a solution of compound 13-c (20.9 g, 129.33 mmol, 1 eq) in tetrahydrofuran (80 mL) was added dropwise. After stirring the reaction mixture at -78°C for 0.5 hour, a solution of dimethyl oxalate (22.91 g, 193.99 mmol, 1.5 eq) in tetrahydrofuran (80 mL) was added dropwise. The reaction mixture was slowly warmed to 25°C and stirred for 1 hour. Water (100 mL) was slowly added to the reaction mixture, and then the mixture was concentrated under reduced pressure to remove most of the tetrahydrofuran. Water (200 mL) was then added, the mixture was stirred for 1 hour, and then filtered. Ethyl acetate (200 mL) was added to the filter cake, stirred for 1 hour, filtered, and the filter cake was collected and dried under reduced pressure to obtain compound 13-d. MS m / z(ESI):247.7[M+1].
[0308] Step 3: Synthesis of compound 13-e
[0309] Compound 13-d (10 g, 4.028 mmol, 1 eq) and sulfonamide (4.66 g, 48.46 mmol, 1.2 eq) were added to hydrochloric acid / methanol (4 M, 100.00 mL, 9.91 eq), and the reaction was stirred at 60 °C for 0.5 h. The reaction was filtered at about 25 °C, the filter cake was washed with methanol (100 mL), and the filtrate was concentrated under reduced pressure. Water (200 mL) was added to the reaction, which was extracted with ethyl acetate (200 mL x 2). The combined organic phase was washed with water (100 mL) and saturated brine (100 mL) successively, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (dichloromethane / methanol = 1 / 0 to 1 / 10) to obtain compound 13-e. MS m / z (ESI): 307.5 [M+1] + .
[0310] 1 H NMR (400 MHz, DMSO-d6) δ ppm 8.32-8.28 (m, 1H), 6.54 (s, 1H), 3.78 (s, 3H).
[0311] Step 4: Synthesis of compound 13-f
[0312] Compound 13-e (1.45 g, 4.71 mmol, 1 eq) was added to DMF (15 mL) under nitrogen protection, and the reaction was cooled to 0 °C. NaH (282.68 mg, 7.07 mmol, 60% content, 1.5 eq) was added in portions. After the reaction was stirred at 0 °C for 0.5 h, iodomethane (3.34 g, 23.56 mmol, 1.47 mL, 5 eq) was added dropwise. The reaction was warmed to 50 °C and stirred for 1 h. The reaction was slowly added to saturated aqueous ammonium chloride solution (50 mL) to quench, and extracted with ethyl acetate (50 mL x 2). The combined organic phase was washed with water (50 mL) and saturated brine (50 mL) successively, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 1 / 1) to obtain compound 13-f. MS m / z (ESI): 321.6 [M+1] + .
[0313] 1 H NMR (400 MHz, DMSO-d6) δ ppm 8.87-8.83 (m, 1H), 7.40 (s, 1H), 3.96 (s, 3H), 3.55 (s, 3H).
[0314] Step 5: Synthesis of compound 13-g
[0315] Under nitrogen, compound 1-e (135.32 mg, 929.67 μmol, 1.3 eq) was added to dichloromethane (2 mL). The reaction mixture was cooled to 0°C, and trimethylaluminum (2 M, 464.84 μL, 1.3 eq) was added dropwise. The reaction mixture was stirred at 0°C for 0.5 hours, followed by the dropwise addition of a solution of 13-f (130 mg, 715.13 μmol, 1 eq) in dichloromethane (2 mL). The reaction mixture was warmed to 25°C and stirred for 30 minutes. Water (50 mL) was slowly added dropwise to the reaction mixture, and the mixture was extracted with ethyl acetate (50 mL x 2). The combined organic phases were washed sequentially with water (20 mL) and saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 1 / 1) to afford compound 13-g. MS m / z(ESI):434.9[M+1].
[0316] Step 6: Synthesis of compound 13-h
[0317] Compound 13-g (350 mg, 804.08 μmol, 1 eq) was added to ethanol (2 mL), followed by the addition of sodium borohydride (45.63 mg, 1.21 mmol, 1.5 eq) in portions. The reaction mixture was stirred at 25°C for 0.5 h. 1 mL of acetic acid and water (50 mL) were slowly added dropwise to the reaction mixture, and the mixture was extracted with ethyl acetate (50 mL × 2). The organic phases were combined, washed sequentially with water (20 mL) and saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. Compound 13-h was purified by flash column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 1 / 1) to give compound 13-h. MS m / z (ESI): 438.9 [M+1] + .
[0318] 1 H NMR (400MHz, DMSO-d6) δppm 10.61 (s, 1H), 7.97 (dd, J = 2.5, 6.8Hz, 1H), 7.86 (br d,J=9.5Hz,1H),7.75(d,J=1.0Hz,1H),7.56(ddd,J=2.5,4.3,9.0Hz,1H),7.48-7.36(m,1H),4.9 6-4.83(m,1H),4.30(dd,J=2.8,11.8Hz,1H),2.67(s,3H),2.32-2.22(m,1H),2.20-2.08(m,1H).
[0319] Step 7: Synthesis of compound 13-j
[0320] Under nitrogen, compound 13-h (70.0 mg, 157.07 μmol, 1 eq), 13-i (27.24 mg, 159.11 μmol, 1 eq), potassium carbonate (65.96 mg, 477.34 μmol, 3 eq), cuprous iodide (60.60 mg, 318.23 μmol, 2 eq), and L-proline (36.63 mg, 318.23 μmol, 2 eq) were added to dimethyl sulfoxide (2 mL). The reaction solution was stirred at 110°C for 1 hour. Water (50 mL) was added to the reaction solution, and the mixture was extracted with ethyl acetate (50 mL x 2). The organic phases were combined, washed sequentially with water (30 mL) and saturated brine (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. Compound 13-j was purified by flash column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 1 / 1) to obtain compound 13-j. MS m / z(ESI):574.1[M+1] + .
[0321] Step 8: Synthesis of compound 13
[0322] Compound 13-j (30.05 mg, 52.35 μmol, 1 eq) and lithium hydroxide monohydrate (21.97 mg, 523.47 μmol, 10 eq) were added to methanol (1 mL) and water (1 mL), and the reaction mixture was stirred at 25°C for 30 minutes. The pH of the reaction mixture was adjusted to 3-4 with 4M hydrochloric acid, water (30 mL) was added, and the mixture was extracted with ethyl acetate (30 mL x 2). The combined organic phases were washed sequentially with water (20 mL) and saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by preparative HPLC (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: water (0.225% formic acid)-acetonitrile, flow rate: 25 mL / min) to obtain compound 13. MS m / z (ESI): 546.2 [M+1] + .
[0323] 1H NMR (400MHz, DMSO-d6) δppm 10.58 (s, 1H), 7.98 (dd, J = 2.4, 6.9Hz, 1H), 7.64-7.51 (m, 2H), 7.46-7.36 (m, 1H), 7.10 (s, 1H), 4.66 (br s,1H),4.27(dd,J=3.9,10.7Hz,1H),3.84(br d,J=12.3Hz,2H),2.99(br t,J=12.3Hz,2H),2.60(s,3H),2.23-2.07(m,4H),1.91(br s,1H),1.75(br d,J=11.0Hz,2H),1.28-1.16(m,2H).
