Regulatory nucleic acid sequences
By developing synthetic central nervous system-specific promoters and cis-regulatory elements, the problem of imprecise expression control in gene therapy has been solved, enabling precise gene expression in specific regions of the midbrain or brain, thus improving therapeutic efficacy and safety.
Patent Information
- Application Number
- CN202180044080.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-04-20
- Filing Date
- 2021-04-19
- Publication Date
- 2026-06-05
- Estimated Expiration
- 2041-04-19
AI Technical Summary
When existing technologies fail to achieve gene therapy in the central nervous system, it is difficult to ensure precise control over the specific expression or widespread expression of exogenous nucleic acid sequences in the midbrain or the brain, which may result in ineffective or harmful expression outside the therapeutic window.
Synthetic central nervous system-specific promoters and cis-regulatory elements, including specific sequences or functional variants thereof, have been developed for linking with vectors to ensure gene therapy expressed specifically in the midbrain or broadly in the brain.
It achieves precise gene expression in specific regions of the midbrain or brain, reduces expression outside the therapeutic window, and improves the effectiveness and safety of gene therapy.
Smart Images

Figure CN115702246B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to regulatory nucleic acid sequences, particularly central nervous system (CNS)-specific promoters, and elements thereof. The invention also relates to expression constructs, vectors, virions, pharmaceutical compositions, and cells comprising such promoters, and methods of using them. The regulatory nucleic acid sequences are particularly useful for gene therapy applications. Background Technology
[0002] The following discussion is intended to help readers understand this disclosure and does not constitute any admission of the content or relevance of prior art.
[0003] Following extensive research into the internal mechanisms of gene regulation in vivo, recent research has focused on regulating gene expression by introducing exogenous nucleic acid sequences into cells.
[0004] This is a routine practice in research and biological processing, in which the nucleic acid sequence of the desired expression product, operatively linked to a promoter, is introduced into the production cell line, usually in the form of a vector.
[0005] In the field of gene therapy, this is particularly significant for monogenic or Mendelian disorders caused by defective genes present in the patient's cells. Introducing the nucleic acid sequence of the wild-type allele of the defective gene, operably linked to a promoter, into the patient's cells is a favorable treatment option because, theoretically, it can cure the condition, whereas traditional drugs can only address the symptoms.
[0006] In gene therapy, controlling the expression of exogenous nucleic acids introduced into cells is crucial for patient health and safety. The level of the expression product needs to be within the therapeutic window, or within the desired tissue or a specific region of that tissue. Expression outside the therapeutic window (i.e., at lower or higher levels), or outside the therapeutic area, or even outside a specific region within the desired tissue, may be ineffective or even harmful.
[0007] Dopamine transporter deficiency syndrome is a type of childhood Parkinson's disease and a candidate for gene therapy through the introduction of alternative genes, as it is caused by a loss-of-function mutation in a single gene, DAT1 / SLC6A3 (Kurian et al., 2009). DAT1 / SLC6A3 encodes the presynaptic dopamine transporter, which is involved in transporting dopamine from outside the neuron into dopaminergic neurons. The dopamine transporter utilizes the sodium gradient across the plasma membrane to transport dopamine, two sodium ions, and one chloride ion into the cell. Therefore, DAT1 / SLC6A3 plays a role in regulating the duration and intensity of dopamine signaling (Ng et al., 2014), and its dysfunction is associated with various neuropsychiatric disorders, such as attention deficit hyperactivity disorder (ADHD) (Kurian et al., 2009).
[0008] One particular difficulty in introducing an alternative DAT1 / SLC6A3 gene is that, in a non-disease state, DAT1 / SLC6A3 is specifically expressed in the midbrain, such as... Figure 1A As shown. To best mimic the original expression of DAT1 / SLC6A3, it is necessary to ensure that the alternative DAT1 / SLC6A3 gene is expressed in the midbrain (because this is the location of dopaminergic neurons), but it is also preferable to express it less in other parts of the brain.
[0009] Therefore, in other CNS regions, there is a need for promoters that drive expression in the midbrain, as well as promoters that drive specific expression in midbrain dopaminergic neurons.
[0010] Angelman syndrome is also a candidate for gene therapy through the introduction of replacement genes. Angelman syndrome is most commonly caused by mutations or deletions of a single gene, UBE3A. UBE3A is involved in the degradation of target proteins. In most neurons, only the maternally inherited copy of the UBE3A gene is active; deletion of the maternal UBE3A gene leads to Angelman syndrome.
[0011] One particular difficulty in introducing a replacement for the UBE3A gene is that, in a non-disease state, UBE3A is widely expressed in the brain, such as... Figure 1B As shown. To best mimic the original expression of the UBE3A gene, the alternative UBE3A gene is preferably widely expressed in the brain.
[0012] Therefore, promoters that drive expression in many or all regions of the brain (e.g., pan-CNS) are also needed.
[0013] Other diseases of the CNS are suitable targets for gene therapy. In some of these diseases, the therapeutic gene may need to be directed to specific CNS tissues, while in others, more general, non-specific expression in the CNS may be more appropriate.
[0014] One or more aspects of the present invention are intended to solve one or more of the problems described above. Summary of the Invention
[0015] In a first aspect of the invention, a synthetic central nervous system (CNS) specific promoter is provided, comprising a sequence according to any one of SEQ ID NO:1-8, 21-26 or a functional variant thereof, or consisting of a sequence according to any one of SEQ ID NO:1-8, 21-26 or a functional variant thereof.
[0016] In some embodiments, the synthesized CNS-specific promoter comprises a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with any one of SEQ ID NO:1-8, 21-26, or consists of a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with any one of SEQ ID NO:1-8, 21-26.
[0017] Therefore, the present invention provides various synthetic CNS-specific promoters and their functional variants. Generally preferred are variants of any one of SEQ ID NO: 1-8, 21-26 that retain at least 25%, 50%, 75%, 80%, 85%, 90%, 95%, or 100% of the activity of the reference promoter. Suitablely, the activity is evaluated using the examples described herein, but other methods may also be used.
[0018] In some embodiments, the synthesized CNS-specific promoter includes SYNP_CRE151 (SEQ ID NO:12) and at least one of the following CREs:
[0019] -CRE0004_Lmx1b(SEQ ID NO:9);
[0020] -CRE0003_Pitx3(SEQ ID NO:10);
[0021] -CRE0005_faf1_truncated body (SEQ ID NO:28);
[0022] -CRE0006_Pitx2_Truncation (SEQ ID NO:29).
[0023] -CRE0007_Pitx2_Truncation (SEQ ID NO:30); and
[0024] -CRE0008_Pitx2_Truncation (SEQ ID NO:31).
[0025] In another aspect of the invention, a CNS-specific cis-regulatory element (CRE) is provided, comprising a sequence according to any one of SEQ ID NO: 9-11, 28-31 or a functional variant thereof, or consisting of a sequence according to any one of SEQ ID NO: 9-11, 28-31 or a functional variant thereof. In some embodiments, the CNS-specific CRE comprises a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with any one of SEQ ID NO: 9-11, 28-31.
[0026] Typically, it is preferred that the CNS-specific CRE according to the invention is a variant of any one of SEQ ID NO: 9-11, 28-31, which retains at least 25%, 50%, 75%, 80%, 85%, 90%, 95%, or 100% of the activity of the reference CRE. The retained activity can be assessed by comparing the expression of a suitable reporter gene under the control of a reference promoter with that of the same promoter containing an alternative CRE under equivalent conditions. Suitablely, the activity is assessed using the examples described herein, but other methods may also be used.
[0027] Suitablely, the CRE according to the invention can be combined with another CRE to form a cis-regulatory module (CRM). Suitablely, the other CRE can be a CRE according to SEQ ID NO:9-11, 28-31 or a functional variant thereof, or they can be other CREs. Suitablely, the other CRE is CNS-specific.
[0028] In another aspect of the invention, a synthetic CNS-specific promoter is provided, comprising, or consisting of, a CRE or a functional variant thereof according to any one of SEQ ID NO: 9-11, 28-31. In some embodiments, the CRE may be operatively connected to a promoter element. In some embodiments, the promoter element may be a minimal or proximal promoter. Preferably, the proximal promoter is a CNS-specific proximal promoter.
[0029] In another aspect of the invention, a minimal or proximal promoter is provided, comprising a sequence according to any one of SEQ ID NO:12-13 or a functional variant thereof, or consisting of a sequence according to any one of SEQ ID NO:12-13 or a functional variant thereof. In another aspect of the invention, a synthetic promoter comprising said minimal or proximal promoter is provided, suitably a synthetic CNS-specific promoter comprising said minimal or proximal promoter. Suitably, the functional variant of the minimal or proximal promoter comprises a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:12-13.
[0030] Suitablely, any one of CNS-4, CNS-5_v2, CNS-6_v2, CNS-7_v2, and CNS-8_v2 (SEQ ID NO:4-8) can function as a minimal or proximal promoter. Therefore, a synthetic CNS-specific promoter is provided, comprising a minimal or proximal promoter according to any one of SEQ ID NO:12-13 or SEQ ID NO:4-8. Suitablely, the minimal or proximal promoter can be operatively linked to a CRE or CRM. The CRE can be a CRE according to the invention or any other CRE. The CRM can include a CRE according to the invention. Suitablely, the CRE or CRM is CNS-specific.
[0031] The CRE, minimal / proximal promoter or promoter of the present invention may be active in a specific region of the CNS, preferably in a specific region of the brain, or in a specific brain cell type or cell type, or in a combination of both.
[0032] The CRE, minimal / proximal promoter, or promoter of the present invention can be active in one or more different parts of the CNS. The CNS is mainly composed of the brain and spinal cord. The retina, optic nerve, olfactory nerve, and olfactory epithelial cells are sometimes considered part of the CNS along with the brain and spinal cord. This is because they are directly connected to brain tissue without intermediate nerve fibers. Suitably, the CRE, minimal / proximal promoter, or promoter of the present invention can be active in both the brain and spinal cord. Suitably, the CRE, minimal / proximal promoter, or promoter of the present invention can be active in the brain but not in the spinal cord or any other part of the CNS. Suitably, the CRE, minimal / proximal promoter, or promoter of the present invention can be active in the spinal cord but not in the brain. Preferably, the CRE, minimal / proximal promoter, or promoter of the present invention can be active in the brain. Suitably, the CRE, minimal / proximal promoter, or promoter of the present invention can be active in one or more different regions within the brain.
[0033] Non-limiting examples of brain regions include: the frontal lobe, parietal lobe, occipital lobe, temporal lobe (including the hippocampus and amygdala), cerebellum, midbrain, pons, medulla oblongata, and diencephalon (including the thalamus and hypothalamus). Non-limiting examples of spinal cord regions include: the cervical vertebrae, thoracic vertebrae, lumbar vertebrae, sacral vertebrae, and coccygeal vertebrae. In some embodiments, it may be desirable for the CRE, minimal / proximal promoter, or promoter of the present invention to exhibit broad activity in the brain. In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in all parts of the brain or CNS (pan-CNS), preferably in all regions of the brain. In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in the brain but not in other parts of the CNS such as the spinal cord. In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in regions 1, 2, 3, 4, 5, 6, 7, 8, or 9 of the aforementioned brain regions. In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in most regions of the brain, i.e., at least 5, at least 6, at least 7, at least 8, or all 9 regions of the aforementioned 9 brain regions. In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in 4 to 6 regions of the aforementioned brain. In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in 2 to 4 regions of the aforementioned brain (e.g., the midbrain, temporal lobe, and diencephalon). In some embodiments, the CRE, minimal / proximal promoter, or synthetic promoter of the present invention may be active in regions of both the brain and spinal cord. In some embodiments, the CRE, CRM, minimal / proximal promoter, or synthetic promoter of the present invention is active in the spinal cord but not in other parts of the CNS, such as the brain. In some embodiments, the CRE, CRM, minimal / proximal promoter, or synthetic promoter of the present invention is active in 1, 2, 3, 4, or 5 regions of the aforementioned spinal cord. In some embodiments, the CRE, CRM, minimum / proximal promoter, or promoter of the present invention is active in most regions of the spinal cord, i.e., active in at least 3, at least 4, or all 5 regions of the aforementioned 5 regions of the spinal cord.
[0034] In some embodiments, it may be desirable for the CRE, minimal / proximal promoter, or promoter of the present invention to exhibit major activity in one region of the CNS, and suitably in one region of the brain. Suitably, it may be desirable for the CRE, minimal / proximal promoter, or promoter of the present invention to exhibit activity in one region of the brain, but with little or no activity in other regions of the brain or CNS. In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active only in one region of the CNS (e.g., the midbrain). In some preferred embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention has specific activity in the midbrain (midbrain specificity). In one preferred embodiment, the CRE, minimal / proximal promoter, or promoter of the present invention has specific activity in the midbrain (midbrain specificity), but with little or no activity in other regions of the brain.
[0035] The CRE, minimal / proximal promoter, or promoter of the present invention can be active in various cell types of the CNS. The main cell types in the brain are neurons, astrocytes, oligodendrocytes, microglia, and ependymal cells. Other cell types may also be present, especially in inflammatory states. In some embodiments, it may be desirable for the promoter to be active in many different cell types. In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in essentially all cell types of the CNS (e.g., neurons, astrocytes, oligodendrocytes, microglia, ependymal cells). In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in at least four of the CNS cell types listed above (e.g., neurons, astrocytes, microglia, and oligodendrocytes). In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in at least three of the CNS cell types listed above (e.g., neurons, astrocytes, and oligodendrocytes).
[0036] In some embodiments, it may be desirable for the promoter to be active in a limited number of CNS cell types, or in no more than one CNS cell type. In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in no more than 4, 3, 2, or 1 of the CNS cell types listed above. In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in no more than two of the CNS cell types listed above (e.g., neurons and oligodendrocytes). In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in only one of the CNS cell types listed above.
[0037] In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in specific subtypes of CNS cells (e.g., dopaminergic neurons). In some specific preferred embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in dopaminergic neurons. In some preferred embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in dopaminergic neurons but not in other CNS cell types or other CNS cell subtypes. In some preferred embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in GABAergic or glutamatergic neurons.
[0038] In some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is active in specific types or subtypes of CNS cells and in specific regions of the brain.
[0039] The CRE, minimal / proximal promoter, or promoter of the present invention may or may not be active in tissues outside the CNS. Non-limiting examples of tissues outside the CNS include the heart, liver, kidney, skeletal muscle, and spleen. Suitably, in some embodiments, the CRE, minimal / proximal promoter, or promoter of the present invention is inactive or has very low activity in tissues or cells outside the CNS. Suitably, the CRE, minimal / proximal promoter, or promoter of the present invention is active in no more than 1, 2, 3, or 4 of the aforementioned tissues outside the CNS during ICV delivery. Suitably, the CRE, minimal / proximal promoter, or promoter of the present invention is active in no more than 1, 2, 3, or 4 of the aforementioned tissues outside the CNS during IV delivery.
[0040] Suitably, in some embodiments, it may be desirable for the CRE, minimal / proximal promoter, or promoter of the present invention to be active in the CNS, but also in other tissues besides the CNS. Suitably, the CRE, minimal / proximal promoter, or promoter of the present invention may be active in at least 1, 2, 3, 4, or 5 tissues other than the aforementioned CNS during ICV delivery. Suitably, the CRE, minimal / proximal promoter, or promoter of the present invention may be active in at least 1, 2, 3, 4, or 5 tissues other than the aforementioned CNS during IV delivery.
[0041] In some embodiments, the CRE, minimal / proximal promoter, or synthetic promoter of the present invention may be active in both the CNS and the peripheral nervous system (PNS). If the CRE, minimal / proximal promoter, or synthetic promoter of the present invention is active in both the CNS and PNS, then the CRE, minimal / proximal promoter, or synthetic promoter of the present invention may be referred to as nervous system specific (NS specific). The PNS refers to the portion of the nervous system located outside the brain and spinal cord. Non-limiting examples of the peripheral nervous system include cranial nerves, brachial plexus, thoracic and abdominal nerves, lumbar plexus, sacral plexus, and neuromuscular junctions. In some embodiments, it may be desirable for the CRE, CRM, minimal / proximal promoter, or promoter of the present invention to exhibit broad activity in the PNS. In some embodiments, the CRE, CRM, minimal / proximal promoter, or synthetic promoter of the present invention is active in 1, 2, 3, 4, 5, or 6 regions of the aforementioned PNS. In some embodiments, the CRE, CRM, minimal / proximal promoter or synthetic promoter of the present invention is active in most regions of the PNS (i.e., at least 4, at least 5 or all 6 of the 6 regions of the PNS described above).
[0042] In some embodiments, the synthetic promoters CNS-5 and CNS-5_v2 are active in most regions of the CNS and PNS (i.e., at least four, at least five, or all six regions of the aforementioned six regions of the PNS). In some embodiments, the synthetic promoters CNS-2, CNS-3, and CNS-4 are active in at least one region of the CNS and the aforementioned PNS. In some embodiments, the synthetic promoters CNS-2, CNS-3, and CNS-4 are active in sympathetic neurons of the CNS and PNS.
[0043] CNS-specific promoters can be expressed in other non-CNS cells. However, they are expressed at higher levels in CNS cells, such as neurons in the brain and spinal cord, as well as in non-neuronal or neuronal supporting cells located in the brain and spinal cord. For example, CNS-specific promoters are expressed at least 25%, or at least 35%, or at least 45%, or at least 55%, or at least 65%, or at least 75%, or at least 80%, or at least 90%, or at least 95%, or any integer between 25% and 95%, in cells located outside the CNS.
[0044] Expression driven by the promoter of this invention can be sustained in desired tissues or cells for at least 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days. Days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or more. The duration of expression can be 1-5 hours, 1-12 hours, 1-2 days, 1-5 days, 1-2 weeks, 1-3 weeks, 1-4 weeks, 1-2 months, 1-4 months, 1-6 months, 2-6 months, 3-6 months, 3-9 months, 4-8 months, 6-12 months, 1-2 years, 1-5 years, 2-5 years, 3-6 years, 3-8 years, 4-8 years, or 5-10 years.
[0045] In another aspect of the invention, an expression cassette is provided, comprising a synthetic CNS-specific promoter of any aspect of the invention operatively linked to a sequence encoding an expression product. Suitably, the expression product is a gene, such as a transgene. In some embodiments, the expression product is a therapeutic expression product.
[0046] In another aspect, a vector comprising a synthetic CNS-specific promoter or expression cassette according to the invention is provided. In some embodiments, the vector is an expression vector. In some embodiments, the vector is a viral vector. In some embodiments, the vector is a gene therapy vector, suitably an AAV vector, an adenovirus vector, a retroviral vector, a herpes simplex vector, or a lentiviral vector. Lentiviral vectors have been widely used as gene transfer tools for the CNS and are known to successfully transduce neurons, astrocytes, and oligodendrocytes (Jakobsson and Lundberg, 2006). They are advantageous because they have relatively large cloning capacity and the viral gene is not expressed. Particularly preferred lentiviral vector systems are based on HIV-1 (Jakobsson and Lundberg, 2006). Herpes simplex virus vectors and adenovirus vectors have also shown potential as CNS gene transfer tools because they have shown successful transduction into CNS cells, but are less popular due to their toxicity.
[0047] AAV vectors have been extensively discussed in the art. AAV vectors are of particular interest because they typically do not integrate into the genome and do not elicit an immune response. AAV serotypes 1, 2, 4, 5, 8, 9, rh10, DJ8, and 2g9 (AAV1, AAV2, AAV4, AAV5, AAV8, AAV9, AAVrh10, AAVDJ8, and AAV2g9) have been noted for efficient transduction in the CNS. Therefore, AAV1, AAV2, AAV4, AAV5, AAV8, AAV9, AAVrh10, AAVDJ8, AAV2g9, and their derivatives are particularly preferred AAV serotypes. In some embodiments, AAV9 is a particularly preferred AAV vector. In other embodiments, AAV2g9 is a particularly preferred AAV vector (WO2014 / 144229). In still other embodiments, AAVDJ8 is a particularly preferred AAV vector. In some embodiments, AAVrh10 is a particularly preferred AAV vector. Suitably, the AAV vector comprises a viral genome including the nucleic acid sequence of the present invention located between two inverted terminal repeats (ITRs). For example, WO2019 / 028306 discloses various wild-type and modified AAV vectors that can be used in the CNS. In one embodiment, the AAV vector is capable of penetrating the blood-brain barrier after delivery. In one embodiment, the AAV vector of the present invention is a recombinant AAV viral vector that is defectively replicated and lacks sequences encoding functional Rep and Cap proteins within its viral genome. These defective AAV vectors may lack most or all of the parental coding sequences, essentially carrying only one or two AAVITR sequences and the nucleic acid of interest for delivery to cells, tissues, organs, or organisms. Suitably, the AAV vectors used herein comprise viruses reduced to the minimum components required for transducing nucleic acid payloads or cargoes of interest. In this way, the AAV vector is designed as a specific delivery vector while lacking the harmful replication and / or integration characteristics found in wild-type viruses. In one embodiment, the AAV particle of the present invention is scAAV. In another embodiment, the AAV particles of the present invention are ssAAV. Methods for producing and / or modifying AAV particles are widely disclosed in the art (see, for example, WO2000 / 28004; WO2001 / 23001; WO2004 / 112727; WO2005 / 005610 and WO2005 / 072364, which are incorporated herein by reference).In one embodiment, the AAV carrier includes a capsid that allows penetration across the blood-brain barrier after administration into a blood vessel (e.g., intravenous or intraarterial) (see, for example, WO2014 / 144229, which discusses capsids designed for effective crossing of the blood-brain barrier, such as capsids or peptide inserts including VOY101, VOY201, AAVPHP.N, AAVPHP.A, AAVPHP.B, PHP.B2, PHP.B3, G2A3, G2B4, G2B5, PHP.S, and variants thereof).
[0048] Methods for preparing AAV vectors are well known in the art and are described in, for example, the following documents: US Patent Nos. US6204059, US5756283, US6258595, US6261551, US6270996, US6281010, US6365394, US6475769, US6482634, US6485966, US6943019, US6953690, US7022519, US7238526, U S7291498 and US7491508, US5064764, US6194191, US6566118, US8137948; or international publication numbers WO1996039530, WO1998010088, WO1999014354, WO1999 / 015685, WO1999 / 047691, WO2000 / 055342, WO2000 / 075353 and WO2001 / 023597; Methods In Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al, Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J Fir. 63:3822-8 (1989); Kajigaya et al, Proc. Nat'l. Acad. Sci. USA 88:4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al, Vir. 219:37-44 (1996); Zhao et al, Vir. 272:382-93 (2000); The contents of each of these are incorporated herein by reference. Viral replication cells commonly used to produce recombinant AAV virus particles include, but are not limited to, HEK293 cells, COS cells, HeLa cells, KB cells, and other mammalian cell lines.
[0049] In some embodiments, the vector is a non-viral vector, such as using cationic polymers or cationic lipids, as known in the art. Various non-viral vectors are discussed in Selene Ingusci et al. (Gene Therapy Tools for Brain Diseases. Front. Pharmacol. 10:724. doi:10.3389).
[0050] In another aspect, the present invention provides a viral body (viral particle) comprising a vector, preferably a viral vector. In some embodiments, the viral body is an AAV viral body.
[0051] In another aspect, a pharmaceutical composition is provided comprising a CNS-specific promoter, expression cassette, vector, or virion synthesized according to the invention.
[0052] For example, AAV carrier particles can be prepared into pharmaceutical compositions. It is understood that such compositions will necessarily include one or more active ingredients, and most commonly pharmaceutically acceptable excipients.
[0053] The pharmaceutical compositions according to this disclosure can be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or in multiple single unit doses. As used herein, a “unit dose” refers to a discrete amount of a pharmaceutical composition containing a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dose of the active ingredient administered to a subject and / or a convenient fraction of such dose, for example, one-half or one-third of such dose.
[0054] In another aspect, CNS-specific promoters, expression cassettes, vectors, virions, or pharmaceutical compositions synthesized according to the present invention are provided for use as pharmaceuticals.
[0055] In another aspect, CNS-specific promoters, expression cassettes, vectors, virions, or pharmaceutical compositions synthesized according to the present invention are provided for therapeutic purposes, i.e., prevention or treatment of medical conditions or diseases.
[0056] Suitably, the medical condition or disease is associated with abnormal gene expression, optionally in CNS tissues or cells. Suitably, the use is for gene therapy, preferably for treating diseases involving abnormal gene expression. Suitably, the medical condition or disease involving abnormal gene expression can be a CNS disease. Suitably, the medical condition or disease can be a monogenic condition of the CNS. Suitably, the gene therapy involves expressing a therapeutic expression product in CNS cells or tissues. Exemplary medical conditions or diseases relevant to aspects of the invention are discussed below.
[0057] In another aspect, a cell comprising the synthetic CNS-specific promoter, expression cassette, vector, or virion of the present invention is provided. In some embodiments, the cell is a mammalian cell, optionally a human cell. Suitably, the cell is a CNS cell. Suitably, the cell may be a neuron, astrocyte, oligodendrocyte, ependymal cell, or microglia. Suitably, the cell may be a human neuron, astrocyte, oligodendrocyte, ependymal cell, or microglia. The synthetic CNS-specific promoter may be free or located in the cell's genome.
[0058] In another aspect, synthetic CNS-specific CREs, synthetic CNS-specific promoters, expression cassettes, vectors, virions, or pharmaceutical compositions described herein are provided for the manufacture of pharmaceutical compositions for treating medical conditions or diseases. Exemplary medical conditions or diseases relating to aspects of the present invention are discussed below.
[0059] In another aspect, a method for producing an expression product is provided, the method comprising providing the synthetic CNS-specific expression cassette, vector, or virion of the present invention in CNS cells or tissues, and expressing a gene of interest present in the synthetic CNS-specific expression cassette, vector, or virion. This method can be in vitro or ex vivo, or in vivo.
[0060] In another aspect, a method for expressing therapeutic transgenes in CNS cells is provided, comprising introducing a synthetically produced CNS-specific expression cassette, vector, or virion as described herein into the CNS cells and expressing an expression product (e.g., a gene of interest) present in the synthetically produced CNS-specific expression cassette, vector, or virion. The CNS cells may be, for example, neurons, astrocytes, oligodendrocytes, ependymal cells, or microglia.
[0061] In another aspect, a method for treating a subject in need, a preferred individual, is provided, the method comprising:
[0062] - Administer to a subject the expression cassette, vector, virion, or pharmaceutical composition described herein, comprising a sequence encoding a therapeutic product operatively linked to a promoter according to the invention; and
[0063] - Expressing therapeutic amounts of the therapeutic product in the subject's CNS.
[0064] Suitable of use, this method is used to treat, prevent, alleviate, or improve neurological disorders and / or conditions. Exemplary medical conditions or diseases relating to aspects of this invention are discussed below.
[0065] Suitable administration methods can be enteric (e.g., oral, sublingual, and rectal) or parenteral (e.g., injection), including intravenous, intra-arterial, intracranial, intramuscular, subcutaneous, intra-articular, intrathecal, and intradermal injection. Preferred administration methods are intravenous, intra-arterial, intracranial, and intrathecal injection.
[0066] In some implementations, the method involves introducing the expression cassette, vector, virion, or pharmaceutical composition described herein into the central nervous system (CNS), including a gene encoding a therapeutic product. A particular challenge in introducing the expression cassette, vector, virion, or pharmaceutical composition into the CNS is the blood-brain barrier. The blood-brain barrier is a semi-permeable boundary of endothelial cells that prevents certain chemicals and molecules in the bloodstream from crossing into the extracellular fluid of the central nervous system. In animal studies, this barrier has been overcome by direct injection into the brain of animals, such as intracranial injection, appropriately intraventricular (ICV) injection (see, for example, Keiser et al., Curr Protoc Mouse Biol. 2018 Dec; 8(4):e57). This method of administration may be disadvantageous for gene therapy in humans because it is difficult to perform and can be dangerous for the subject.
[0067] Conversely, in a human gene therapy setting, it is preferred to introduce the expression cassette described herein into the CNS via intravenous or intra-arterial (e.g., intracarotid) administration of a viral vector containing the expression cassette. Suitablely, this viral vector is an AAV vector. Intravenous or intra-arterial administration of certain serotypes of AAV allows the AAV vector to penetrate into the brain. Due to the CNS specificity of the CNS-specific promoter synthesized according to the invention, minimal expression in non-CNS tissues and cells is expected. Furthermore, the permeability of AAV vectors is expected to improve with the development of improved AAV capsids for CNS penetration. Intravenous or intra-arterial administration is safer and less invasive than intracranial administration, while still allowing penetration across the blood-brain barrier.
[0068] Appropriately, the medical condition or disease is a CNS condition or disease, such as a neurological disorder and / or condition. Appropriately, the medical condition or disease may be selected from, for example: dopamine transporter deficiency syndrome, attention deficit / hyperactivity disorder (ADHD), bipolar disorder, epilepsy, multiple sclerosis, tau pathologies, Alzheimer's disease, Huntington's disease, Parkinson's disease, Krabbe's disease, adrenoleukodystrophy, motor neuron disease, cerebral palsy, Batten disease, Gaucher disease, Tay Sachs disease, Rett syndrome, Sandhoff disease, Charcot-Marie-Tooth disease. Diseases such as Anglemann syndrome, Canavan disease, late-stage infantile neuronal ceroid lipofuscin deposition, mucopolysaccharidosis IIIA, mucopolysaccharidosis IIIB, metachromatic leukodystrophy, hereditary lysosomal storage disorders such as Niemann-Pick disease C1 and / or neuronal ceroid lipofuscin deposition such as Barton's disease, progressive supranuclear palsy, corticobasal ganglia syndrome, and brain cancers (including astrocytomas and glioblastomas).
[0069] Appropriately, the nucleic acid encoding the expression product may be one of the genes selected from the group consisting of: NPC1, EAAT2, NPY, CYP46A1, GLB1, APOE (APOE2), HEX, CLN1, CLN2, CLN3, CLN4, CLN5, CLN6, SUMF1, DCTN1, PRPH, SOD1, NEFH, GBA, IDUA, NAGLU, GUSB, ARSA, MANB, AADC, GDNF, NTN, ASP, MECP2, PTCHD1, GJB1, UBE3A, HEXA, FXN, and MOG.
[0070] Alternatively or concurrently, the expression product may be an antibody, an antibody fragment, or an antibody-like scaffold protein.
[0071] Alternatively or concurrently, the expression product may be a gene editing system targeting disease alleles (e.g., CRISPR-Cas9 system, TALEN, ZFN, etc.).