[0324] Example 11
[0325]
[0326] Synthesis route:
[0327]
[0328] Step 1: Synthesis of compound 14-b
[0329] Under nitrogen, compound 14-a (300 g, 2.36 mol, 243.90 mL, 1 eq), ethylene glycol (292.85 g, 4.72 mol, 263.83 mL, 2 eq), and toluene (1.5 L) were added to a round-bottom flask. Then, p-toluenesulfonic acid (40.63 g, 235.92 mmol, 0.1 eq) was added. The mixture was refluxed at 120°C for 12 hours while separating the water with a water separator. The reaction solution was washed with water (300 mL x 2). The aqueous phase was extracted with ethyl acetate (100 mL). The combined organic phases were washed with saturated brine (300 mL x 2), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The concentrate was separated by silica gel column chromatography (petroleum ether:ethyl acetate = 100:0 to 50:50) to obtain compound 14-b.
[0330] 1 H NMR (400MHz, CDCl3) δppm 7.72 (d, J = 3.1Hz, 1H), 7.30-7.08 (m, 1H), 4.11-4.02 (m, 2H), 3.99-3.92 (m, 2H), 1.77 (s, 3H).
[0331] Step 2: Synthesis of compound 14-c
[0332] Compound 14-b (20 g, 116.81 mmol, 1 eq) was dissolved in tetrahydrofuran (360 mL), cooled to -78°C, and butyllithium (2.5 M, 51.40 mL, 1.1 eq) was slowly added dropwise. The reaction mixture was stirred at -78°C for 1 hour, followed by the slow dropwise addition of a solution of carbon tetrabromide (42.61 g, 128.49 mmol, 1.1 eq) in tetrahydrofuran (40 mL). The reaction mixture was stirred at -78°C for 0.5 hour, then warmed to 0°C and stirred for 0.5 hour. Saturated ammonium chloride solution (300 mL) was added dropwise to the reaction mixture, and the mixture was extracted with ethyl acetate (300 mL x 3). The combined organic phases were washed with saturated brine (300 mL x 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 10 / 1) to afford compound 14-c.
[0333] MS m / z(ESI):249.8[M+1] + .
[0334] 1 H NMR (400MHz, CDCl3) δppm 7.65 (s, 1H), 4.12-4.07 (m, 2H), 4.03-3.98 (m, 2H), 1.79 (s, 3H).
[0335] Step 3: Synthesis of compound 14-d
[0336] Compound 14-c (49.1 g, 196.31 mmol, 1 eq) was dissolved in acetone (280 mL) in a three-necked flask. Aqueous hydrochloric acid (6 M, 196.31 mL, 6 eq) was added at 0°C and stirred at 25°C for 2 hours. Water (200 mL) was added to the reaction solution, and the mixture was extracted with ethyl acetate (200 mL × 3). The combined organic phases were washed with saturated brine (200 mL × 3), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to provide compound 14-d.
[0337] 1 H NMR (400MHz, CDCl3) δppm 7.87 (s, 1H), 2.65 (d, J = 0.8Hz, 3H).
[0338] Step 4: Synthesis of compound 14-e
[0339] Compound 14-d (22 g, 106.76 mmol, 1 eq) and methanol (300 mL) were added to a three-necked flask. A solution of sodium methoxide in tetrahydrofuran (5 M, 42.71 mL, 2 eq) and dimethyl oxalate (18.91 g, 160.15 mmol, 1.5 eq) were then slowly added at 0°C. The mixture was stirred at 70°C for 1 hour. The reaction mixture was cooled to 0°C, water (300 mL) was added, and the pH was adjusted to 2-3 with 2 mol / L dilute hydrochloric acid. The mixture was stirred at 0°C for 30 minutes and filtered. The filter cake was washed with methanol (30 mL x 3) and dried under reduced pressure to obtain compound 14-e. MS m / z (ESI): 291.9 [M+1] + .
[0340] 1 H NMR (400MHz, DMSO-d6) δppm 7.92 (s, 1H), 6.55 (s, 1H), 3.69 (s, 3H).
[0341] Step 5: Synthesis of compound 14-f
[0342] Compound 14-e (65 g, 222.52 mmol, 1 eq), sulfonamide (32.08 g, 333.78 mmol, 19.93 mL, 1.5 eq) and hydrochloric acid / methanol solution (4 M, 500 mL, 8.99 eq) were added to a round-bottom flask. The mixture was stirred at 70°C for 2 hours. The reaction solution was cooled to 0°C, stirred for 1 hour, and then filtered. Water (300 mL) was added to the filter cake, stirred for 30 minutes, and then filtered. Tert-butyl methyl ether (200 mL) was added to the filter cake, stirred for 30 minutes, and then filtered. The filter cake was dried under reduced pressure to obtain compound 14-f. MS m / z (ESI): 351.9 [M+1] + .
[0343] 1 H NMR (400MHz, DMSO-d6) δppm 8.05 (s, 1H), 6.84 (s, 1H), 3.81 (s, 3H).
[0344] Step 6: Synthesis of compound 14-g
[0345] Under nitrogen, compound 14-f (20 g, 56.79 mmol, 1 eq) and DMF (200 mL) were added to a three-necked flask. After stirring and dissolving, sodium hydroxide (2.95 g, 73.82 mmol, 60% content, 1.3 eq) was added portionwise at 0°C. The reaction mixture was stirred at 0°C for 30 minutes, followed by the addition of iodomethane (24.18 g, 170.37 mmol, 10.61 mL, 3 eq). The mixture was stirred at 50°C for 12 hours. The reaction mixture was slowly poured into ice water (200 mL), adjusted to pH 2-3 with 1 M dilute hydrochloric acid, stirred for 15 minutes, and filtered. The filter cake was rinsed with water (50 mL) and methanol (20 mL x 2) and dried under reduced pressure.
[0346] Compound 14-g was obtained. MS m / z (ESI): 365.7 [M+1] + .
[0347] 1 H NMR (400MHz, DMSO-d6) δppm 8.35(s,1H),7.37(s,1H),3.95(s,3H),3.60(s,3H).
[0348] Step 7: Synthesis of compound 14-h
[0349] 14-g (50 g, 136.53 mmol, 1 eq) and triethylamine (69.08 g, 682.67 mmol, 95.02 mL, 5 eq) were added to acetonitrile (250 mL) and water (250 mL), and the mixture was stirred at 50°C for 1 hour. Water (200 mL) was added to the reaction solution, and the mixture was extracted with ethyl acetate (200 mL x 2). The combined organic phase was washed sequentially with water (100 mL) and saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. Compound 14-h was obtained. MS m / z (ESI): 351.8 [M+1] + .
[0350] Step 8: Synthesis of compound 14-i
[0351] Under nitrogen, compound 14-h (20 g, 56.79 mmol, 1 eq), 1-e (8.27 g, 56.79 mmol, 1 eq), DIEA (22.02 g, 170.37 mmol, 29.67 mL, 3 eq), and HATU (32.39 g, 85.18 mmol, 1.5 eq) were added to DMF (200 mL). The reaction solution was stirred at 25°C for 1 hour. Water (100 mL) was added to the reaction solution, and the mixture was extracted with ethyl acetate (500 mL x 2). The combined organic phases were washed sequentially with water (200 mL) and saturated brine (200 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain compound 14-i. MS m / z (ESI): 478.8 [M+1].
[0352] Step 9: Synthesis of compound 14-j
[0353] Dissolve 14-i (10 g, 20.85 mmol, 1 eq) in ethanol (100 mL), cool to 0°C, and add sodium borohydride (788.62 mg, 20.85 mmol, 1 eq) in portions. Stir the reaction at 0°C for 30 minutes. Slowly add 2M dilute hydrochloric acid (40 mL) and water (50 mL), and extract with ethyl acetate (50 mL). The organic phase is washed with saturated sodium chloride solution (30 mL), dried over anhydrous sodium sulfate, and filtered. The organic phase is concentrated under reduced pressure to obtain product 14-j. MS m / z (ESI): 482.9 [M+1] + .