[0072] Alternatively or concurrently, the expression product may be one or more regulatory polynucleotides, such as RNA or DNA molecules as therapeutic agents. For example, the regulatory polynucleotide may be miRNA or siRNA. The target gene may be any gene associated with any neurological disorder, such as, but not limited to, those listed herein. For example, siRNA duplexes or encoding dsRNAs may reduce or silence the expression of target genes in CNS cells, thereby improving symptoms of neurological disorders. In one non-limiting example, the target gene is Huntington's protein (HTT). In another non-limiting example, the target gene is microtubule-associated protein tau (MAPT).
[0073] In another aspect, a synthetic CNS-specific promoter is provided, comprising, or consisting of, SEQ ID NO:1 or SEQ ID NO:21. Suitably, upon administration via ICV injection, the synthetic CNS-specific promoter is capable of promoting extensive intracranial expression of an expression product operatively linked to the CNS-specific promoter. Suitably, the synthetic CNS-specific promoter is active in at least six regions of the brain. Suitably, upon administration via ICV injection, the synthetic CNS-specific promoter is capable of promoting CNS-specific expression of the expression product in the brain at a level of at least 100%, 150%, or 200% compared to Synapsin-1 (SEQ ID NO:14). Suitably, upon administration via ICV injection, the synthetic CNS-specific promoter is capable of promoting expression in the cortex and hippocampus.
[0074] In another aspect, a method for expressing an expression product in the CNS is provided, the method comprising introducing an expression cassette containing a synthetic CNS-specific promoter operatively linked to the expression product into CNS cells, the synthetic CNS-specific promoter comprising, or consisting of, SEQ ID NO:1 or SEQ ID NO:21. Suitably, the expression cassette is introduced into the CNS via ICV injection, and the expression product is widely distributed in the brain. Suitably, the expression of the expression product in the brain is in at least six regions of the brain. Suitably, the synthetic CNS-specific promoter is capable of promoting CNS-specific expression of the expression product in the brain at a level of at least 100%, 150%, or 200% compared to Synapsin-1 (SEQ ID NO:14). Suitably, the expression cassette is introduced into the CNS via ICV injection, and the expression product is expressed in the cortex and hippocampus.
[0075] In another aspect, a synthetic CNS-specific promoter is provided, comprising, or consisting of, SEQ ID NO:2, SEQ ID NO:25, or SEQ ID NO:7 or a functional variant thereof, as described above. Suitably, when administered via ICV injection, such a synthetic CNS-specific promoter is capable of promoting the widespread expression in the brain of an expression product of a nucleic acid operatively linked to the CNS-specific promoter. Suitably, the synthetic CNS-specific promoter is active in at least six regions of the brain. Suitably, when administered via IV injection, the synthetic CNS-specific promoter comprising, or consisting of, SEQ ID NO:2 or a functional variant thereof, is capable of promoting the widespread intracranial expression of an expression product operatively linked to the CNS-specific promoter. Suitably, the synthetic CNS-specific promoter comprising, or consisting of, SEQ ID NO:2 or a functional variant thereof, does not promote expression in the midbrain. Appropriately, when administered via IV injection, a synthetic CNS-specific promoter comprising SEQ ID NO:7 or SEQ ID NO:25 or a functional variant thereof, or consisting of SEQ ID NO:7 or SEQ ID NO:25 or a functional variant thereof, can promote the expression of the expression product operatively linked to the CNS-specific promoter in the cortex, hippocampus, and midbrain.
[0076] In another aspect, a method for expressing an expression product in the CNS is provided, the method comprising introducing an expression cassette comprising a synthetic CNS-specific promoter operatively linked to a nucleic acid encoding the expression product into CNS cells, the synthetic CNS-specific promoter comprising, or consisting of, SEQ ID NO:2 or a functional variant thereof, SEQ ID NO:25 or a functional variant thereof, or SEQ ID NO:7 or a functional variant thereof, or consisting of, or consisting of, SEQ ID NO:2 or a functional variant thereof, SEQ ID NO:25 or a functional variant thereof, or SEQ ID NO:7 or a functional variant thereof. Suitably, the expression cassette is introduced into the CNS via ICV injection, and the expression product is widely expressed in the brain. Suitably, the expression of the expression product in the brain is in at least six brain regions discussed above. Suitably, the expression cassette comprising, or consisting of, SEQ ID NO:2 or a functional variant thereof, or consisting of, SEQ ID NO:2 or a functional variant thereof is introduced into the CNS via IV injection, and the expression product is widely expressed in the brain, but not widely expressed in the midbrain. Appropriately, an expression cassette comprising SEQ ID NO:7 or SEQ ID NO:25 or a functional variant thereof, or consisting of SEQ ID NO:7 or SEQ ID NO:25 or a functional variant thereof, is introduced into the CNS via IV injection, and the expression product is expressed in the cortex, hippocampus, and midbrain, but not in the midbrain.
[0077] In another aspect, a synthetic CNS-specific promoter is provided, comprising, or consisting of, SEQ ID NO:3, SEQ ID NO:22, or SEQ ID NO:4 or a functional variant thereof, or composed of, SEQ ID NO:3, SEQ ID NO:22, or SEQ ID NO:4 or a functional variant thereof, as described above. Suitably, when administered via ICV injection, the synthetic CNS-specific promoter is capable of promoting expression in the cortex and hippocampus. Suitably, the synthetic CNS-specific promoter has no activity or very low activity in other regions of the brain. Suitably, when administered via IV injection, the synthetic CNS-specific promoter comprising, or consisting of, SEQ ID NO:3, or a functional variant thereof, SEQ ID NO:22, or SEQ ID NO:4 or a functional variant thereof, or composed of, or consisting of, SEQ ID NO:3, or a functional variant thereof, SEQ ID NO:22, or SEQ ID NO:4 or a functional variant thereof, is capable of promoting expression in the cortex, striatum, and hippocampus. Appropriately, synthetic CNS-specific promoters comprising SEQ ID NO:4 or SEQ ID NO:22 or functional variants thereof, or composed of SEQ ID NO:4 or SEQ ID NO:22 or functional variants thereof, can additionally promote expression in the midbrain.
[0078] In another aspect, a method for expressing an expression product in the CNS is provided, the method comprising introducing an expression cassette containing a synthetic CNS-specific promoter operatively linked to a nucleic acid encoding the expression product into CNS cells, the synthetic CNS-specific promoter comprising, or consisting of, SEQ ID NO:3 or a functional variant thereof, SEQ ID NO:22 or a functional variant thereof, or SEQ ID NO:4 or a functional variant thereof, or composed of, or consisting of, SEQ ID NO:3 or a functional variant thereof, SEQ ID NO:22 or a functional variant thereof, or SEQ ID NO:4 or a functional variant thereof. Suitably, the expression cassette is introduced into the CNS via ICV injection, and the expression product is expressed in the cortex and hippocampus. Suitably, expression of the expression product is minimal in other regions of the brain. Suitably, the expression cassette is introduced into the CNS via ICV injection, and the expression product is expressed in the cortex and hippocampus. Suitably, the expression cassette is introduced into the CNS via IV injection, and the expression product is expressed in the cortex, striatum, and hippocampus.
[0079] In another aspect, a synthetic CNS-specific promoter is provided, comprising, or consisting of, SEQ ID NO:5 or SEQ ID NO:23 or a functional variant thereof, as described above. Suitably, the synthetic CNS-specific promoter is capable of promoting expression in the cortex, striatum, hippocampus, and midbrain. Suitably, the synthetic CNS-specific promoter has no activity or very low activity in other regions of the brain. Suitably, the synthetic CNS-specific promoter is administered via ICV injection.
[0080] In another aspect, a method for expressing an expression product in the CNS is provided, the method comprising introducing an expression cassette containing a synthetic CNS-specific promoter operatively linked to a nucleic acid encoding the expression product into CNS cells, the synthetic CNS-specific promoter comprising, or consisting of, SEQ ID NO:5 or SEQ ID NO:23 or a functional variant thereof, or composed of, or consisting of, SEQ ID NO:5 or SEQ ID NO:23 or a functional variant thereof. Suitably, the expression cassette is introduced into the CNS via ICV injection. Suitably, the expression product is expressed in the cortex, striatum, hippocampus, and midbrain. Suitably, expression in other regions of the brain is minimal.
[0081] In another aspect, a synthetic CNS-specific promoter is provided, comprising, or consisting of, SEQ ID NO:6, SEQ ID NO:24, SEQ ID NO:26, or SEQ ID NO:8 or functional variants thereof, as described above. Suitably, when administered via ICV injection, the synthetic CNS-specific promoter is capable of promoting expression in the hippocampus, cortex, and midbrain. Suitably, when administered via IV injection, the synthetic CNS-specific promoter comprising, or consisting of, SEQ ID NO:6, or SEQ ID NO:24 or functional variants thereof, or functional variants thereof, is capable of promoting expression in the hippocampus, midbrain, and cerebellum. Suitably, when administered via IV injection, the synthetic CNS-specific promoter comprising, or consisting of, SEQ ID NO:8, or SEQ ID NO:26 or functional variants thereof, or functional variants thereof, is capable of promoting expression in the hippocampus and midbrain. Suitablely, the synthetic CNS-specific promoter has no or very low activity in other regions of the brain. Suitablely, synthetic CNS-specific promoters comprising SEQ ID NO:6 or a functional variant thereof, SEQ ID NO:24 or a functional variant thereof, SEQ ID NO:26 or a functional variant thereof, or SEQ ID NO:8 or a functional variant thereof, or composed of SEQ ID NO:6 or a functional variant thereof, SEQ ID NO:24 or a functional variant thereof, SEQ ID NO:26 or a functional variant thereof, or SEQ ID NO:8 or a functional variant thereof, are primarily active in neurons. Suitablely, synthetic CNS-specific promoters comprising SEQ ID NO:8 or SEQ ID NO:26 or a functional variant thereof, or composed of SEQ ID NO:8 or SEQ ID NO:26 or a functional variant thereof, are primarily active in dopaminergic neurons.
[0082] In another aspect, a method for expressing an expression product in the CNS is provided, the method comprising introducing an expression cassette comprising a synthetic CNS-specific promoter operatively linked to a nucleic acid encoding the expression product into CNS cells, the synthetic CNS-specific promoter comprising, or consisting of, SEQ ID NO:6, SEQ ID NO:24, SEQ ID NO:26, or SEQ ID NO:8. Suitably, the expression cassette is introduced into the CNS via ICV injection, and the expression product is expressed in the hippocampus, cortex, and midbrain. Suitably, an expression cassette comprising, or consisting of, SEQ ID NO:6 or SEQ ID NO:24, or a functional variant thereof, or a functional variant thereof, is introduced into the CNS via IV injection, and the expression product is expressed in the hippocampus, midbrain, and cerebellum. Suitable, an expression cassette comprising SEQ ID NO:8 or SEQ ID NO:26 or a functional variant thereof, or consisting of SEQ ID NO:8 or SEQ ID NO:26 or a functional variant thereof, is introduced into the CNS via IV injection, and the expression product is expressed in the hippocampus and midbrain. Suitable, expression of the expression product is minimized in other regions of the brain.
[0083] In another aspect, a method for expressing an expression product in dopaminergic neurons is provided, the method comprising introducing a synthetic CNS-specific expression cassette into the dopaminergic neurons via IV injection, wherein the CNS-specific expression cassette comprises SEQ ID NO:8 or SEQ ID NO:26 or a functional variant thereof. Attached Figure Description
[0084] Figure 1A The expression pattern of the DAT1 / SLC6A3 gene in coronal sections of the adult mouse brain (taken from the Alan Mouse Brain Atlas; mouse.brain-map.org) is shown. DAT1 / SLC6A3 is highly expressed in the midbrain.
[0085] Figure 1B The expression pattern of the UBE3A gene in coronal sections of the adult mouse brain (from Alan's mouse brain atlas; mouse.brain-map.org) is shown. UBE3A is widely expressed in the brain.
[0086] Figure 2AIntracranial biodistribution of transgenic GFP in sagittal sections is shown for CNS-1 (SEQ ID NO:1), CNS-2 (SEQ ID NO:2), CNS-3 (SEQ ID NO:3), and CNS-4 (SEQ ID NO:4) delivered via ICV and IV, as well as for the control promoter hSyn1. Scale bar is 1 mm.
[0087] Figure 2B Intracranial biodistribution of transgenic GFP in sagittal sections under control of CNS-5 (SEQ ID NO:23), CNS-6 (SEQ ID NO:24), CNS-7 (SEQ ID NO:25), and CNS-8 (SEQ ID NO:26) delivered via ICV and IV is shown. Scale bar is 1 mm.
[0088] Figure 3A Intracranial biodistribution of transgenic GFP controlled by CNS-1 (SEQ ID NO:1), CNS-2 (SEQ ID NO:2), CNS-3 (SEQ ID NO:3), and CNS-4 (SEQ ID NO:4) delivered via ICV is shown in coronal sections. Scale bar is 1 mm.
[0089] Figure 3B Intracranial biodistribution of transgenic GFP in coronal sections under the control of the ICV-delivered CNS-5 (SEQ ID NO:23), CNS-6 (SEQ ID NO:24), CNS-7 (SEQ ID NO:25), and CNS-8 (SEQ ID NO:26) and the control promoter hSyn1 is shown. Scale bar is 1 mm.
[0090] Figure 4A Intracranial biodistribution of transgenic GFP in coronal sections under control of CNS-1 (SEQ ID NO:1), CNS-2 (SEQ ID NO:2), CNS-3 (SEQ ID NO:3), and CNS-4 (SEQ ID NO:4) delivered via IV is shown. Scale bar is 1 mm.
[0091] Figure 4B Intracranial biodistribution of transgenic GFP in coronal sections under control of CNS-5 (SEQ ID NO:23), CNS-6 (SEQ ID NO:24), CNS-7 (SEQ ID NO:25), and CNS-8 (SEQ ID NO:26) delivered via IV is shown. Scale bar is 1 mm.
[0092] Figure 5AThe intracranial biodistribution of transgenic GFP in different brain regions is shown at high magnification, controlled by the control promoter hSyn1 and CNS-1 (SEQ ID NO:1), CNS-2 (SEQ ID NO:2), CNS-3 (SEQ ID NO:3), and CNS-4 (SEQ ID NO:4) delivered via ICV. Scale bar is 100 μm.
[0093] Figure 5B The intracranial biodistribution of transgenic GFP in different brain regions is shown at high magnification, controlled by the control promoter hSyn1 and delivered via ICV for CNS-5 (SEQ ID NO:23), CNS-6 (SEQ ID NO:24), CNS-7 (SEQ ID NO:25), and CNS-8 (SEQ ID NO:26). Scale bar: 100 μm.
[0094] Figure 6A The intracranial biodistribution of transgenic GFP in different brain regions is shown at high magnification under control of IV-delivered CNS-1 (SEQ ID NO:1), CNS-2 (SEQ ID NO:2), CNS-3 (SEQ ID NO:3), and CNS-4 (SEQ ID NO:4) and an uninjected control. Scale bar: 100 μm.
[0095] Figure 6B The intracranial biodistribution of transgenic GFP in different brain regions is shown at high magnification under control of IV-delivered CNS-5 (SEQ ID NO:23), CNS-6 (SEQ ID NO:24), CNS-7 (SEQ ID NO:25), and CNS-8 (SEQ ID NO:26) and an uninjected control. Scale bar: 100 μm.