[0354] Step 10: Chiral separation to obtain compound 14-k:
[0355] Compound 14-j (6 g, 12.40 mmol, 1 eq) was separated by chiral supercritical fluid chromatography (column: (s,s) WHELK-O1 (250 mm x 50 mm, 10 μm); mobile phase: [0.1% ammonia / ethanol]; flow rate: 220 mL / min) to afford compound 14-k. MS m / z (ESI): 482.9 [M+1] + .
[0356] Chiral SFC retention time: 3.464 minutes.
[0357] 1H NMR(400MHz, DMSO-d6)δppm 10.62(s,1H),7.97(br dd,J=2.4,6.8Hz,2H),7.89(s,1H),7.62-7.52(m,1H),7.46-7.33(m,1H),4.92(br d,J=9.6Hz,1H),4.33(br d,J=10.8Hz,1H),2.62(s,3H),2.37(br d,J=13.9Hz,1H),2.22-2.07(m,1H).
[0358] Step 11: Synthesis of compound 14-m
[0359] Compound 14-k (150.00 mg, 310.07 μmol, 1 eq) and compound 14-l (182.44 mg, 620.14 μmol, 2 eq), sodium carbonate (164.32 mg, 1.55 mmol, 5 eq), and 1,1-bis(diphenylphosphino)ferrocenepalladium chloride (22.69 mg, 31.01 μmol, 0.1 eq) were dissolved in dioxane (9 mL) and water (0.9 mL). The atmosphere was purged with nitrogen three times and stirred at 90°C for 1 hour. The reaction mixture was filtered through celite, and water (10 mL) was added to the filtrate. The mixture was extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (10 mL × 3), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 5 / 3) to obtain compound 14-m. MS m / z(ESI):571.2[M+1].
[0360] Step 12: Synthesis of compound 14-n
[0361] Compound 14-m (50 mg, 87.55 μmol, 1 eq) and acetic acid (52.58 μg, 8.76 e-1 μmol, 5.01 e-2 μL, 0.01 eq) were dissolved in tetrahydrofuran (10 mL). Wet palladium on carbon (14.44 mg, 13.57 μmol, palladium content, 1.55 e-1 eq) was added under argon. The atmosphere was purged three times with argon and then three times with hydrogen. The reaction mixture was heated to 50°C and stirred under a hydrogen atmosphere (50 psi) for 3 hours. The reaction mixture was cooled to room temperature and filtered through celite. The filter cake was washed with methanol (10 mL x 3). The filtrates were combined and concentrated. The crude product was purified by preparative HPLC (column: YMC Triart C18 250*50mm*7μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; flow rate: 30mL / min) to obtain compound 14-n. MS m / z (ESI): 573.1 [M+1] + .
[0362] Step 13: Synthesis of compound 14
[0363] Compound 14-n (10 mg, 17.45 μmol, 1 eq) was dissolved in tetrahydrofuran (2 mL) and water (1 mL). Lithium hydroxide (2.09 mg, 87.24 μmol, 5 eq) was added and stirred at 25°C for 1 hour. 1M dilute hydrochloric acid was added to the reaction solution to adjust the pH to 6-7. Water (10 mL) and ethyl acetate (10 mL x 3) were then added for extraction. The combined organic phases were washed with saturated brine (10 mL x 3), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to yield compound 14. MS m / z (ESI): 545.3 [M+1] + .
[0364] 1 H NMR (400MHz, CD3OD) δppm 7.88 (br d, J=4.3Hz, 1H), 7.53-7.47 (m, 2H), 7.21 (t, J=8.9Hz, 1H), 4.40 (br d,J=11.6Hz,1H),3.85-3.81(m,1H),3.50-3.43(m,2H),2.73(s,3H),2.38-2.25(m,4H),1.94-1.86(m,4H),1.70(br s,1H),1.56(br s,1H).
[0365] Example 12
[0366]
[0367] Synthesis route:
[0368]
[0369] Step 1: Synthesis of compound 15-a
[0370] 14-k (50 mg, 103.36 μmol, 1 eq) and compound 1-h (35.99 mg, 124.03 μmol, 1.2 eq) were dissolved in 1,4-dioxane (3 mL), and potassium phosphate (65.82 mg, 310.07 μmol, 3 eq) and water (1 mL) were added. After nitrogen displacement, tetrakistriphenylphosphine palladium (23.89 mg, 20.67 μmol, 0.2 eq) was added. The mixture was stirred at 100°C for 16 hours. The reaction solution was filtered, and water (20 mL) was added to the filtrate, followed by extraction with ethyl acetate (20 mL). The organic phase was washed with saturated sodium chloride solution (20 mL) and concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether / ethyl acetate, gradient: 0-60%) to obtain compound 15-a. MS m / z (ESI): 567.2 [M+1] + .
[0371] Step 2: Synthesis of compound 15
[0372] Compound 15-a was dissolved in tetrahydrofuran (2 mL), and lithium hydroxide monohydrate (17.76 mg, 423.24 μmol, 5 eq) and water (2 mL) were added. The mixture was stirred at 25°C for 30 min. 2M dilute hydrochloric acid was added to adjust the pH to 3-4, and water (20 mL) was added. The mixture was extracted with ethyl acetate (20 mL x 2). The combined organic phases were concentrated under reduced pressure to obtain a crude product. The crude product was purified by preparative HPLC (column: Phenomenex Gemini-NX C1875*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; flow rate: 30 mL / min) to obtain 15. MS m / z (ESI): 567.2 [M+23] + . 1 H NMR (400MHz, DMSO-d6) δppm 10.74(br s,1H),8.41(br s,1H),8.12(s,1H),7.99(dd,J=2.3,6.6Hz,1H),7.57(br d,J=7.9Hz,3H),7.41(br t,J=9.1Hz,1H),7.33(br d,J=8.1Hz,2H),4.94(br d,J=9.4Hz,1H),4.36(br d,J=11.4Hz,1H),3.45-3.44(m,2H),2.64(s,3H),2.42(brd,J=13.8Hz,2H),2.28-2.16(m,1H).
[0373] Example 13
[0374]
[0375] Synthesis route:
[0376]
[0377] Step 1: Synthesis of compound 16-b
[0378] Compound 14-h (1 g, 2.84 mmol, 1 eq) and compound 16-a (557.27 mg, 3.41 mmol, 1.2 eq) were dissolved in tetrahydrofuran (10 mL). The system was cooled to 0°C, and N,N-diisopropylethylamine (1.10 g, 8.52 mmol, 1.48 mL, 3 eq) and tri-n-propyl cyclic phosphoric anhydride in 50% ethyl acetate (3.61 g, 5.68 mmol, 3.38 mL, 50% purity, 2 eq) were added. The mixture was stirred at 50°C for 16 hours. The reaction mixture was added to saturated sodium chloride solution (20 mL) and extracted with ethyl acetate (20 mL x 2). The combined organic phases were concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether / ethyl acetate, gradient: 0-40%, flow rate: 20 mL / min) to obtain compound 16-b. MS m / z (ESI): 496.8 [M+1] + .
[0379] Step 2: Synthesis of compound 16-c
[0380] 16-b (1.5 g, 3.01 mmol, 1 eq) was dissolved in ethanol (15 mL) and sodium borohydride (114.02 mg, 3.01 mmol, 1 eq) was added at 0°C. The mixture was stirred at 0°C for 30 min. 2M dilute hydrochloric acid (20 mL) and water (20 mL) were added dropwise to the reaction solution, and the mixture was extracted with ethyl acetate (20 mL). The combined organic phase was washed with saturated sodium chloride solution (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain compound 16-c. MS m / z (ESI): 500.9 [M+1] + .