[0096] Figure 7A The biodistribution of transgenic GFP in the midbrain under the control of the control promoter hSyn1 and CNS-1 (SEQ ID NO:1), CNS-2 (SEQ ID NO:2), CNS-3 (SEQ ID NO:3), and CNS-4 (SEQ ID NO:4) delivered via ICV is shown. The left column shows GFP expression, the middle column shows TH+ positive cells (dopaminergic neurons), and the right column shows the superposition of both with the nuclear dye DAPI. Scale bar is 25 μm.
[0097] Figure 7BThe biodistribution of transgenic GFP in the midbrain under the control of CNS-5 (SEQ ID NO:23), CNS-6 (SEQ ID NO:24), CNS-7 (SEQ ID NO:25), and CNS-8 (SEQ ID NO:26) delivered via ICV is shown. The left column shows GFP expression, the middle column shows TH+ positive cells (dopaminergic neurons), and the right column shows the superposition of both with the nuclear dye DAPI. Scale bar is 25 μm.
[0098] Figure 8A The biodistribution of transgenic GFP in the midbrain under the control of CNS-1 (SEQ ID NO:1), CNS-2 (SEQ ID NO:2), CNS-3 (SEQ ID NO:3), and CNS-4 (SEQ ID NO:4) delivered via IV is shown. The left column shows GFP expression, the middle column shows TH+ positive cells (dopaminergic neurons), and the right column shows the superposition of both with the nuclear dye DAPI. Scale bar is 25 μm.
[0099] Figure 8B The biodistribution of transgenic GFP in the midbrain under the control of CNS-5 (SEQ ID NO:23), CNS-6 (SEQ ID NO:24), CNS-7 (SEQ ID NO:25), and CNS-8 (SEQ ID NO:26) delivered via IV is shown. The left column shows GFP expression, the middle column shows TH+ positive cells (dopaminergic neurons), and the right column shows the superposition of both with the nuclear dye DAPI. Scale bar is 25 μm.
[0100] Figure 9 The biodistribution of transgenic GFP in different tissues under the control of CNS-1-8 (SEQ ID NO: 1-4, 23-26) delivered via ICV or IV and the control promoter Synapsin1 (SEQ ID NO: 14) is shown. For this data, RNA extracted from systemic organs was converted to RNA and quantified by qPCR. Different promoters in CNS-1-8 (SEQ ID NO: 1-4, 23-26) showed off-target expression in the liver, kidney, heart, skeletal muscle, or spleen.
[0101] Figure 10The percentage of GFP immunoreactivity in different brain regions is shown after ICV or IV delivery of GFP driven by CNS 1-8 (SEQ ID NO:1-4,23-26) or Synapsin-1 (SEQ ID NO:14). Data (mean ± SEM) were obtained by quantifying the GFP staining intensity of 10 non-overlapping RGB images in the cortex, hippocampus, striatum, midbrain, and cerebellum using threshold analysis. Images were taken at x40 magnification through discrete brain regions, kept at constant settings. Foreground immunostaining was defined by the mean of the highest and lowest signal values. Data are expressed as the mean percentage area of immunoreactivity per unit field of view for each region of interest (n=3). The highest expression was observed in the cortex and hippocampus brain regions after ICV delivery. CNS 1-8 (SEQ ID NO:1-4,23-26) expression in the hippocampus was higher than that of the hSyn1 control. CNS-1 (SEQ ID NO:1) expression in the hippocampus, midbrain, and cerebellum was higher than that of hSyn1 delivered via ICV.
[0102] Figure 11 This image shows GFP expression controlled by CNS-1 (SEQ ID NO:1) during ICV delivery. Magnification is x40. NeuN is a marker of neuronal nuclei. GFAP is a marker of astrocytes, and IBA1 is a marker of microglia. GFP expression driven by the CNS-1 (SEQ ID NO:1) promoter is predominantly neuronal.
[0103] Figure 12 Intracranial biodistribution of transgenic GFP in sagittal sections is shown under the control of CNS-8 (SEQ ID NO:26) delivered via ICV and IV and the control promoter hSyn1. Scale bar is 1 mm.
[0104] Figure 13A The intracranial biodistribution of transgenic GFP under the control of CNS-8 (SEQ ID NO:26) delivered via ICV and the control promoter hSyn1 is shown in coronal sections. On the left, the scale bar is 1 mm. On the right, brain regions are shown at a higher magnification. The scale bar is 100 μm.
[0105] Figure 13B The intracranial biodistribution of transgenic GFP controlled by the IV-delivered CNS-8 (SEQ ID NO:26) and the control promoter hSyn1 is shown in coronal sections. On the left, the scale bar is 1 mm. On the right, brain regions are shown at a higher magnification. The scale bar is 100 μm.
[0106] Figure 14AThe biodistribution of transgenic GFP in the midbrain under the control of CNS-8 (SEQ ID NO:26) delivered via ICV (top) and IV (bottom) is shown. The left column shows TH+ positive cells (dopaminergic neurons), the middle column shows GFP expression, and the right column shows the superposition of both with the nuclear dye DAPI. Scale bar is 25 μm.
[0107] Figure 14B The percentage of dopaminergic neurons (TH+GFP+ cells) exhibiting GFP expression outside of all dopaminergic neurons is shown as a quantification. The left portion of the figure shows the percentage of GFP-expressing dopaminergic neurons under control with the control promoter Syn-1 in ICV and IV deliveries. The middle portion of the figure shows the percentage of GFP-expressing dopaminergic neurons under control with CNS-8 (SEQ ID NO:26) when a low dose is administered in ICV and IV deliveries (Example 1). The right portion of the figure shows the percentage of GFP-expressing dopaminergic neurons under control with CNS-8 (SEQ ID NO:26) when a high dose is administered in ICV and IV deliveries (Example 2).
[0108] Figure 15 This image shows a comparison of the biodistribution of transgenic GFP controlled by CNS-8 (SEQ ID NO:26) in different tissues under low and high doses. The left side shows the biodistribution of GFP controlled by CNS-8 (SEQ ID NO:26) under low doses, and the right side shows the biodistribution of GFP controlled by CNS-8 (SEQ ID NO:26) under high doses. The data on the biodistribution of GFP controlled by CNS-8 (SEQ ID NO:26) under low doses are compared with... Figure 9 The data shown are identical. For this data, RNA extracted from systemic organs was converted to RNA and quantified by qPCR.
[0109] Figure 16A The expression pattern of the faf1 gene in mouse PNS neurons is shown in single-cell transcriptome data (Zeisel et al., 2018). Dark gray indicates high expression, white indicates no expression, and light gray indicates low expression. faf1 is expressed in many PNS neurons.
[0110] Figure 16B The expression pattern of the pitx3 gene in PNS neurons is shown in single-cell transcriptome data (Zeisel et al., 2018). Dark gray indicates high expression, white indicates no expression, and light gray indicates low expression. pixt3 is expressed in sympathetic PNS neurons. Detailed Implementation
[0111] CRE and its functional variants
[0112] This article discloses various CREs that can be used to construct CNS-specific promoters. Appropriately, the CREs are CNS-specific. These CREs are typically derived from genomic promoter and enhancer sequences, but in this paper they are used in cases entirely different from their primary genomic environments. Generally, CREs constitute a small portion of a larger genomic regulatory domain that controls the expression of genes normally associated with it. Surprisingly, these CREs (many of which are very small) can be isolated from their normal environments and retain CNS-specific regulatory activity. This is surprising because removing regulatory sequences from the complex and “three-dimensional” natural environment of the genome often results in a significant loss of activity, so there is no reason to expect a particular CRE to retain the observed level of activity once removed from its natural environment. It is even more surprising when CREs retain CNS-specific activity in AAV vectors. This is a special case because AAV vectors include inverted terminal repeats (ITRs), which have a different DNA structure compared to the genome, and it is known that both ITRs and DNA structure affect CRE activity.
[0113] It should be noted that the sequence of the CRE of the present invention can be altered without causing a significant loss of activity. Functional variants of the CRE can be prepared by modifying the sequence of the CRE, provided that modifications that are significantly detrimental to the activity of the CRE are avoided. Given the information provided in this disclosure, modifying the CRE to provide functional variants is straightforward. Furthermore, this disclosure provides a simple method for evaluating the function of any particular CRE variant.
[0114] The relatively small size of certain CREs according to the invention is advantageous because it allows the CRE, and more specifically, the promoter containing the CRE, to be provided in the vector while occupying a minimal amount of vector payload. This is especially important when the CRE is used in vectors with limited capacity, such as AAV-based vectors.
[0115] The CREs of this invention include certain CNS-specific TFBSs. It is generally desirable that these CNS-specific TFBSs retain function in functional variants of the CRE. Those skilled in the art will readily understand that the sequence of a TFBS can vary while still retaining function. Therefore, the sequence of a TFBS is typically characterized by a common sequence in which a certain degree of variation is usually present. Further information about the variations occurring in the TFBS can be illustrated using a position weight matrix (PWM), which represents the frequency of a particular nucleotide typically present at a particular position in the common sequence. Details of the TF common sequence and the associated position weight matrix can be found, for example, in databases such as Jaspar or Transfac (http: / / jaspar.genereg.net / and http: / / gene-regulation.com / pub / databases.html). This information enables those skilled in the art to modify the sequence of any particular TFBS of the CRE in a manner that preserves CRE function and, in some cases, even enhances CRE function. Therefore, those skilled in the art can be well guided on how to modify the TFBS of any particular TF while retaining the ability to bind the desired TF; for example, the Jaspar system will score a hypothetical TFBS based on its similarity to a specific PWM. Furthermore, all TFBSs can be identified / analyzed by scanning all PWM CREs in the JASPAR database. Of course, technicians can find further guidance in the literature, and routine experiments can be used to confirm the binding of TFs to the assumed TFBSs in any variant CRE. Clearly, significant modifications can be made to sequences in CREs while preserving function, even within the TFBSs themselves.
[0116] The CRE of this invention can be used in conjunction with a wide range of suitable minimal promoters or CNS-specific proximal promoters.
[0117] Functional variants of CREs include sequences that differ from reference CRE elements, but they essentially retain the activity of a CNS-specific CRE. Those skilled in the art will understand that the sequence of a CRE can be altered while retaining its ability to recruit suitable CNS-specific transcription factors (TFs), thereby enhancing expression. Functional variants of CREs can include substitutions, deletions, and / or insertions compared to a reference CRE, as long as they do not substantially render the CRE nonfunctional.
[0118] In some implementations, a functional variant of the CRE can be considered as a CRE that substantially retains its activity when it replaces a reference CRE in the promoter. For example, a CNS-specific promoter containing a functional variant of a particular CRE preferably retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and more preferably 100% of its activity (compared to a reference promoter containing an unmodified CRE).
[0119] Appropriately, the functional variants of the CRE maintain a comparable level of sequence identity with the reference CRE. Appropriately, the functional variants include sequences having at least 70% identity with the reference CRE, more preferably sequences having at least 80%, 90%, 95%, or 99% identity with the reference CRE.
[0120] Retained activity can be assessed by comparing the expression of a suitable reporter gene under reference promoter control with that of the same promoter containing a substitute CRE under equivalent conditions. Suitable assays for assessing CNS-specific promoter activity are disclosed herein, for example, in the examples.
[0121] In some embodiments, the CRE can be combined with one or more additional CREs to form a cis-regulation module (CRM). The additional CRE can be provided upstream of or downstream of the CRE according to the invention. The additional CRE can be the CRE disclosed herein or other CREs. Suitably, the additional CRE is CNS-specific.
[0122] The CRE according to the invention or the CRM containing the CRE according to the invention may include one or more additional regulatory elements. For example, they may include inducible or repressible elements, boundary control elements, insulators, locus control regions, response elements, binding sites, terminal repeat segments, response sites, stabilizing elements, destabilizing elements, and splicing elements, as long as they do not substantially render the CRE or CRM ineffective.
[0123] According to the present invention, the CRE may include a spacer region between the CRM and the minimum or proximal promoter and / or between the CRE. Alternatively or additionally, the spacer region may exist at the 5' end of the CRM.
[0124] Clearly, the CRE according to the invention, or a CRM including the CRE according to the invention, or a functional variant thereof, can be combined with any suitable promoter element to provide a synthesized CNS-specific promoter according to the invention. Suitablely, the promoter element is a CNS-specific proximal promoter.
[0125] In many cases, shorter promoter sequences are preferred, especially when the capacity of the vector (e.g., a viral vector, such as AAV) is limited. Therefore, in some embodiments, a synthetic CNS-specific CRM comprising at least one of the CREs according to SEQ ID NO: 9-11, 28-31, or a functional variant thereof, is 1000 nucleotides or less in length, for example, 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 300, 250, 200, 150, 100, 75, 60, 50, or fewer nucleotides.
[0126] Synthesized CNS-specific promoters and their functional variants
[0127] This document discloses various synthetic CNS-specific promoters. Functional variants of the reference synthetic CNS-specific promoter are promoters containing sequences different from the reference synthetic CNS-specific promoter but substantially retaining the CNS-specific promoter activity. Those skilled in the art will understand that the sequence of a synthetic CNS-specific promoter can be altered while retaining its ability to recruit suitable CNS-specific transcription factors (TFs) and RNA polymerase II to provide CNS-specific expression of operably linked sequences (e.g., open reading frames). Functional variants of the synthetic CNS-specific promoter may include substitutions, deletions, and / or insertions compared to the reference promoter, provided that such substitutions, deletions, and / or insertions do not render the synthetic CNS-specific promoter substantially non-functional compared to the reference promoter.
[0128] Therefore, in some embodiments, the functional variant of the synthesized CNS-specific promoter can be considered as a variant that substantially retains the CNS-specific promoter activity of the reference promoter. For example, the functional variant of the synthesized CNS-specific promoter preferably retains at least 70% of the activity of the reference promoter, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, and more preferably 100% of the activity.
[0129] Functional variants of synthesized CNS-specific promoters typically retain a level of sequence similarity comparable to that of a reference synthetic CNS-specific promoter. In some embodiments, the functional variants include sequences having at least 70% identity with a reference synthetic CNS-specific promoter, more preferably having at least 80%, 90%, 95%, or 99% identity with a reference synthetic CNS-specific promoter.
[0130] The activity of a functional variant can be assessed by comparing the expression of a suitable reporter gene under the control of a reference synthetic CNS-specific promoter with the expression of a hypothetical functional variant under equivalent conditions. Suitable assays for assessing CNS-specific promoter activity are disclosed herein, for example, in the examples.
[0131] A specific synthetic CNS-specific promoter functional variant may include a functional variant of the CRE present in the reference synthetic CNS-specific promoter. A specific synthetic CNS-specific promoter functional variant may include a functional variant of the CRE present in the reference synthetic CNS-specific promoter. A specific synthetic CNS-specific promoter functional variant may include a functional variant of the promoter element, or a different promoter element compared to the reference synthetic CNS-specific promoter.
[0132] A functional variant of a specific synthetic CNS-specific promoter may include one or more additional CREs besides those present in the reference synthetic CNS-specific promoter. For example, the additional CRE may be provided upstream of or downstream of the CRE present in the reference synthetic CNS-specific promoter. The additional CRE may be the CRE disclosed herein or other CREs.
[0133] A functional variant of a specific synthetic CNS-specific promoter may include additional spacer regions between adjacent elements (CRE, CRM, or promoter elements), or, if one or more spacer regions are present in the reference synthetic CNS-specific promoter, those spacer regions may be longer or shorter than those in the reference synthetic CNS-specific promoter.
[0134] Obviously, the synthesized CNS-specific promoters of the present invention can contain the CRE of the present invention or a CRM containing the CRE of the present invention and other regulatory sequences. For example, they may include one or more other CREs, inducible or repressible elements, boundary control elements, insulators, locus control regions, response elements, binding sites, terminal repeat segments, response sites, stabilizing elements, destabilizing elements, and splicing elements, as long as they do not substantially render the promoter nonfunctional.
[0135] In some implementations, the CNS-specific promoter described above is operatively linked to one or more additional regulatory sequences. For example, the additional regulatory sequences can enhance expression compared to a CNS-specific promoter that is not operatively linked to additional regulatory sequences. Generally, it is preferred that the additional regulatory sequences do not substantially reduce the specificity of the CNS-specific promoter.
[0136] For example, the CNS-specific promoter according to the invention can be operatively linked to sequences encoding UTRs (e.g., 5' and / or 3' UTRs) and / or introns, etc.
[0137] In some implementations, a CNS-specific promoter is operatively linked to a sequence encoding a UTR (e.g., a 5'UTR). The 5'UTR can contain various elements that regulate gene expression. In natural genes, the 5'UTR begins at the transcription start site and ends one nucleotide before the start codon in the coding region. It should be noted that the 5'UTR referred to herein can be the entire naturally occurring 5'UTR, or it can be a portion of a naturally occurring 5'UTR. The 5'UTR can also be partially or completely synthetic. In eukaryotes, the median length of a 5'UTR is approximately 150 nucleotides, but in some cases they can be much longer. Regulatory sequences that can be found in the 5'UTR include, but are not limited to:
[0138] - May affect the stability of mRNA or the protein binding sites for translation;
[0139] - Ribose switch;
[0140] - Sequences that promote or inhibit translation initiation; and
[0141] Introns within the -5'UTR have been associated with the regulation of gene expression and mRNA output.
[0142] When a regulatory sequence includes both a 5'UTR and an intron, it can be referred to as a 5'UTR and intron sequence.
[0143] In some embodiments, the synthesized CNS-specific promoter as described above is operatively linked to sequences encoding the 5'UTR and introns. In some embodiments, the 5'UTR and introns are derived from the major immediate CMV gene (CMV-IE gene). For example, the 5'UTR and introns derived from the CMV-IE gene suitably include CMV-IE gene exon 1 and CMV-IE gene exon 2, or portions thereof.
[0144] In some implementations, the promoter element can be modified in light of its association with the 5'UTR, for example, the sequence downstream of the transcription start site (TSS) in the promoter element can be removed (e.g., replaced with the 5'UTR).
[0145] The 5' UTR and introns of CMV-IE are described in Simari, et al., Molecular Medicine 4:700-706, 1998, “Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene,” which is incorporated herein by reference. Variants of the CMV-IE 5' UTR and intron sequences discussed by Simari et al. are also listed in WO2002 / 031137, a patent incorporated herein by reference, and the regulatory sequences disclosed therein may also be used.
[0146] Other regulatory elements, such as other UTRs that can be used in conjunction with promoters, are known in the art, for example in Leppek, K., Das, R. & Barna, M., “Functional 5′UTR mRNA structures in eukaryotic translation regulation and how to find them”, Nat Rev Mol Cell Biol 19, 158–174 (2018), which is incorporated herein by reference.
[0147] In some implementations, any one or a variant of the CNS-specific promoters described herein is linked to a sequence encoding the 5'UTR and / or the 5'UTR and introns.
[0148] In some embodiments, the sequence encoding the 5'UTR and introns includes SEQ ID NO:27 or a functional variant thereof. In some embodiments, the functional variant may have a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with it. SEQ ID NO:27 encodes the 5'UTR and introns of CMV-IE.
[0149] Tcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggattccccgtgccaagagtgacgtaagtaccgcctatagactcta taggcacacccctttggctcttatgcatgaacggtggagggcagtgtagtctgagcagtactcgttgctgccgcgcgcgccaccagacataatagctgacagactaacagactgttcctttccatgggtcttttctgcag(SEQ ID NO:27)
[0150] In some implementations, the CNS-specific promoter CNS-1 (SEQ ID NO:1) is operatively linked to the 5'UTR and intron (SEQ ID NO:27) of CMV-IE to provide SEQ ID NO:21.
[0151] In some implementations, the CNS-specific promoter CNS-4 (SEQ ID NO:4) is operatively linked to the 5'UTR and intron (SEQ ID NO:27) of CMV-IE to provide SEQ ID NO:22.
[0152] In some implementations, any one of the CNS-specific promoters CNS-2, CNS-3, CNS-5, CNS-5_v2, CNS-6, CNS-6_v2, CNS-7, CNS-7_v2, CNS-8, and CNS-8_v2 is operatively linked to the 5'UTR and intron (SEQ ID NO: 27) of the CMV-IE.
[0153] The preferred synthetic CNS-specific promoters of the present invention exhibit CNS-specific promoter activity of at least 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, or 400% of the activity exhibited by Synapsin-1, Camk2a, or NSE promoters in CNS cells. In many cases, higher levels of promoter activity are preferred, but this is not always the case; therefore, in some cases, a more moderate expression level may be preferred. In some cases, it is desirable to have a range of promoters with different activity levels to achieve the desired expression levels; this disclosure provides promoters having such a range of activities. Compared to Syn-1, the activity of the specific synthetic CNS-specific promoters of the present invention can be assessed by comparing the CNS-specific expression of a reporter gene under the control of the synthetic CNS-specific promoter with the expression of the same reporter gene under the control of the Syn-1 promoter, wherein the two promoters are provided in equivalent expression constructs and under equivalent conditions.
[0154] In addition to different activity levels, in some cases, it is desirable to have a series of promoters active in different regions of the brain. Furthermore, it is desirable to have a series of promoters with different activity levels in different regions of the brain to achieve desired expression levels; this disclosure provides promoters with such activity ranges. In some cases, expression is required in specific regions of the brain. In some embodiments, expression is required in specific regions of the brain, while expression is rare or absent in other parts of the brain. This may be the case, for example, in treating diseases such as dopamine transporter deficiency syndrome, where expression in the midbrain is required. In some preferred embodiments, the CNS-specific promoter according to the invention exhibits activity in the midbrain. In some preferred embodiments, the CNS-specific promoter according to the invention exhibits activity in the midbrain, while having little or no activity in other regions of the brain. In some preferred embodiments, the CNS-specific promoter according to the invention exhibits activity in dopaminergic neurons. In some embodiments, the CNS-specific promoter according to the invention exhibits activity in dopaminergic neurons, while having little or no expression in other CNS cell types or CNS subtypes. The preferred synthetic CNS-specific promoters of the present invention exhibit dopaminergic neuron-specific promoter activity at least 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, or 400% of the activity of tyrosine hydroxylase in dopaminergic neurons. The activity of the specific synthetic CNS-specific promoters of the present invention, compared to tyrosine kinases, can be assessed by comparing the dopaminergic neuron-specific expression of a reporter gene under the control of the synthetic CNS-specific promoter with the expression of the same reporter gene in dopaminergic neurons under the control of a tyrosine hydroxylase promoter, wherein the two promoters are provided in equivalent expression constructs and under identical conditions. In some embodiments, the synthetic CNS-specific promoters of the present invention, appropriately tyrosine hydroxylase promoters, relative to known dopaminergic neuron-specific promoters, are capable of increasing the expression of a gene (e.g., a therapeutic gene or a gene of interest) in the dopaminergic neurons of a subject by at least 20%, at least 40%, at least 60%, at least 80%, at least 100%, at least 200%, at least 300%, at least 500%, at least 1000%, or more.
[0155] Additionally, it is preferable to have extensive expression in all or almost all regions of the brain. This may be the case, for example, when treating conditions such as Anglemann syndrome, which require extensive expression throughout the brain.
[0156] In some embodiments, the synthetic CNS-specific promoters of the present invention, appropriately Syn1, Camk2a, or NSE promoters, relative to known CNS-specific promoters, are capable of increasing the expression of a gene (e.g., a therapeutic gene or a gene of interest) in the CNS or CNS cells of a subject by at least 20%, at least 40%, at least 60%, at least 80%, at least 100%, at least 200%, at least 300%, at least 500%, at least 1000%, or more.
[0157] The preferred synthetic CNS-specific promoters of the present invention exhibit activity in non-CNS cells (e.g., Huh7 and HEK293 cells) at 50% or less of the activity compared to CMV-IE, preferably 25% or less of CMV-IE, more preferably 10% or less of CMV-IE, and in some cases 5% or less of CMV-IE, or 1% or less of CMV-IE.
[0158] In many cases, shorter promoter sequences are preferred, especially when vector (e.g., viral vector, such as AAV) capabilities are limited. Therefore, in some embodiments, the synthesized CNS-specific promoter is 1000 nucleotides or less in length, for example, 900, 800, 700, 600, 500, 450, 400, 350, 300, 250, 200, 150, 100 or less nucleotides.
[0159] The most preferred synthetic CNS-specific promoters are those that are both short and exhibit high levels of activity.
[0160] It is surprising that CNS-specific promoters retain CNS-specific activity in AAV vectors, because it is known that the ITR of AAV vectors and the different DNA structure compared to the genome can affect promoter activity, and often the ITR and the different DNA structure have a negative impact on promoter activity.
[0161] Synthetic CNS-specific expression cassette
[0162] The present invention also provides a synthetic CNS-specific expression cassette comprising a synthetic CNS-specific promoter of the present invention operatively linked to a sequence encoding an expression product and a suitable gene (e.g., a transgene).
[0163] If the gene encodes a protein, it can be virtually any type of protein. As a non-limiting example, the protein can be an enzyme, an antibody or antibody fragment (e.g., a monoclonal antibody), a viral protein (e.g., REP-CAP, REV, VSV-G, or RD114), a therapeutic protein, or a toxic protein (e.g., caspase 3, 8, or 9).
[0164] In some preferred embodiments of the invention, the gene encodes a therapeutic expression product, preferably a therapeutic peptide, suitable for treating diseases or conditions associated with abnormal gene expression, optionally in the CNS.
[0165] In some embodiments, therapeutically expressed products include those useful for treating CNS diseases. The term "CNS disease" is, in principle, as understood by those skilled in the art. This term refers to diseases that can be treated and / or prevented by administration of an active compound to the CNS, particularly to CNS cells. In some embodiments, CNS diseases are neurological diseases and / or conditions.
[0166] As a non-limiting example, CNS disorders may be selected from: hyaline membrane absence, acid lipase disorder, acid maltase deficiency, acquired epileptic aphasia, acute disseminated encephalomyelitis, attention deficit hyperactivity disorder (ADHD), Adie pupil, Adie syndrome, adrenoleukodystrophy, corpus callosum agenesis, cognitive impairment, Aicardi syndrome, Aicardi-Goutieres syndrome, AIDS – neurological complications, Alexander disease, Alpers disease, alternating hemiplegia, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), anencephaly, aneurysm, Angemann syndrome, hemangioma, hypoxia, antiphospholipid syndrome, aphasia, apraxia, arachnoid cysts, arachnoiditis, Arnold-Chiari malformation, arteriovenous malformation, Asperger's syndrome, ataxia, ataxia-telangiectasia, ataxia and cerebellum or spinal cord Cerebellar degeneration, atrial fibrillation and stroke, attention deficit hyperactivity disorder, autism spectrum disorder, autonomic dysfunction, back pain, Barth syndrome, Barton's disease, Becker's rigidity, Behcet's disease, Bell's palsy, benign primary blepharospasm, benign focal muscular atrophy, benign intracranial hypertension, Bernhardt-Roth syndrome, Binswanger's disease, blepharospasm, Bloch-Sulzberger syndrome, brachial plexus birth injury, brachial plexus injury, Bradbury-Eggleston syndrome, brain and spinal cord tumors, cerebral aneurysms, brain injury, Brown-Sequard syndrome, spinal-bulbar muscular atrophy, cerebral autosomal dominant arteriovenous dysplasia with subcortical infarction and leukoencephalopathy (CADASIL), Canavan disease, carpal tunnel syndrome, burning pain, cavernous hemangioma, cavernous hemangioma Angioma, cavernous malformation, central cervical cord syndrome, central cord syndrome, central pain syndrome, central pontine myelinolysis, cerebrovascular disorders, cerebral cerebral degeneration, cerebellar hypoplasia, cerebral aneurysm, cerebral arteriosclerosis, cerebral atrophy, cerebral beriberi, and cerebral cavernous malformation.Malformation), cerebral gigantism, cerebral hypoxia, cerebral palsy, brain-eye-face-bone syndrome (COFS), Charcot-Marie-Tooth disease, Chiari malformation, cholesterol ester storage disease, chorea, chorea acanthosis, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic orthostatic intolerance, chronic pain, type II Cockayne syndrome, Coffin Lowry syndrome, cavitary brain, coma, complex regional pain syndrome, congenital bilateral facial paralysis, congenital myasthenia gravis, congenital myopathy, congenital vascular cavernous malformation, corticobasal degeneration, cranial arteritis, craniosynostosis, Cree encephalitis, Creutzfeldt-Jakob disease, cumulative trauma syndrome, Cushing's syndrome, cytomegalovirus infection, chorea-eye-chorea-feet syndrome, Dandy-Walker syndrome, Dawson's disease, De Morsier syndrome, Dejerine-Klumpke paralysis, dementia, dementia with multiple infarctions, dementia with semantics, dementia with subcortical conditions, Lewy body dementia, dentate-cerebellar ataxia, dentate-red nucleus atrophy, dermatomyositis, developmental apraxia, Devic syndrome, diabetic neuropathy, diffuse sclerosis, Dravet syndrome, familial autonomic dysfunction, writing disorders, reading disorders, swallowing disorders, apraxia, myoclonic cerebellar coordination disorder, progressive cerebellar coordination disorder, dystonia, early infantile epileptic encephalopathy, empty sella syndrome, encephalitis, encephalitis of lethargy, encephalopathy, encephalopathy (familial infantile), trigeminal neuralgia, epilepsy, epileptic hemiplegia, Erb paralysis, Erb-Duchenne and Dejerine-Klumpke paralysis, essential tremor, extrapontine myelinolysis, Fabry disease, Fa HR syndrome, syncope, familial autonomic dysfunction, familial hemangioma, familial idiopathic basal ganglia calcification, familial periodic paralysis, familial spastic