[0381] Step 3: Synthesis of compound 16-d
[0382] Compound 16-c (200 mg, 398.60 μmol, 1 eq) and 1-h (138.79 mg, 478.32 μmol, 1.2 eq) were dissolved in 1,4-dioxane (6 mL). Sodium carbonate (211.24 mg, 1.99 mmol, 5 eq) and water (0.5 mL) were added. After nitrogen purging, 1,1-bis(diphenylphosphino)ferrocenepalladium chloride (29.17 mg, 39.86 μmol, 0.1 eq) was added. After nitrogen purging three times, the mixture was stirred at 90°C for 16 hours. The reaction mixture was filtered, and water (20 mL) was added to the filtrate, which was then extracted with ethyl acetate (20 mL). The combined organic phases were washed with saturated sodium chloride solution (20 mL) and concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether / ethyl acetate, gradient: 0-60%, flow rate: 20 mL / min) to afford 16-d. MS m / z(ESI):585.0[M+1] + .
[0383] Step 4: Synthesis of compound 16
[0384] 16-d (90 mg, 153.84 μmol, 1 eq) was dissolved in methanol (2 mL) and tetrahydrofuran (4 mL). A solution of lithium hydroxide monohydrate (32.28 mg, 769.20 μmol, 5 eq) in water (2 mL) was added, and the mixture was stirred at 25°C for 30 min. 2M hydrochloric acid was added to the reaction solution to adjust the pH to 3-4. Water (20 mL) was added, and the mixture was extracted with ethyl acetate (20 mL x 2). The combined organic phases were concentrated under reduced pressure. The crude product was purified by preparative thin-layer chromatography (dichloromethane:methanol = 10:1) to obtain compound 16. MS m / z (ESI): 557.3 [M+1] + .
[0385] 1 H NMR (400MHz, DMSO-d6) δppm 10.91(br s,1H),8.07(s,1H),7.83-7.72(m,2H),7.54(br d,J=7.9Hz,2H),7.32(br d,J=8.3Hz,2H),4.87(br d,J=10.9Hz,1H),4.29(brs,1H),3.47-3.45(m,1H),2.59(br s,3H),2.36(br d,J=16.9Hz,1H),2.22-1.97(m,2H).
[0386] Example 14
[0387]
[0388] Synthesis route
[0389]
[0390] Step 1: Synthesis of compound 17-c
[0391] Under nitrogen, compound 17-b (34.37 g, 306.68 mmol, 1 eq) was added to dichloromethane (1000 mL). Aluminum trichloride (81.79 g, 613.36 mmol, 33.52 mL, 2 eq) was then added at 20°C. The reaction mixture was stirred at 20°C for 30 min, followed by the slow addition of a mixture of 17-a (50 g, 306.68 mmol, 29.76 mL, 1 eq) and dichloromethane (200 mL). After the additions were complete, the reaction mixture was stirred at 20°C for 1.5 hours. The reaction mixture was poured into 1 M aqueous potassium bisulfate (2000 mL) and stirred for 5 min, during which time a large amount of solid formed. The mixture was then filtered. The filter cake was added to ethyl acetate (1.5 L), stirred for 20 min, and filtered. The filtrate was washed with saturated aqueous sodium chloride (1 L x 1). The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to yield compound 17-c.
[0392] 1 H NMR (400MHz, CDCl3) δppm 7.54 (d, J = 4.0Hz, 1H), 7.14 (d, J = 4.0Hz, 1H), 6.57 (s, 1H), 5.89 (s, 1H), 3.87 (s, 2H).
[0393] Step 2: Synthesis of compound 17-d
[0394] Compound 17-c (40 g, 145.39 mmol, 1 eq) was dissolved in dichloromethane (800 mL). A solution of hydrobromic acid in acetic acid (71.30 g, 290.78 mmol, 47.85 mL, 33% purity, 2 eq) was added at 20°C. The reaction mixture was stirred at 20°C for 12 hours. The reaction mixture was washed with saturated aqueous sodium bisulfite (1000 mL × 1), followed by water (1000 mL × 1), and saturated aqueous sodium chloride (1000 mL × 1). The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to yield compound 17-d.
[0395] 1 H NMR (400MHz, CDCl3) δppm 7.57(d,J=4.0Hz,1H),7.16(d,J=4.0Hz,1H),3.88-3.81(m,1H),3.75-3.68 (m,1H),3.65-3.58(m,1H),3.57-3.49(m,1H),3.25(dd,J=5.6,17.7Hz,1H).
[0396] Step 3: Synthesis of compound 17-e
[0397] Compound 17-d (53 g, 148.86 mmol, 1 eq) was dissolved in methanol (600 mL), and concentrated sulfuric acid (2.92 g, 29.77 mmol, 1.59 mL, 0.2 eq) was added. The reaction solution was stirred at 20°C for 2 hours. The reaction solution was directly concentrated under reduced pressure. The resulting residue was dissolved in dichloromethane (500 mL), washed with water (500 ml × 1), then washed with 1 molar sodium carbonate aqueous solution (500 mL × 1) and saturated sodium chloride aqueous solution (500 mL × 1). The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was separated by flash column chromatography (gradient elution: petroleum ether: ethyl acetate = 100:0 to 5:1) to obtain compound 17-e.
[0398] 1 H NMR (400MHz, CDCl3) δppm 7.56(d,J=4.0Hz,1H),7.15(d,J=4.0Hz,1H),3.83-3.79(m,1H),3.77(s,3H),3.72-3.66(m,1H),3.60-3.48(m,2H),3.26-3.15(m,1H).
[0399] Step 4: Synthesis of compound 17-f
[0400] Compound 17-e (10 g, 27.02 mmol, 1 eq) was dissolved in N,N-dimethylformamide (200 mL), followed by the addition of potassium thioacetate (4.63 g, 40.53 mmol, 1.5 eq). The reaction mixture was stirred at 20°C for 12 hours. The reaction mixture was diluted with ethyl acetate (300 mL) and washed with saturated sodium chloride solution (200 mL x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (gradient elution: petroleum ether:ethyl acetate = 100:0 to 5:1) to obtain compound 17-f.
[0401] 1 H NMR (400MHz, CDCl3) δppm 7.48(d,J=4.0Hz,1H),7.12(d,J=4.0Hz,1H),3.73(s,3H),3.40-3.29(m,3H),3.26-3.18(m,1H),3.11-3.00(m,1H),2.36(s,3H).
[0402] Step 5: Synthesis of compound 17-g
[0403] At 20°C, aqueous hydrochloric acid (2M, 6.20 mL, 1.46 eq) was added to a mixture of compound 17-f (3.1 g, 8.49 mmol, 1 eq) and acetonitrile (62 mL). N-chlorosuccinimide (4.53 g, 33.95 mmol, 4 eq) was then added portionwise. The reaction mixture was stirred at 20°C for 2 hours. The reaction mixture was poured into tert-butyl methyl ether (150 mL), washed with water (150 mL × 1), then with 0.1 M aqueous sodium carbonate solution (200 mL × 1), and saturated aqueous sodium chloride solution (200 mL × 1). The mixture was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to yield compound 17-g. MS m / z (ESI): 388.8 [M+1]. + .
[0404] Step 6: Synthesis of compound 17-h
[0405] Compound 17-g (3.3 g, 8.47 mmol, 1 eq) was dissolved in tetrahydrofuran (6 mL), and aqueous ammonia (7.12 g, 50.81 mmol, 7.83 mL, 25% purity, 6 eq) was added. The reaction mixture was stirred at 20°C for 0.5 hours. The reaction mixture was directly concentrated under reduced pressure, then dissolved in ethyl acetate (60 mL), washed with saturated sodium chloride solution (60 mL × 1), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. Tert-butyl alcohol methyl ether (30 mL) was added to the crude product and the mixture was slurried at room temperature. The mixture was filtered, and the filter cake was dried under reduced pressure to obtain compound 17-h. MS m / z (ESI): 369.8 [M+1] + .
[0406] Step 7: Synthesis of compound 17-i
[0407] Compound 17-h (1.9 g, 5.13 mmol, 1 eq) was dissolved in trifluoroacetic acid (20 mL), and the reaction mixture was stirred at 70°C for 0.5 hours. The reaction mixture was directly concentrated under reduced pressure, dissolved in dichloromethane (50 mL), and then washed with saturated sodium chloride solution (50 mL × 3), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain compound 17-i. MS m / z (ESI): 351.9 [M+1] + .
[0408] 1H NMR (400MHz, CD3OD) δppm 7.81 (d, J = 4.3Hz, 1H), 7.33 (d, J = 4.0Hz, 1H), 3.81 (s, 3H), 3.60-3.44 (m, 4H), 3.21 (dd, J = 9.0, 18.8Hz, 1H).
[0409] Step 8: Synthesis of compound 17-j
[0410] Compound 17-i (1.6 g, 4.54 mmol, 1 eq) was dissolved in tetrahydrofuran (30 mL) and sodium cyanoborohydride (570.93 mg, 9.09 mmol, 2 eq) was added. The mixture was stirred at 20°C for 0.5 hours. Ethyl acetate (20 mL) was added to the reaction mixture, which was then washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (petroleum ether:ethyl acetate = 100:0 to 2:1) to obtain compound 17-j.
[0411] 1 H NMR (400MHz, CDCl3) δppm 6.97 (d, J=3.8Hz, 1H), 6.85 (d, J=3.8Hz, 1H), 4.77 (ddd, J=2.3, 8.7, 11.6Hz, 1H), 4.39 (br d,J=8.3Hz,1H),3.79(s,3H),3.55(dd,J=3.5,13.6Hz,1H),3.37(tt,J=3.3,12.7 Hz,1H),3.13-2.98(m,1H),2.57(td,J=2.6,13.8Hz,1H),1.84(q,J=12.5Hz,1H).
[0412] Step 9: Synthesis of compound 17-1
[0413] Under nitrogen protection, compound 1-e (1.48 g, 10.16 mmol, 3 eq) was dissolved in dichloromethane (10 mL). Trimethylaluminum (2 M, 5.08 mL, 3 eq) was added dropwise at 0°C. The mixture was stirred at 0°C for 15 min, and then a solution of 17-j (1.2 g, 3.39 mmol, 1 eq) in dichloromethane (10 mL) was added. The reaction solution was stirred at 20°C for 1 hour. The reaction solution was poured into 2M potassium hydrogen sulfate aqueous solution (50 mL) to produce a large amount of viscous solid. The solid was filtered and the filter cake was washed with dichloromethane (100 mL). The filtrate was concentrated under reduced pressure. The residue was slurried with dichloromethane (10 mL) at room temperature, filtered, and the filter cake was dried under reduced pressure to obtain compound 17-1.
[0414] 1H NMR(400MHz,DMSO-d6)δppm 10.47(s,1H),7.93(dd,J=2.5,6.8Hz,1H),7.49-7.43(m,1H),7.42-7.31(m,2H),7.14(d,J=3.8Hz,1H),7.00(d,J=3.8Hz,1H),4.58(br t,J=10.4Hz,1H),3.55(dd,J=3.3,13.3Hz,1H),3.23(br d,J=3.0Hz,1H),2.95(t,J=12.9Hz,1H),2.35(br d,J=13.8Hz,1H),1.82(q,J=12.5Hz,1H).
[0415] Step 10: Synthesis of compound 17-n
[0416] At 20°C, compound 17-1 (100 mg, 213.78 μmol, 1 eq) was added to 1,4-dioxane (3 mL) and water (1 mL), followed by 1-h (74.44 mg, 256.54 μmol, 1.2 eq) and sodium carbonate (33.99 mg, 320.68 μmol, 1.5 eq). The atmosphere was purged with nitrogen three times, followed by the addition of tetrakistriphenylphosphine palladium (2.47 mg, 2.14 μmol, 0.01 eq). The atmosphere was purged with nitrogen three more times, and the temperature was raised to 90°C and stirred for 12 hours. The reaction mixture was diluted with ethyl acetate (10 mL), washed with saturated sodium chloride aqueous solution (10 mL x 2), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound 17-n. MS m / z (ESI): 551.1 [M+1] + .
[0417] Step 11: Synthesis of compound 17
[0418] Compound 17-n (150 mg, 272.21 μmol, 1 eq) was added to a mixture of methanol (3 mL) and water (3 mL), followed by the addition of sodium hydroxide (65.33 mg, 1.63 mmol, 6 eq). The reaction mixture was stirred at 50°C for 12 hours. 2M hydrochloric acid was added to the reaction mixture to adjust the pH to 4-5, and the mixture was directly concentrated under reduced pressure. The crude product was separated by preparative HPLC (column: Venusil ASB Phenyl 150*30 mm*5 μm; mobile phase: water (0.05% hydrochloric acid)-acetonitrile, flow rate: 25 mL / min) to obtain compound 17.
[0419] 1H NMR(400MHz,CD3OD)δppm 7.88(dd,J=2.6,6.7Hz,1H),7.59(d,J=8.3Hz,2H),7.51-7.45(m,1H),7.33(d,J=8.3 Hz,2H),7.28(d,J=3.5Hz,1H),7.22(t,J=9.0Hz,1H),7.11(d,J=3.8Hz,1H),4.80(br d,J=10.5Hz,1H),4.82-4.77(m,1H),3.64(s,2H),3.47(dd,J=3.1,13.2Hz,1H),3.40-3.35 (m,1H),3.35-3.35(m,1H),3.22-3.12(m,1H),2.47(brd,J=13.6Hz,1H),2.22-1.94(m,1H).
[0420] Step 12: Synthesis of compounds 18 and 19
[0421] Compound 17 (700 mg, 1.34 mmol, 1 eq) was purified by chiral supercritical fluid chromatography (chromatographic column: DAICELCHIRALPAK AD (250 mm*30 mm, 10 μm); mobile phase: 0.1% NH 3. The mixture was separated by elution with H2O and EtOH (flow rate: 80 mL / min) to give compound 18 (retention time: 4.507 min) and compound 19 (retention time: 5.397 min).
[0422] Compound 18: 1 H NMR(400MHz,DMSO-d6)δppm 10.61(s,1H),7.95(dd,J=2.4,6.9Hz,1H),7.55(d,J=8.3Hz,2H),7.50(ddd,J=2.5,4.3,9.0Hz, 1H),7.43-7.38(m,1H),7.37-7.35(m,1H),7.29(d,J=8.3Hz,2H),7.12(d,J=3.5Hz,1H),4.63(br d,J=11.5Hz,1H),3.54(br dd,J=3.1,13.2Hz,2H),3.48(s,2H),3.05-2.94(m,1H),2.42(br d,J=13.6Hz,1H),2.34(s,1H),1.90(q,J=12.5Hz,1H).
[0423] Compound 19: 1H NMR(400MHz,DMSO-d6)δppm 10.54(s,1H),7.95(dd,J=2.5,7.0Hz,1H),7.57(d,J=8.3Hz,2H),7.52-7.46(m ,1H),7.43-7.36(m,2H),7.30(d,J=8.3Hz,2H),7.13(d,J=3.0Hz,1H),4.64(br d,J=11.3Hz,1H),3.57-3.51(m,4H),2.98(br t,J=12.8Hz,1H),2.42(br d,J=13.3Hz,1H),1.90(q,J=12.5Hz,1H).