paralysis, Farber's disease, febrile seizures, fibromuscular dysplasia, Fisher syndrome, infantile hypotonia syndrome, foot drop, Friedreich ataxia, frontotemporal dementia, Gaucher disease, generalized ganglioside deposition syndrome, Gerstmann syndrome, Gerstmann-Straussler-Scheinker disease, giant axonal neuropathy, giant cell arteritis, giant cell inclusion body disease, globular leukodystrophy, glossopharyngeal neuralgia, glycogen storage disease, Guillain-Barre syndrome, Hallervorden-Spatz disease, head injury, headache, continuous hemifacial pain, hemifacial spasm, alternating hemiparesis (Hemiplegia)Alterans syndrome, hereditary neurological disorders, hereditary spastic paraplegia, polyneuritis-type hereditary ataxia, herpes zoster, otitis herpes zoster, Hirayama syndrome, Holmes-Adie syndrome, holoprosencephaly, HTLV-1 related myelopathy, Hughes syndrome, Huntington's disease, hydrocephalus, hydrocephalus-normal pressure, hydramnios, Cushing's syndrome, somnolencephaly, hypertonia, hypotonia, hypoxia, immune-mediated encephalomyelitis, inclusion body myositis, pigmentary disorders, infantile hypotonia, infantile axonal dystrophy, infantile encephalomyelitis, infantile encephalomyelitis Phytanic acid storage disease, infantile Refsum disease, infantile spasms, inflammatory muscle disease, occipital cleft with exposed head malformation, enterogenic lipodystrophy, intracranial cysts, intracranial hypertension, Isaacs syndrome, Joubert syndrome, Keams-Sayre syndrome, Kennedy disease, Kinsboume syndrome, Kleine-Levin syndrome, Klippel-Feil syndrome, Klippel-Trenaunay syndrome (KTS), Kliiver-Bucy syndrome, Korsakoff Amnesiac syndrome, Krabbe disease, Kugelberg-Welander disease, Kuru disease, Lambert-Eaton myasthenia gravis, Landau-Kleffner syndrome, lateral femoral cutaneous nerve entrapment, lateral medullary syndrome, learning disabilities, Leigh disease, Lennox-Gastaut syndrome, Lesch-Nyhan syndrome, leukodystrophy, Levine-Critchley syndrome, Lewy body dementia, lipid storage disease, lipoprotein storage disease, lissencephaly, locked-in syndrome, Lou Gehrig's disease, lupus-neurological sequelae, Lyme disease-neurological complications, Machado-Joseph's disease, macrocephaly, megalencephaly, Melkersson-Rosenthal syndrome, meningitis, meningitis and encephalitis, Menkes' disease, paresthesia femoris, metachromatic leukodystrophy, microcephaly, migraine, Miller-Fisher syndrome, mini-stroke, mitochondrial myopathy, Moebius syndrome, unilateral muscular atrophy, motor neuron disease, Moyamoya disease.Diseases, mucolipidoses, mucopolysaccharidosis, multiple infarct dementia, multifocal motor neuropathy, multiple sclerosis, multiple system atrophy, multiple system atrophy with orthostatic hypotension, muscular dystrophy, myasthenia gravis (congenital), myasthenia gravis, myelin-destructive diffuse sclerosis, infantile myoclonic encephalopathy, myoclonus, myopathy, myopathy (congenital), myopathy (thyroid toxicity), myotonia, congenital myotonia, narcolepsy, neuroacanthosis, neurodegeneration with iron accumulation in the brain, neurofibromatosis, neuroleptic malignant syndrome, neurological complications of AIDS, neurological complications of Lyme disease, neurological consequences of cytomegalovirus infection, neurological manifestations of Pompe disease. Neurological sequelae of lupus, neuromyelitis optica, neurotic myotonia, neuronal ceroid lipofuscin deposition, neuronal migration disorder, neuropathic-hereditary neuropathy, neurosarcoidosis, neurosyphilis, neurotoxicity, cavernous nevus, Niemann-Pick disease, O'Sullivan-McLeod syndrome, occipital neuralgia, Ohtahara syndrome, olivopontocerebellar atrophy, strabismus-ocular clonus-myoclonus, orthostatic hypotension, overuse syndrome, chronic pain, pantothenic acid kinase-related neurodegeneration, paraneoplastic syndrome, paroxysmal sensory abnormalities, Parkinson's disease, paroxysmal choreoathetosis, paroxysmal migraine, Parry-Romberg disease, Pelizaeus-Merzbacher disease, Pena Shokeir II syndrome, peripheral nerve cysts, periodic paralysis, peripheral neuropathy, periventricular leukomalacia, persistent vegetative state, pervasive developmental disorders, phytate storage disease, Pick's disease, nerve compression, piriformis syndrome, pituitary tumor, polymyositis, Pompe disease, pore brain, post-poliomyelitis syndrome, postherpetic neuralgia, post-infectious encephalomyelitis, orthostatic hypotension, orthostatic orthocardia syndrome, orthostatic tachycardia syndrome, primary Dentatum atrophy, primary lateral sclerosis, primary progressive aphasia, prion disease, progressive hemifacial atrophy, progressive motor ataxia, progressive multifocal leukoencephalopathy, progressive sclerotic gray matter dystrophy, progressive supranuclear palsy, prosopagnosia, Pseudo-Torch syndrome, pseudotoxoplasmosis syndrome, pseudotumor brain, psychogenic motor disorders, Ramsay Hunt syndrome I, Ramsay Hunt syndrome II, Rasmussen encephalitis, reflex sympathetic dystrophy syndrome, Refsum disease, Refsum disease in infants, repetitive motion disorder, repetitive stress injury, restless legs syndrome, retrovirus-associated myelopathy, Rett syndrome, Reye syndrome, rheumatic encephalitis, Riley-Day syndrome, sacral nerve root cyst, SaintVitus chorea, salivary gland disorders, Sandhoff's disease, Schilder's disease, schizophrenia, Seitelberger's disease, epileptic seizure syndrome, semantic dementia, optic-septal dysplasia, severe myoclonic epilepsy of infancy (SMEI), shaken baby syndrome, herpes zoster, Shy-Drager syndrome, Sjogren's syndrome, sleep apnea, sleep disorders, Sotos syndrome, spasticity, spina bifida, spinal cord infarction, spinal cord injury, spinal cord tumor, spinal muscular atrophy. Spinocerebellar atrophy, spinocerebellar degeneration, Steele-Richardson-Olszewski syndrome, stiff-person syndrome, substantia nigra degeneration, stroke, Sturge-Weber syndrome, subacute sclerosing panencephalitis, subcortical arteriosclerotic encephalopathy, unilateral short-duration neuropathic headache attacks (SUNCT), dysphagia, Sydenham's chorea, syncope, syphilitic spinal sclerosis, syringomyelia, syringomyelia, systemic lupus erythematosus, tabes dorsalis (S) Dorsalis, tardive dyskinesia, Tarlov's cyst, Tay-Sachs disease, temporal arteritis, tethered cord syndrome, Thomsen's rigidity, thoracic outlet syndrome, thyrotoxic myopathy, painful spasm, Todd's paralysis, Tourette syndrome, transient ischemic attack, transmissible cavernous encephalopathy, transverse myelitis, traumatic brain injury, tremor, trigeminal neuralgia, tropical spastic paraplegia, Troyer's syndrome, tuberous sclerosis, vasculitis of the central and peripheral nervous systems, Von Economo's disease, Von Hippel-Lindau's disease (VHL), Von Recklinghausen's disease, Wallenberg syndrome, Werdnig-Hoffman's disease, Wemicke-Korsakoff's syndrome, West syndrome, Whiplash, Whipple's disease, Williams syndrome, Wilson's disease, Wolman's disease, X-linked spinal-bulbar muscular atrophy.
[0167] In some implementation schemes, CNS diseases are selected from the following list: dopamine transporter deficiency syndrome, attention deficit hyperactivity disorder (ADHD), bipolar disorder, epilepsy, multiple sclerosis, tau pathologies, Alzheimer's disease, Huntington's disease, Parkinson's disease, Krabbe's disease, adrenoleukodystrophy, motor neuron disease, cerebral palsy, Batten disease, Gaucher disease, Tay Sachs disease, Rett syndrome, Sandhoff disease, and Charcot-Marie-Tooth disease. Diseases such as Anglemann syndrome, Canavan disease, late-stage infantile neuronal ceroid lipofuscin deposition, mucopolysaccharidosis IIIA, mucopolysaccharidosis IIIB, metachromatic leukodystrophy, hereditary lysosomal storage disorders such as Niemann-Pick disease C1 and / or neuronal ceroid lipofuscin deposition such as Barton's disease, progressive supranuclear palsy, corticobasal ganglia syndrome, and brain cancers (including astrocytomas and glioblastomas).
[0168] Various expression products suitable for treating the above-mentioned conditions have been described in the art. Suitably, the nucleic acid encoding the expression product operatively linked to the CRE, minimal / proximal promoter, or promoter according to the invention can be one of the genes selected from the group consisting of: NPC1, EAAT2, NPY, CYP46A1, GLB1, APOE (e.g., ApoE2, ApoE3, or ApoE4), HEX, CLN1, CLN2, CLN3, CLN4, CLN5, CLN6, SUMF1, DCTN1, PRPH, SOD1, NEFH, GBA, IDUA, NAGLU, GUSB, ARSA, MANB, AADC, GDNF, NTN, ASP, MECP2, PTCHD1, GJB1, UBE3A, HEXA, MOG. Additionally or alternatively, the expression product operatively linked to the CRE, minimal / proximal promoter, or promoter according to the invention can be a miRNA / CRISPR Cas9 targeting the disease allele.
[0169] CYP46A1 is the rate-limiting enzyme for cholesterol degradation and has been found to play beneficial roles in a variety of CNS diseases. Inhibition of CYP46A1 may contribute to the induction and / or exacerbation of Alzheimer's disease by increasing viral cholesterol levels, as described in (Djelti et al., 2015), which is incorporated herein by reference. CYP46A1 has also been found to have neuroprotective effects in Huntington's disease, as described in (Boussicault et al., 2016), which is incorporated herein by reference. Therefore, the CYP46A1 gene is a particularly preferred nucleic acid encoding an expression product. In some preferred embodiments, the CYP46A1 gene is operatively linked to a CRE, minimal / proximal promoter, or promoter according to the invention. Suitably, the CYP46A1 gene is operatively linked to a synthetic promoter active in all regions of the CNS (pan-CNS), or operatively linked to a promoter active in 5, 6, 7, 8, or 9 or more of the aforementioned brain regions. Expression of CYP45A1 in all regions of the CNS or in 5, 6, 7, 8, or 9 or more of the aforementioned brain regions may be beneficial, as expression of CYP46A1 by the ubiquitous promoters CMV or CAG has been found to be beneficial in a mouse model of Huntington's disease (Kacher et al., 2019). Appropriately, the CYP46A1 gene is operatively linked to a synthetic promoter consisting of or containing SEQ ID NO:1, SEQ ID NO:21, or SEQ ID NO:2.
[0170] In some embodiments, useful expression products include dystrophin (including micro-dystrophin), β1,4-acetylgalactosamine galactosyltransferase (GALGT2), carbamoyl synthase I, α-1 antitrypsin, ornithine transcarbamoylase, argininosuccinate synthase, argininosuccinate lyase, arginase, fumarate acetoacetate hydrolase, phenylalanine hydroxylase, glucose-6-phosphatase, bile pigmentogen deaminase, cystathionine β-synthetase, branched-chain ketoacid decarboxylase, albumin, isovaleryl-CoA dehydrogenase, propionyl-CoA carboxylase, methylmalonyl-CoA mutant enzyme, glutaryl-CoA dehydrogenase, insulin, β-glucosidase, pyruvate carboxylate, liver phosphorylase, phosphorylase kinase, glycine decarboxylase, H protein, T protein, and cystic fibrosis transmembrane regulatory factor (CFTR).
[0171] Other useful expression products include enzymes that are useful in enzyme replacement therapy for various conditions caused by insufficient enzyme activity. For example, enzymes containing mannose-6-phosphate can be used to treat lysosomal storage diseases (e.g., suitable genes include those encoding β-glucuronidase (GUSB)).
[0172] In some embodiments, exemplary peptide expression products include neuroprotective peptides and anti-angiogenic peptides. Suitable peptides include, but are not limited to, glial-derived neurotrophic factor (GDNF), fibroblast growth factor 2 (FGF-2), nurturin, ciliary neurotrophic factor (CNTF), nerve growth factor (NGF; e.g., nerve growth factor-β), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), neurotrophin-4 (NT-4), neurotrophin-6 (NT-6), epidermal growth factor (EGF), pigment epithelial-derived factor (PEDF), Wnt peptide, soluble Fit-1, angiostatin, endostatin, VEGF, anti-VEGF antibody, soluble VEGFR, factor VIII (FVIII), Factor IX (FIX), and members of the hedgehog family (sonic hedgehog, Indian hedgehog, and desert hedgehog, etc.).
[0173] In some embodiments, useful therapeutic expression products include hormones and growth and differentiation factors, including but not limited to insulin, glucagon, growth hormone (GH), parathyroid hormone (PTH), growth hormone-releasing factor (GRF), follicle-stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiopoietin, angiostatin, granulocyte colony-stimulating factor (GCSF), erythropoietin (EPO), connective tissue growth factor (CTGF), basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), insulin-like growth factor I and II (IGF-I and IGF-II), any of the transforming growth factor α superfamily (including TGFa), activins, inhibins, or bone morphogenetic protein (BMP). Any one of 1-15, any one of the heregluin / neuregulin / ARIA / neu differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophic factors NT-3 and NT-4 / 5, ciliary neurotrophic factor (CNTF), glial cell line-derived neurotrophic factor (GDNF), neurturin, agarin, any one of the semaphorins / collapsins family, netrin-1 and netrin-2, hepatocyte growth factor (HGF), eprins, noggin, sound hedgehog factor, and tyrosine hydroxylase.
[0174] In some embodiments, useful expression products include proteins that regulate the immune system, including but not limited to cytokines and lymphokines such as thrombopoietin (TPO), interleukins (ILs) IL-1 to IL-25 (including IL-2, IL-4, IL-12, and IL-18), monocyte chemoattractant protein, leukemia suppressor factor, granulocyte-macrophage colony-stimulating factor, Fas ligand, tumor necrosis factor α and β, interferons (α, β, and γ), stem cell factor, and flk-2 / flt3 ligand. Gene products generated by the immune system are also useful in this invention. These include, but are not limited to, immunoglobulins IgG, IgM, IgA, IgD, and IgE, chimeric immunoglobulins, humanized antibodies, single-chain antibodies, T-cell receptors, chimeric T-cell receptors, single-chain T-cell receptors, class I and class II MHC molecules, and engineered immunoglobulins and MHC molecules. Useful gene products also include complement regulatory proteins, such as complement regulatory protein, membrane cofactor protein (MCP), decay accelerator factor (DAF), CR1, CF2, and CD59.
[0175] In some embodiments, useful expression products include any of the receptors for hormones, growth factors, cytokines, lymphokines, regulatory proteins, and immune system proteins. Useful heterologous nucleic acid sequences also include receptors for cholesterol regulation and / or lipid regulation, including low-density lipoprotein (LDL) receptors, high-density lipoprotein (HDL) receptors, very low-density lipoprotein (VLDL) receptors, and scavenger receptors. The invention also includes the use of gene products, such as members of the steroid hormone receptor superfamily, including glucocorticoid receptors and estrogen receptors, vitamin D receptors, and other nuclear receptors. In addition, useful gene products include transcription factors such as jun, fos, max, mad, serum response factor (SRF), AP-1, AP-2, myb, MyoD, and myogenin, proteins containing ETS boxes, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C / EBP, SP1, CCAAT box-binding proteins, interferon regulatory factor (IRF-1), Wilms' tumor protein, ETS-binding proteins, STAT, GATA box-binding proteins such as GATA-3, and the forkhead family of winged helical proteins.
[0176] In some embodiments, useful expression products include non-naturally occurring polypeptides, such as chimeric or hybrid polypeptides having non-naturally occurring amino acid sequences, which include insertions, deletions, or amino acid substitutions.
[0177] Further suitable expression products include microRNAs (miRNAs), interfering RNAs, antisense RNAs, ribozymes, and aptamers.