[0424] Example 15
[0425]
[0426] Synthesis route
[0427]
[0428] Step 1: Synthesis of compound 20-b
[0429] Compound 17-1 (200 mg, 427.57 μmol, 1 eq) was added to a mixture of dioxane (3 mL) and water (1 mL). Compound 20-a (107.83 mg, 555.84 μmol, 1.3 eq) and sodium carbonate (67.98 mg, 641.35 μmol, 1.5 eq) were added with stirring. The atmosphere was purged with nitrogen three times, and tetrakistriphenylphosphine palladium (24.70 mg, 21.38 μmol, 0.05 eq) was added. The atmosphere was purged with nitrogen three times again. The reaction mixture was stirred at 90°C for 12 hours. 2-Methyltetrahydrofuran (10 mL) was added to dilute the reaction mixture, washed with saturated sodium chloride solution (10 mL x 2), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was separated by flash column chromatography (petroleum ether:ethyl acetate = 100:0 to 3:1) to obtain compound 20-b. MS m / z(ESI):537.0[M+1] + .
[0430] Step 2: Synthesis of compound 20
[0431] Compound 20-b (100 mg, 186.21 μmol, 1 eq) was added to a mixture of methanol (3 mL) and water (3 mL), followed by the addition of sodium hydroxide (44.69 mg, 1.12 mmol, 6 eq). The reaction mixture was stirred at 50°C for 1 hour. The reaction mixture was directly concentrated under reduced pressure, dissolved in water (10 mL), and adjusted to pH 4 with 2M hydrochloric acid. The mixture was extracted with 2-methyltetrahydrofuran (10 mL × 2). The combined organic phases were washed with saturated sodium chloride aqueous solution (20 mL × 1), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to yield compound 20. MS m / z (ESI): 509.0 [M+1] + .
[0432] 1 H NMR(400MHz,DMSO-d6)δppm 10.48(s,1H),7.99-7.91(m,3H),7.77(d,J=8.5Hz,2H),7.56(d,J=3.8Hz,1H),7.52-7.46(m, 1H),7.38-7.33(m,1H),7.43-7.32(m,1H),7.38-7.31(m,1H),7.20(d,J=3.8Hz,1H),4.67(br t,J=10.7Hz,1H),3.56(br dd,J=3.1,13.2Hz,1H),3.45-3.39(m,1H),3.27-3.19(m,1H),3.06-2.93(m,1H),2.43(br d,J=13.6Hz,1H),1.91(q,J=12.5Hz,1H).
[0433] Example 16
[0434]
[0435] Synthesis route:
[0436]
[0437] Step 1: Synthesis of compound 21-b
[0438] Compound 17-1 (200 mg, 427.57 μmol, 1 eq) was added to a mixture of 1,4-dioxane (3 mL) and water (1 mL). Compound 21-a (161.28 mg, 555.84 μmol, 1.3 eq) and sodium carbonate (67.98 mg, 641.35 μmol, 1.5 eq) were added with stirring. The atmosphere was purged with nitrogen three times, and tetrakistriphenylphosphine palladium (24.70 mg, 21.38 μmol, 0.05 eq) was added. The atmosphere was purged with nitrogen three times again. The reaction mixture was stirred at 90°C for 12 hours. 2-Methyltetrahydrofuran (10 mL) was added to the reaction mixture, which was then washed sequentially with water (10 mL × 1) and saturated sodium chloride solution (10 mL × 1), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether:ethyl acetate = 100:0 to 2:1) to obtain compound 21-b. MS m / z(ESI):550.9[M+1] + .
[0439] Step 2: Synthesis of compound 21
[0440] Compound 21-b (110 mg, 199.62 μmol, 1 eq) was added to a mixture of methanol (3 mL) and water (3 mL), and sodium hydroxide (39.92 mg, 998.10 μmol, 5 eq) was added with stirring. The reaction mixture was heated to 50°C and stirred for 1 hour. 1 M aqueous hydrochloric acid was added to the reaction mixture to adjust the pH to 4. The mixture was extracted with 2-methyltetrahydrofuran (10 mL x 2). The combined organic phases were washed with saturated aqueous sodium chloride (20 mL x 1), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain compound 21.
[0441] 1 H NMR(400MHz,DMSO-d6)δppm 10.54(s,1H),7.94(dd,J=2.4,6.9Hz,1H),7.55-7.47(m,3H),7.42-7.37(m,1H ),7.34(d,J=3.5Hz,1H),7.27(d,J=8.0Hz,2H),7.12(d,J=3.8Hz,1H),4.63(br d,J=11.5Hz,1H),3.58-3.50(m,1H),2.98(br t,J=12.8Hz,1H),2.82(br t,J=7.7Hz,2H),2.48-2.32(m,4H),1.90(q,J=12.1Hz,1H).
[0442] Example 17
[0443]
[0444] Synthesis route
[0445]
[0446] Compounds 17-1 (35 mg, 74.82 μmol, 1 eq) and 22-a (55.54 mg, 149.65 μmol, 2 eq) were added to 1,4-dioxane (2 mL) at 20°C. The atmosphere was purged with nitrogen three times, followed by the addition of 1,1-bis(diphenylphosphino)ferrocenepalladium chloride (2.74 mg, 3.74 μmol, 0.05 eq). The atmosphere was purged with nitrogen three more times, and the reaction mixture was heated to 90°C and stirred for 12 hours. The reaction mixture was filtered and purified by preparative HPLC (column: Xtimate C18 100*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile], flow rate: 25 mL / min) to obtain compound 22. 1 H NMR(400MHz,CD3OD)δppm 7.88(dd,J=2.6,6.7Hz,1H),7.64(s,1H),7.50-7.46(m,1H),7.36(s,1H),7 .22(t,J=9.0Hz,1H),7.15(d,J=3.8Hz,1H),7.04(d,J=3.5Hz,1H),4.77(br d,J=10.5Hz,1H),3.76(s,3H),3.46(dd,J=3.3,13.1Hz,1H),3.21-3.08(m,1H),2.45(br d,J=13.8Hz,1H),2.14-1.95(m,1H),1.72-1.57(m,1H).
[0447] Example 18
[0448]
[0449] Synthesis route
[0450]
[0451] Step 1: Synthesis of compound 23-c
[0452] Compound 17-1 (200 mg, 427.57 μmol, 1 eq) was added to a mixture of 1,4-dioxane (3 mL) and water (3 mL). Compound 11-b (176.88 mg, 555.84 μmol, 1.3 eq) and sodium carbonate (67.98 mg, 641.36 μmol, 1.5 eq) were added with stirring. The atmosphere was purged with nitrogen three times, and tetrakistriphenylphosphine palladium (24.70 mg, 21.38 μmol, 0.05 eq) was added. The atmosphere was purged with nitrogen three times again. The reaction mixture was heated to 90°C and stirred for 12 hours. 2-Methyltetrahydrofuran (10 mL) was added to dilute the reaction mixture, and the mixture was washed sequentially with water (10 mL × 1) and saturated sodium chloride solution (10 mL × 1), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (petroleum ether:ethyl acetate=100:0-2:1) to obtain compound 23-c.
[0453] MS m / z(ESI):579.1[M+1] + .
[0454] Step 2: Synthesis of compound 23
[0455] Compound 23-c (100 mg, 172.68 μmol, 1 eq) was added to a mixture of methanol (3 mL) and water (3 mL), and sodium hydroxide (34.53 mg, 863.41 μmol, 5 eq) was added with stirring. The reaction was heated to 50°C and stirred for 1 hour. 1 M aqueous hydrochloric acid was added to the reaction mixture to adjust the pH to 4, and the mixture was extracted with 2-methyltetrahydrofuran (10 mL x 2). The combined organic phases were washed with saturated aqueous sodium chloride (10 mL x 1), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain compound 23.