[0178] In some embodiments of the invention, the synthesized CNS-specific expression cassette includes genes useful for gene editing, such as genes encoding site-specific nucleases, like broad-spectrum nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or regularly spaced clustered short palindromic repeat systems (CRISPR-Cas). Suitablely, the site-specific nuclease is adapted to edit the desired target genomic site by generating a nick (typically a site-specific double-strand break), and then repairing the nick via non-homologous end joining (NHEJ) or homology-dependent repair (HDR), thereby forming the desired edit. The edit can be a partial or complete repair of a dysfunctional gene, or a knockdown or knockout of a functional gene. Alternatively, editing can be performed by base editing or prime editing, using suitable systems known in the art.
[0179] Suitablely, the synthesized CNS-specific expression cassette includes sequences that provide or encode one or more (preferably all) of a ribosome binding site, a start codon, a stop codon, and a transcription termination sequence. Suitablely, the expression cassette includes nucleic acids encoding post-transcriptional regulatory elements. Suitablely, the expression cassette includes nucleic acids encoding polyA elements.
[0180] Vectors and viral particles
[0181] The present invention further provides a vector comprising a CNS-specific promoter or expression cassette synthesized according to the present invention.
[0182] In some embodiments of the present invention, the vector is a plasmid. Such a plasmid may include various other functional nucleic acid sequences, such as one or more selectable markers, one or more origins of replication, multiple cloning sites, etc. In some embodiments of the present invention, the vector is a viral vector.
[0183] In some embodiments of the invention, the vector is an expression vector for expression in eukaryotic cells. Examples of eukaryotic expression vectors include, but are not limited to, pW-LNEO, pSV2CAT, pOG44, pXTl, and pSG, available from Stratagene; pSVK3, pBPV, pMSG, and pSVL, available from Amersham Pharmacia Biotech; and pCMVDsRed2-express, pIRES2-DsRed2, pDsRed2-Mito, and pCMV-EGFP, available from Clontech. Many other vectors are well known and commercially available. For adenovirus vectors of mammalian cells, pSV and pCMV family vectors are particularly well known, non-limiting examples. There are many well-known yeast expression vectors, including but not limited to yeast integration plasmid (YIp) and yeast replication plasmid (YRp). For plants, the Ti plasmid of Agrobacterium is an exemplary expression vector, and suitable expression vectors are also provided for plant viruses, such as tobacco mosaic virus (TMV), potato virus X, and cowpea mosaic virus.
[0184] In some preferred embodiments, the vector is a gene therapy vector. Various gene therapy vectors are known in the art, including AAV vectors, adenovirus vectors, retroviral vectors, and lentiviral vectors. When the vector is a gene therapy vector, it preferably comprises a nucleic acid sequence operatively linked to a CNS-specific promoter synthesized according to the present invention, the nucleic acid sequence encoding a therapeutic product, suitably a therapeutic protein. The therapeutic protein may be a secretible protein. Non-limiting examples of secretible proteins have been discussed above; exemplary secretible therapeutic proteins include coagulation factors such as factor VIII or factor IX, insulin, erythropoietin, lipoprotein lipase, antibodies or nanobodies, growth factors, cytokines, chemokines, plasma factors, toxic proteins, etc.
[0185] In some embodiments of the invention, the vector is a viral vector, such as a retrovirus, lentivirus, adenovirus, herpes simplex virus, or adeno-associated virus (AAV) vector. In some preferred embodiments, the vector is a lentiviral vector, suitably an HIV-1-based lentiviral vector. In some preferred embodiments, the vector is an AAV vector. In some preferred embodiments, the AAV has a serotype suitable for CNS transduction or specifically optimized for CNS transduction. In some embodiments, the AAV is selected from the group consisting of AAV1, AAV2, AAV4, AAV5, AAV8, AAV9, AAVrh10, AAVDJ8, and AAV2g9, or derivatives thereof.
[0186] The preferred AAV vector is a complementary double-stranded AAV vector (scAAV) to overcome one of the limiting steps in AAV transduction (i.e., the conversion from single-stranded to double-stranded AAV), although the use of single-stranded AAV vectors (ssAAV) is also included herein. In some embodiments of the invention, the AAV vector is chimeric, i.e., it comprises components from at least two AAV serotypes, such as the ITR of AAV2 and the capsid protein of AAV5. AAV9 is known to transduce CNS cells and tissues particularly efficiently, therefore AAV9 and its derivatives are particularly meaningful for targeting CNS cells and tissues. AAV2g9 is known to transduce CNS cells and tissues particularly efficiently, therefore AAV2g9 and its derivatives are particularly meaningful for targeting CNS cells and tissues. AAVrh10 is known to transduce CNS cells and tissues particularly efficiently, therefore AAVrh10 and its derivatives are particularly meaningful for targeting CNS cells and tissues. AAVrh10 is particularly preferred because systemic or intravenous delivery of AAVrh10 has been found to provide high transgenic expression in the central nervous system, as described in (Tanguy et al., 2015), which is incorporated herein by reference. AAVDJ8 is known to transduce CNS cells and tissues particularly effectively; therefore, AAVDJ8 and its derivatives are particularly meaningful for targeting CNS cells and tissues. AAVDJ8 is preferred because it has been shown to effectively target multiple regions of the brain and to effectively target astrocytes, as described in (Hammond et al., 2017), which is incorporated herein by reference. AAV1, AAV2, AAV4, AAV5, and AAV8 are also known to target CNS cells and tissues; therefore, these AAV serotypes and their derivatives are also particularly meaningful for targeting CNS cells and tissues.
[0187] The present invention further provides a recombinant virus (virus particle) comprising the above-described vector.
[0188] Pharmaceutical Composition
[0189] The vector or virus of the present invention can be formulated into a pharmaceutical composition with pharmaceutically acceptable excipients, i.e., one or more pharmaceutically acceptable carrier substances and / or additives, such as buffers, carriers, excipients, stabilizers, etc. This pharmaceutical composition can be provided in the form of a kit. Suitable pharmaceutical compositions and delivery systems for AAV vectors, as well as their methods and uses, are known in the art.
[0190] Therefore, another aspect of the present invention provides a pharmaceutical composition comprising the vector or virus described herein.
[0191] The relative amounts of the active ingredient (e.g., AAV carrier particles), pharmaceutically acceptable excipients, and / or any other components in the pharmaceutical compositions according to this disclosure may vary depending on the identity, size, and / or condition of the treated subject, and further depending on the route of administration of the composition. For example, the composition may include 0.1% to 99% (w / w) of the active ingredient. For instance, the composition may include 0.1% to 100% (e.g., 0.5% to 50%, 1-30%, 5-80%, at least 80% (w / w)) of the active ingredient.
[0192] The pharmaceutical composition may be formulated using one or more excipients or diluents to (1) increase stability; (2) increase cell transfection or transduction; (3) allow sustained or delayed release of the payload; (4) alter biodistribution (e.g., target viral particles to specific tissues or cell types); (5) increase the translation of encoded proteins; (6) alter the release profile of encoded proteins; and / or (7) allow for tunable expression of the payload of the invention. In some embodiments, pharmaceutically acceptable excipients may be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% purity. In some embodiments, the excipients are approved for human and veterinary use. In some embodiments, the excipients may be approved by the U.S. Food and Drug Administration. In some embodiments, the excipients may be pharmaceutical grade. In some embodiments, the excipients may conform to the standards of the United States Pharmacopeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia. The excipients used herein include, but are not limited to, any and all solvents, dispersion media, diluents or other liquid carriers, dispersants or suspending agents, surfactants, isotonic agents, thickeners or emulsifiers, preservatives, etc., to suit the desired specific dosage form. Various excipients used to formulate pharmaceutical compositions and techniques used to prepare compositions are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, ARGennaro, Lippincott, Williams and Wilkins, Baltimore, MD, 2006; the entirety is incorporated herein by reference). The use of conventional excipient media may be considered within the scope of this disclosure, unless within this scope any conventional excipient media may be incompatible with the substance or its derivatives, for example, producing any adverse biological effects or otherwise interacting with any other component of the pharmaceutical composition in a harmful manner.
[0193] Treatment and other methods and uses
[0194] The present invention also provides synthesized CNS-specific promoters, expression cassettes, vectors, virions, or pharmaceutical compositions according to various aspects of the invention, for the treatment of diseases, preferably diseases associated with abnormal gene expression, optionally in the CNS (e.g., hereditary CNS diseases). Related conditions, diseases, and therapeutic expression products have been discussed above.
[0195] The present invention also provides synthesized CNS-specific promoters, expression cassettes, vectors, and virions according to various aspects thereof, which are used as drugs.
[0196] The present invention also provides synthesized CNS-specific promoters, expression cassettes, vectors, and virions according to various aspects of the present invention, which are used to manufacture pharmaceutical compositions for treating any of the conditions or diseases described herein.
[0197] The present invention further provides a cell comprising a synthesized CNS-specific promoter, expression cassette, vector, and virion according to various aspects of the invention. Suitably, the cell is a eukaryotic cell. Suitably, the eukaryotic cell may be an animal (metazoan) cell (e.g., a mammalian cell). Suitably, the cell is a human cell.
[0198] In some embodiments of the invention, the cell is ex vivo, for example, in a cell culture. In other embodiments of the invention, the cell may be part of a tissue or a multicellular organism.
[0199] In a preferred embodiment, the cell is a CNS cell, which can be ex vivo or in vivo. The CNS cell can be a primary neuron, astrocyte, oligodendrocyte, microglia, or ependymal cell. Alternatively, the CNS cell can be a CNS-derived cell line, such as an immortalized cell line.
[0200] The cell can exist in a CNS tissue environment (e.g., in the CNS of an animal) or can be isolated from CNS tissue, for example, it can be in cell culture. Appropriately, the primary cell or cell line is a human cell.
[0201] The CNS-specific promoters, expression cassettes, or vectors synthesized according to the present invention can be inserted into the genome of a cell, or they can be free (e.g., present in a free vector).
[0202] In another aspect, the present invention provides a method for producing an expression product, the method comprising providing a synthetic CNS-specific expression cassette (preferably in a vector as described above) according to the invention in cells, preferably CNS cells, and expressing a gene present in the synthetic CNS-specific expression cassette. Suitably, the method comprises maintaining the CNS cells under suitable conditions to express the gene. In culture, this may include incubating the cells or tissue containing the cells under suitable culture conditions. Of course, expression can be carried out in vivo, for example in one or more cells of a subject's CNS.
[0203] Suitable of the method, the method includes the step of introducing a synthetic CNS-specific expression cassette into CNS cells. Widely known methods for transfecting CNS cells are well-established in the art. A preferred method for transfecting CNS cells is to transfect the cells with a viral vector containing a synthetic CNS-specific expression cassette, such as an AAV vector.
[0204] It will be apparent to those skilled in the art that the synthesized CNS-specific promoters, expression cassettes, vectors, or virions according to various aspects of the present invention can be used in gene therapy. Therefore, the use of such nucleic acid constructs in gene therapy constitutes a part of the present invention.
[0205] Therefore, in some embodiments, the present invention provides gene therapy for subjects using expression cassettes, vectors, or virions according to the invention, preferably gene therapy via CNS-specific expression of therapeutic genes. This treatment may involve treating a disease by secreting a therapeutic product from CNS cells, suitably a disease involving abnormal gene expression in the CNS, as described above.
[0206] The present invention also provides a method for expressing therapeutic transgenes in CNS cells, the method comprising introducing an expression cassette or vector according to the present invention into CNS cells. The CNS cells may be in vivo or in vitro.
[0207] The present invention also provides a gene therapy method for subjects in need, preferably humans, comprising:
[0208] - Administer to a subject (appropriately introduced into the subject's CNS) the synthetic CNS-specific expression cassette, vector, virion, or pharmaceutical composition of the present invention, comprising a gene encoding a therapeutic product.
[0209] Appropriately, the method includes expressing a therapeutic amount of the gene in the subject's CNS. Various conditions and diseases that can be treated have been discussed above. Genes encoding suitable therapeutic products have also been discussed above.
[0210] Suitablely, the method includes administering a vector or virus according to the invention to a subject. Suitablely, the vector is a viral gene therapy vector, such as an AAV vector.
[0211] In some embodiments, the method includes systemic administration of a gene therapy vector. Systemic administration can be enteric (e.g., oral, sublingual, and rectal) or parenteral (e.g., injection). Preferred injection routes include intravenous, intramuscular, subcutaneous, intra-articular, intra-articular, intrathecal, and intradermal injection. In one embodiment, the gene therapy vector can be delivered by injection into the CSF pathway. Non-limiting examples of delivery into the CSF pathway include intrathecal and intraventricular administration.
[0212] A particularly preferred route of administration for AAV vectors or virions containing a synthetic CNS-specific promoter or expression cassette according to the invention is intravascular. Suitably, AAV vectors or virions containing a synthetic CNS-specific promoter or expression cassette according to the invention can be administered via a vein on the back of the hand or an anterior forearm. Suitable veins in the anterior forearm are the cephalic vein, median sternal vein, or basilic vein. This is because this route of administration is generally safe for the patient while still allowing some penetration into the CNS.
[0213] In some implementations, the viral gene therapy vector may be administered simultaneously or sequentially with one or more additional therapeutic agents or one or more saturants designed to prevent the vector from being cleared by the reticuloendothelial system.
[0214] When the carrier is an AAV carrier, the dose of the carrier can be from 1x10. 10 gc / kg to 1x10 15 gc / kg or more, appropriately from 1x10 12 gc / kg to 1x10 14 gc / kg, appropriately from 5 x 10 12 gc / kg to 5x10 13 gc / kg.
[0215] Generally, the subjects in need will be mammals, preferably primates, and more preferably humans. Typically, the subjects in need will display characteristic symptoms of the disease. The method generally involves improving the symptoms displayed by the subjects in need by expressing therapeutic amounts of a therapeutic product. In one embodiment, the treatment method of the present invention can be used to reduce declines in functional capacity and activities of daily living, as measured by standard assessment systems (e.g., but not limited to the Total Functional Capacity (TFC) scale). In one embodiment, the method of the present invention can be used to improve the performance of any assessment used to measure symptoms of neurological disorders. Such assessments include, but are not limited to, ADAS-cog (Alzheimer's Disease Rating Scale - Cognition), MMSE (Mini-Mental State Examination), GDS (Geriatric Depression Scale), FAQ (Functional Activities Questionnaire), ADL (Activities of Daily Living), GPCOG (General Practitioner Cognitive Assessment), Mini-Cog, AMTS (Minor Intelligence Test), Clock-drawing test, 6-CIT (Six Cognitive Impairment Tests), TYM (Test Your Memory), MoCa (Montreal Cognitive Assessment), ACE-R (Addenbrookes Cognitive Assessment), MIS (Memory Screening System), BADLS (Bristol Activities of Daily Living Scale), Barthel Index, Functional Independence Assessment, Instrumental Activities of Daily Living, IQCODE (Informed Persons Questionnaire on Cognitive Decline in Older Adults), Neuropsychiatric questionnaires, Cohen-Mansfield Agitation Scale, BEHAVE-AD, EuroQol, Short Form-36 and / or MBR Caregiver Response Scale or Sheehan B (Ther Adv Neurological Response Scale). Any other test described in Disord.5(6):349-358(2012)) is incorporated herein by reference in its entirety.