[0456] 1H NMR(400MHz,DMSO-d6)δppm 10.51(s,1H),7.94(dd,J=2.5,6.8Hz,1H),7.55(d,J=8.3Hz,2H),7.51-7.46(m,1H),7.43-7.39(m ,1H),7.38-7.34(m,1H),7.33-7.28(m,1H),7.24(d,J=8.0Hz,2H),7.13(d,J=3.3Hz,1H),4.64(br s,1H),3.55(br dd,J=3.1,13.2Hz,1H),2.98(br t,J=12.8Hz,1H),2.62-2.58(m,2H),2.45-2.31(m,2H),2.19(br t,J=7.2Hz,2H),1.96-1.87(m,1H),1.85-1.76(m,2H).
[0457] Example 19
[0458]
[0459] Synthesis route:
[0460] Step 1: Synthesis of compound 24-b
[0461]
[0462] Compound 24-a (4.7 g, 25.51 mmol, 1 eq), triphenyl phosphite (9.50 g, 30.61 mmol, 8.05 mL, 1.2 eq), and triethylamine (3.87 g, 38.27 mmol, 5.33 mL, 1.5 eq) were added to dichloromethane (200 mL). The reaction mixture was cooled to -25°C, and a solution of bromine (4.89 g, 30.61 mmol, 1.58 mL, 1.2 eq) in dichloromethane (20 mL) was slowly added. The mixture was then stirred at -25°C for 1 hour. A 20% aqueous sodium sulfite solution (100 mL) was added to the reaction mixture, and the mixture was extracted with dichloromethane (200 mL x 2). The organic phases were combined, washed sequentially with water (100 mL) and saturated brine (100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was separated by flash column chromatography (silica gel column, ethyl acetate:petroleum ether=10%-30%) to obtain compound 24-b.
[0463] 1H NMR (400MHz, CDCl3) δppm 6.01 (br s, 1H), 4.16 (br d, J = 3.51Hz, 2H), 2.51 (brd, J = 17.57Hz, 2H), 2.36-2.13 (m, 4H), 1.86 (br s, 2H), 1.53 (br s,1H),1.29(br s,3H).
[0464] Step 2: Synthesis of compound 24-c
[0465] Under nitrogen, compound 24-b (3 g, 12.14 mmol, 1 eq), bis-pinacol boronate (3.70 g, 14.57 mmol, 1.2 eq), Pd(dppf)Cl2 (1.78 g, 2.43 mmol, 0.2 eq), and potassium acetate (3.57 g, 36.42 mmol, 3 eq) were added to 1,4-dioxane (50 mL). The reaction mixture was stirred at 90°C for 2 hours. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (100 mL x 2). The organic phases were combined, washed sequentially with water (50 mL) and saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was separated by flash column chromatography (silica gel, ethyl acetate:petroleum ether = 10%-30%) to obtain compound 24-c.
[0466] 1 H NMR(400MHz,CDCl3)δppm 6.44(br d,J=2.26Hz,1H),4.06(q,J=7.19Hz,2H),2.24-2.11(m,4H),2.09-1.95(m,2H),1.78-1.66(m,2H),1.19(s,12H),1.18(br s,3H),0.84-0.75(m,1H).
[0467] Step 3: Synthesis of compound 24-d
[0468] Under nitrogen, compound 17-1 (200 mg, 427.57 μmol, 1 eq), compound 24-c (150.95 mg, 513.08 μmol, 1.2 eq), Pd(PPh3)4 (49.41 mg, 42.76 μmol, 0.1 eq), and potassium phosphate (272.28 mg, 1.28 mmol, 3 eq) were added to 1,4-dioxane (6 mL) and water (2 mL). The reaction mixture was stirred at 100°C for 2 hours. Water (20 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (30 mL x 2). The organic phases were combined, washed sequentially with water (20 mL) and saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography (silica gel, ethyl acetate:petroleum ether = 10%-30%) to obtain compound 24-d. MS m / z(ESI):555.1[M+1] + .
[0469] Step 4: Synthesis of compound 24-e
[0470] Compound 24-d (100 mg, 180.15 μmol, 1 eq) and lithium hydroxide monohydrate (75.60 mg, 1.80 mmol, 10 eq) were added to methanol (2 mL) and water (2 mL), and the reaction mixture was stirred at 25°C for 1 hour. The pH of the reaction mixture was adjusted to a weakly acidic state with 4 M hydrochloric acid solution, and water (30 mL) was added. The mixture was extracted with ethyl acetate (30 mL x 2). The organic phases were combined, washed sequentially with water (20 mL) and saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain compound 24-e. MS m / z (ESI): 527.0 [M+1] + .
[0471] Step 5: Synthesis of compound 24
[0472] Under nitrogen, compound 24-e (50 mg, 94.87 μmol, 1 eq) was added to tetrahydrofuran (5 mL), followed by the addition of Pd / C (55.97 mg, 47.44 μmol, 10% palladium content, 0.5 eq). The hydrogen atmosphere was then replaced, and the reaction mixture was stirred at 30°C under a hydrogen atmosphere (50 psi) for 2 hours. The reaction mixture was filtered and concentrated under reduced pressure. The crude product was purified by preparative HPLC (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; flow rate: 25 mL / min) to yield compound 24. MS m / z (ESI): 529.3 [M+1] + .
[0473] 1H NMR (400MHz, DMSO-d6) δppm 12.04(br s,1H),10.44(s,1H),7.98-7.85(m,1H),7.51-7.32(m,2H),7.18(br d,J=9.29Hz,1H),6.94(dd,J=7.28,3.51Hz,1H),6.76(dd,J=13.93,3.39Hz,1H),4.55(br t,J=9.29Hz,1H),3.51(br dd,J=12.92,2.13Hz,1H),3.28-3.20(m,1H),3.05-2.64(m,2H),2.38-2.28(m,1H),2.21(d,J= 7.28Hz,1H),2.13(d,J=7.03Hz,1H),2.06-1.55(m,7H),1.49-1.33(m,2H),1.20-1.01(m,1H).
[0474] Biological activity test
[0475] Experimental Example 1: HBV in vitro quantitative qPCR test
[0476] 1 Experimental purpose:
[0477] The HBV DNA content in HepG2.2.15 cells was detected by real-time quantitative qPCR. 50 The value was used as an indicator to evaluate the inhibitory effect of the compound on HBV.
[0478] 2 Experimental Materials:
[0479] 2.1 Cell line: HepG2.2.15 cells
[0480] HepG2.2.15 cell culture medium (DMEM / F12, Invitrogen-11330057; 10% serum, Invitrogen-10099141; 100 units / ml penicillin and 10 μg / ml streptomycin, Invitrogen-15140122; 1% non-essential amino acids, Invitrogen-11140076; 2 mM L-glutamine, Invitrogen-25030081; 300 μg / ml geneticin, Invitrogen-10131027)
[0481] 2.2 Reagents:
[0482] Pancreatin (Invitrogen-25300062)
[0483] DPBS (Hyclone-SH30028.01B)
[0484] DMSO (Sigma-D2650-100ML)
[0485] High-throughput DNA purification kit (QIAamp 96 DNA Blood Kit, Qiagen-51162)
[0486] Quantitative FastStart Universal Probe Master (Roche-04914058001)
[0487] 2.3 Consumables and instruments:
[0488] 96-well cell culture plate (Corning-3599)
[0489] CO2 incubator (HERA-CELL-240)
[0490] Optical sealing film (ABI-4311971)
[0491] Quantitative PCR 96-well plate (Applied Biosystems-4306737)
[0492] Fluorescence quantitative PCR instrument (Applied Biosystems-7500 real time PCR system)
[0493] 3. Experimental steps and methods:
[0494] 3.1 HepG2.2.15 cells (4x10 4 cells / well) to a 96-well plate and culture overnight at 37°C in 5% CO2.
[0495] On the second day, dilute the compound to a total of eight concentrations using a three-fold serial dilution. Add the compound to the culture wells at varying concentrations in duplicate. The final DMSO concentration in the culture medium is 1%. 1 μM GLS4 serves as a 100% inhibition control; 1% DMSO serves as a 0% inhibition control.
[0496] 3.3 On the fifth day, replace the culture medium with fresh medium containing compounds.
[0497] 3.4 On the eighth day, the culture medium in the culture wells was collected and DNA was extracted using a high-throughput DNA purification kit (Qiagen-51162). For specific steps, refer to the product manual.
[0498] 3.5 The preparation of PCR reaction solution is shown in Table 1:
[0499] Table 1. Preparation of PCR reaction solution
[0500]
[0501] Upstream primer sequence: GTGTCTGCGGCGTTTTATCA
[0502] Downstream primer sequence: GACAAACGGGCAACATACCTT
[0503] Probe sequence: 5'+FAM+CCTCTKCATCCTGCTGCTATGCCTCATC+TAMRA-3'
[0504] 3.6 Add 15 μL of reaction mixture to each well of a 96-well PCR plate, and then add 10 μL of sample DNA or HBV DNA standard to each well.
[0505] 3.7 The PCR reaction conditions were as follows: heating at 95°C for 10 minutes, followed by denaturation at 95°C for 15 seconds and extension at 60°C for 1 minute, for a total of 40 cycles.
[0506] 3.8 Data Analysis
[0507] 3.8.1 Calculation of inhibition percentage: % Inh. = [1-(DNA copy number in sample-DNA copy number in 1 μM GLS4) / (DNA copy number in DMSO control-DNA copy number in 1 μM GLS4)] x 100.
[0508] 3.8.2 Calculating EC 50 GraphPad Prism software was used to calculate the 50% inhibitory concentration (EC) of the compounds against HBV. 50 )value.
[0509] 4 Experimental results are shown in Table 2:
[0510] Table 2. qPCR assay for EC detection 50 Test results
[0511]
[0512] Conclusion: The compounds of the present invention have significant inhibitory effects on HBV.
[0513] Experimental Example 2: Cytochrome P450 isoenzyme inhibition
[0514] A. Experimental Purpose
[0515] The inhibitory effect of test compound 3 on the activity of human liver microsomal cytochrome P450 isoenzymes (CYP1A2, CYP2C9, CYP2C19, CYP2D6 and CYP3A4) was determined.
[0516] B. Experimental Operation
[0517] First, the test compound 3 (10 mM) was subjected to gradient treatment to prepare working solutions (100× final concentration). The working solution concentrations were: 5, 1.5, 0.5, 0.15, 0.05, 0.015, 0.005 mM. At the same time, working solutions of each positive inhibitor of P450 isoenzymes (CYP1A2, CYP2C9, CYP2C19, CYP2D6 and CYP3A4) and their specific substrate mixtures were prepared. Human liver microsomes frozen in a -80°C refrigerator were thawed on ice. After the human liver microsomes were completely dissolved, they were diluted with PB (phosphate buffer) to prepare a certain concentration of working solution (0.253 mg / ml). 20 μL of the substrate mixture was added to the reaction plate (Blank wells). 20 μL of PB was added and 158 μL of human liver microsome working solution was added to the reaction plate at the same time. The reaction plate was placed on ice and set aside. At this time, 2 μL of test compound (N=1) and specific inhibitor (N=2) of various concentrations were added to the corresponding wells. The group without inhibitor (test compound or positive inhibitor) was added with the corresponding organic solvent as the control sample (test compound control sample was 1:1 DMSO:MeOH, positive control sample was 1:9 DMSO:MeOH). After pre-incubation in a 37°C water bath for 10 minutes, 20 μL of coenzyme factor (NADPH) solution was added to the reaction plate and incubated in a 37°C water bath for 10 minutes. 400 μL of cold acetonitrile solution (internal standard was 200 ng / mL) was added. The reaction was terminated by adding tolbutamide and labetalol; the reaction plate was placed on a shaker and shaken for 10 min; centrifuged at 4,000 rpm for 20 min; 200 μL of supernatant was added to 100 μL of water for sample dilution; the plate was sealed, shaken, and then subjected to LC / MS / MS detection.
[0518] C. Experimental Results
[0519] The experimental results are shown in Table 3. The compounds of the present invention did not show CYP inhibitory activity.
[0520] Table 3 Inhibitory effect of test compound 3 on human liver microsomal cytochrome P450 isoenzyme activity
[0521]
[0522] Experimental Example 3: Pharmacokinetic Properties Study
[0523] A. Test sample: Compound 3
[0524] B. Experimental Methods: The purpose of this study was to determine the pharmacokinetic parameters of the compound and calculate its oral bioavailability in female Balb / c mice. Four female Balb / c mice were used. Two mice were intravenously administered with a dose of 3 mg / kg. Plasma samples were collected at 0 h (pre-dose) and 0.0833, 0.25, 0.5, 1, 2, 4, 7, and 24 h after administration. Two rats were orally administered with a dose of 1 mg / kg. Plasma samples were collected at 0 h (pre-dose) and 0.5, 1, 2, 3, 4, 6, and 24 h after administration. The collected samples were then analyzed by LC / MS / MS and data were collected. The collected analytical data were used to calculate the relevant pharmacokinetic parameters using Phoenix WinNonlin 6.2.1 software.
[0525] C. Experimental results:
[0526] Table 4 In vitro pharmacokinetic experimental results
[0527]
[0528] Conclusion: The compounds of the present invention have ideal in vitro pharmacokinetic experimental results.
[0529] Experimental Example 4: Evaluation of liver-to-blood ratio of compound in mice
[0530] A. Experimental Purpose:
[0531] Tissue distribution of test compound 3 in female Balb / c mice
[0532] B. Experimental Operation
[0533] Compound 3 was prepared as a clear solution and administered orally (PO, 3 mpk) to female Balb / c mice. The oral vehicle was 10% solutol. Whole blood was collected at 0.5, 2.0, and 8.0 hours to prepare plasma. Tissues were collected at the corresponding time points to prepare tissue homogenates. Drug concentrations were analyzed by LC-MS / MS, and pharmacokinetic parameters were calculated using Phoenix WinNonlin software.
[0534] C. Experimental Results
[0535] The experimental results are shown in Table 5.
[0536] Table 5 Pharmacokinetic test results
[0537]
[0538]
[0539] Conclusion: The compounds of the present invention have a good liver-blood distribution ratio in mice.
Claims
1. A compound represented by formula (III) or a pharmaceutically acceptable salt thereof, in, Each R1 is independently selected from halogen; m is selected from 0, 1 and 2; R2 is -COOH, T is NCH3; L1 is -CH=CH-; Ring A is phenyl; Ring B does not exist, that is, L1 is directly connected to ring C; Ring C is selected from 5-6 membered heteroaryl; The 5-6 membered heteroaryl group contains 1, 2 or 3 heteroatoms or heteroatom groups independently selected from O, S, N and NH.
2. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein Each R1 is independently selected from F, Cl, and Br.
3. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein Ring C is selected from thienyl, thiazolyl, imidazolyl and pyridyl.
4. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, which is selected from in, R1, L1, and m are as defined in claims 1-3.
5. The compound of the following formula or a pharmaceutically acceptable salt thereof:
6. Use of the compound according to any one of claims 1 to 5 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating core protein regulator-related diseases.
Citation Information
Patent Citations
Cyclic sulfamide compounds and methods of using same
CN110621672A
Cyclic sulfamide compounds for treatment of hbv
WO2020051319A1