[0216] Gene therapy protocols for therapeutic gene expression in target cells, both in vitro and in vivo, are well-known in the art and will not be discussed in detail here. In short, they include intravenous or intra-arterial administration (e.g., intracarotid, intrahepatic artery, intrahepatic vein) of plasmid DNA vectors (naked or in liposomes) or viral vectors, intracranial administration, intramuscular injection, interstitial injection, intratracheal infusion, and application to the endothelium and liver parenchyma. Various devices have been developed to improve the accessibility of DNA to target cells. Simple methods involve physical contact with target cells using catheters or implantable materials containing the relevant vectors, while more complex methods utilize jetting devices or similar devices. Genes can be transferred to mammalian CNS cells using both in vitro and in vivo procedures. In vitro methods typically require harvesting CNS cells, transducing them in vitro with a suitable expression vector, and then reintroducing the transduced CNS cells into the CNS. This approach is generally less popular due to the difficulty and risks of harvesting and reintroducing CNS cells in the brain. In vivo gene transfer has been achieved by directly injecting DNA or viral vectors into the CNS, for example, via intracranial injection, or via intravenous or intra-arterial injection of viral vectors.
[0217] In one embodiment, the gene therapy vector may be administered to a subject in a therapeutically effective amount (e.g., to the subject's CNS) to alleviate the subject's neurological symptoms (e.g., as determined using known evaluation methods). In some embodiments, the gene therapy vector and the composition comprising the gene therapy vector may be administered in a manner that allows them to cross the blood-brain barrier, vascular barrier, or other epithelial barrier.
[0218] Gene therapy vectors can be used in combination with one or more other therapeutic, preventative, investigational, or diagnostic agents. The term "in combination" does not imply that these agents must be administered simultaneously and / or formulated together for delivery, although such delivery methods are within the scope of this invention. The composition can be administered simultaneously, before, or after one or more other desired therapeutic agents or medical procedures. Compounds that can be used in combination with the AAV particles described herein include, but are not limited to, cholinesterase inhibitors (donepezil, rivastigmine, galantamine), NMDA receptor antagonists such as memantine, antipsychotics, antidepressants, anticonvulsants (e.g., sodium valproate and levetiracetam for myoclonus), secretase inhibitors, amyloid aggregation inhibitors, copper or zinc modulators, BACE inhibitors, tau aggregation inhibitors such as methylene blue, phenothiazines, anthraquinones, n-aniline, or rhodamine, microtubule stabilizers such as NAP, taxol, or paclitaxel, kinase or phosphatase inhibitors, such as inhibitors against GSK3 (lithium) or PP2A, and ? Immunization with β-peptides or tau phosphorylated epitopes, anti-tau or anti-amyloid antibodies, dopamine-depleting agents (e.g., tetraphenylquinazine for chorea), benzodiazepines (e.g., clonazepam for myoclonus, chorea, dystonia, rigidity and / or spasticity), amino acid precursors of dopamine (e.g., levodopa for rigidity), skeletal muscle relaxants (e.g., baclofen, tizanidine for rigidity and / or spasticity), inhibitors that release acetylcholine at the neuromuscular junction to cause muscle paralysis (e.g., botulinum toxin for bruxism and / or dystonia), atypical neuroleptics (e.g., olanzapine and quetiapine for psychosis and / or agitation, used for...) Risperidone, sulpiride, and haloperidol for psychosis, chorea, and / or irritability; clozapine for psychosis with treatment resistance; aripiprazole for psychosis with prominent negative symptoms; selective serotonin reuptake inhibitors (SSRIs) (e.g., citalopram, fluoxetine, paroxetine, sertraline, mirtazapine, venlafaxine for depression, anxiety, obsessive-compulsive behavior, and / or irritability); hypnotics (e.g., xopiclone and / or zolpidem for altering sleep-wake cycles); anticonvulsants (e.g., sodium valproate and carbamazepine for mania or hypomania); and mood stabilizers (e.g., lithium for mania or hypomania).
[0219] According to some preferred embodiments, the above method can be used to treat subjects suffering from the aforementioned CNS-related diseases (such as dopamine transporter deficiency syndrome).
[0220] Definitions and general points
[0221] While the preparation and use of various embodiments of the present invention are discussed in detail below, it should be understood that the present invention provides many applicable inventive concepts that can be embodied in various specific situations. The specific embodiments discussed herein merely illustrate specific methods for preparing and using the present invention and do not limit the scope of the invention.
[0222] To facilitate understanding of the invention, several terms are defined below. The terms defined herein have meanings commonly understood by one of ordinary skill in the art related to the invention. Terms such as “a,” “an,” and “the” are not intended to refer only to a singular entity, but rather to include a general category of specific examples that can be used for illustration. The terms herein are used to describe specific embodiments of the invention, but their use does not limit the invention unless set forth in the claims.
[0223] This document includes a discussion of the background of the invention to explain its context. This does not imply an admission that any material mentioned has been disclosed, known, or is part of the general knowledge in any country by the priority date of any claim.
[0224] In this specification, various publications, patents, and published patent specifications are cited in detail using identifying references. The entire contents of all documents referenced in this specification are incorporated herein by reference. In particular, the teachings or sections of these documents specifically mentioned herein are incorporated herein by reference.
[0225] Unless otherwise stated, the practice of this invention will employ conventional techniques within the scope of the art, including cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology. Such techniques are well explained in the literature. See, for example, Current Protocols in Molecular Biology (Ausubel, 2000, Wiley and Son Inc, Library of Congress, USA); Molecular Cloning: A Laboratory Manual, Third Edition, (Sambrook et al, 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (MJ Gaited., 1984); U.S. Patent No. 4,683,195; Nucleic Acid Hybridization (Harries and Higgins eds. 1984); Transcription and Translation (Hames and Higgins eds. 1984); Culture of Animal Cells (Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells and Enzymes (IRL Press, 1986); Perbal, A Practical Guide to Molecular Cloning (1984); theseseries, Methods in Enzymology (Abelson and Simon, eds.-in-chief, Academic Press, Inc., New York), specifically, Vols.154and155 (Wu et al. eds.) and Vol.185, "GeneExpression Technology" (Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (Miller and Calos eds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods in Cell and Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook of Experimental Immunology, Vols. I-IV (Weir and Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986). .
[0226] The term "central nervous system" or "CNS" is readily understood by those skilled in the art. The CNS comprises the brain and spinal cord. Preferably, the synthesized CNS-specific promoter is active in the brain. The promoter of the present invention can be active in the brain and / or spinal cord. Preferably, the CNS is the CNS of a mammal, and even more preferably, the CNS of a human subject.
[0227] The term "CNS cell" refers to cells found in or derived from the CNS (CNS tissue). CNS cells can be primary cells or cell lines (e.g., SH-Sy5y, Neuro2A, U87-MG). CNS cells can be in vivo (e.g., in CNS tissue) or in vitro (e.g., in cell cultures). CNS cells include neurons, astrocytes, oligodendrocytes, microglia, and ependymal cells. Neurons found in CNS tissue consist of a cell body, long axon, and synaptic terminals. Neurons transmit electrical signals received in the cell body to other cells near their synaptic terminals via their long axons. Oligodendrocytes are a type of glial cell in the CNS that produce myelin sheaths to encase neuronal axons, accelerating the conduction of electrical signals. Astrocytes are star-shaped cells and are the most abundant cell type in the brain. They have multiple functions, helping to regulate the transmission of electrical impulses and neuronal function within the brain. Microglia are resident macrophages in the brain and are involved in immune defense. Ependymal cells form the epithelial layer of the ventricles. The term "CNS cell" as used herein includes neurons, astrocytes, oligodendrocytes, microglia, and / or ependymal cells. The promoters of the present invention can be active in any CNS cell type (e.g., neurons). The promoters of the present invention can be active in more than one type of CNS cell type (e.g., neurons and astrocytes). The promoters of the present invention can be active in all types of CNS cells (neurons, astrocytes, oligodendrocytes, microglia, and ependymal cells). Furthermore, the synthetic CNS-specific promoters of the present invention can be active in one type of CNS cell type, such as dopaminergic neurons or a subtype of mature oligodendrocytes. In some embodiments, the synthetic CNS-specific promoters of the present invention can be active only in one type of CNS cell type, such as dopaminergic neurons or a subtype of mature oligodendrocytes. The CREs, proximal / minimum promoters, and promoters of the present invention can be active in specific regions of the CNS, specific CNS cells, or CNS cell subtypes, or both. In some embodiments, the CRE, proximal / minimum promoter, and promoter of the present invention can be active in specific CNS cell types, such as neurons, across all regions of the CNS. In other embodiments, the CRE, proximal / minimum promoter, and promoter of the present invention can be active in specific CNS cell types, such as neurons, within no more than one region of the CNS (e.g., the midbrain). In some embodiments, the CRE, proximal / minimum promoter, and promoter of the present invention can be active in all CNS cells across all regions of the CNS. In some embodiments, the CRE, proximal / minimum promoter, and promoter of the present invention can be active in all CNS cells within no more than one region of the CNS (e.g., the midbrain).
[0228] The term "cis-regulatory element" or "CRE" is a term familiar to those skilled in the art, referring to nucleic acid sequences that can regulate or modulate the transcription of neighboring genes (i.e., cis-regulatory elements), such as enhancers, promoters, insulators, or silencers. CREs are found near the genes they regulate. CREs typically regulate gene transcription by binding to TFs, i.e., they include TFBSs. A single TF may bind to many CREs, thereby controlling the expression of many genes (pleiotropic). CREs are usually, but not always, located upstream of the transcription start site (TSS) of the gene they regulate. In this paper, an "enhancer" is a CRE that enhances (i.e. upregulates) the transcription of a gene it is operatively associated with, and can be found upstream, downstream, or even within introns of the gene it regulates. Multiple enhancers can regulate the transcription of a gene in a coordinated manner. In this paper, a "silencer" refers to a CRE that binds to a TF called a repressor protein, which acts to prevent or downregulate gene transcription. The term "silencer" can also refer to a region in the 3' untranslated region of messenger RNA that binds to a protein that inhibits the translation of that mRNA molecule, but this usage differs from the usage used to describe CREs. Generally, the CREs of the present invention are CNS-specific enhancer elements (commonly referred to as CNS-specific CREs, or CNS-specific CRE enhancers, etc.). In the context of the present invention, it is preferred that the CRE is located 2500 nucleotides or less from the transcription start site (TSS), more preferably 2000 nucleotides or less from the TSS, more preferably 1500 nucleotides or less from the TSS, and suitably 1000, 750, 500, 250, 200, 150, or 100 nucleotides or less from the TSS. The CREs of the present invention preferably have a relatively short length, preferably 1000 nucleotides or less, for example, their length can be 800, 700, 600, 500, 400, 300, 200, 175, 150, 90, 80, 70, 60, or 50 nucleotides or less. The CREs of the present invention are typically provided in conjunction with operatively linked promoter elements, which can be minimal promoters or proximal promoters; the CREs of the present invention can enhance the CNS-specific activity of the promoter elements.
[0229] The term "cis-regulatory module" or "CRM" refers to a functional regulatory nucleic acid module, which typically comprises two or more CREs; in this invention, CREs are typically CNS-specific enhancers, and thus the CRM is a synthetic CNS-specific regulatory nucleic acid. A CRM may include multiple CNS-specific CREs. Suitably, at least one CRE included in the CRM is a CRE according to SEQ ID NO:9-11,28-31 or a functional variant thereof. Typically, multiple CREs in a CRM work together (e.g., additive or synergistic) to enhance transcription of the gene operatively associated with the promoter containing the CRM. There is considerable room for shuffling (i.e., reordering), reversing (i.e., reversing direction), and altering the spacing between CREs within the CRM. Therefore, functional variants of the CRM of this invention include, among other things, variants of the reference CRM in which CREs are shuffled and / or reversed, and / or the spacing between CREs is altered.
[0230] As used herein, the phrase "promoter" refers to a DNA region, typically located upstream of the nucleic acid sequence to be transcribed, that is required for transcription to occur; that is, it initiates transcription. A promoter allows for the appropriate activation or repression of transcription of a coding sequence under its control. Promoters typically contain a specific sequence that is recognized and bound by multiple transference tracts (TFs). The binding of the TF to the promoter sequence leads to the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the coding region of a gene. Many different promoters are known in the art.
[0231] As used herein, the term "synthetic promoter" refers to a promoter that does not exist in nature. Here, it generally includes the CREs and / or CRMs of the present invention operatively linked to a minimal (or core) promoter or a CNS-specific proximal promoter (promoter element). The function of the CREs and / or CRMs of the present invention is to enhance CNS-specific transcription of genes operatively linked to a synthetic promoter. A portion of the synthetic promoter may be naturally occurring (e.g., a minimal promoter or one or more CREs within a promoter), but the synthetic promoter as an entity is not naturally occurring. Alternatively, the synthetic promoter may be a shorter, truncated version of a promoter that exists in nature.
[0232] As used herein, a “minimum promoter” (also known as a “core promoter”) refers to a typical short DNA segment that is inactive or substantially inactive on its own, but can mediate transcription when bound to other transcriptional regulatory elements. Minimum promoter sequences can originate from a variety of sources, including prokaryotic and eukaryotic genes. An example of a minimum promoter is SYNP_CRE151 (SEQ ID NO:12). Other examples of minimum promoters are the minimum promoter for the dopamine β-hydroxylase gene, the minimum promoter for the cytomegalovirus (CMV) immediate early gene (CMV-MP), and the minimum promoter for herpes simplex thymidine kinase (MinTK). Minimum promoters typically include a transcription start site (TSS) and directly upstream elements, an RNA polymerase II binding site, and a general transcription factor binding site (usually a TATA box). Minimum promoters may also include some elements downstream of the TSS, but these elements are generally not functional without additional regulatory elements.
[0233] As used herein, a “proximal promoter” refers to a minimal promoter plus at least some additional regulatory sequences, typically a proximal sequence upstream of a gene that tends to contain the major regulatory element. It typically extends approximately 250 base pairs upstream of the TSS and includes a specific TFBS. A proximal promoter may also include one or more regulatory elements downstream of the TSS, such as a UTR or intron. In this example, suitably, the proximal promoter may be a shorter, truncated version of a naturally occurring CNS-specific proximal promoter. The proximal promoter of this invention can bind to one or more CREs or CRMs of this invention. However, the proximal promoter can also be synthetic.
[0234] As used herein, "promoter element" refers to the minimal promoter or proximal promoter as defined above. In the context of this invention, promoter elements may be combined with one or more CREs to provide the synthesized CNS-specific promoters of this invention.
[0235] In the context of this invention, a “functional variant” of a CRE, CRM, promoter element, promoter, or other regulatory nucleic acid is a variant of a reference sequence that retains the ability to function in the same manner as the reference sequence, for example, as a CNS-specific CRE, CNS-specific CRM, or CNS-specific promoter. Alternative terms for such functional variants include “bioequivalent” or “equivalent”.
[0236] It is understood that the ability of a particular CRE, CRM, promoter, or other regulatory sequence to function as a CNS-specific enhancer largely depends on its ability to bind the same CNS-specific TFs as the reference sequence. Therefore, in most cases, functional variants of the CRE or CRM will contain most or all of the TFBSs of the same TFs as the reference CRE, CRM, or promoter. It is preferred, but not required, that the TFBSs of the functional variant are in the same relative position (i.e., sequence and general position) as the reference CRE, CRM, or promoter. It is also preferred, but not required, that the TFBSs of the functional variant are in the same orientation as the reference sequence (note that in some cases, TFBSs may exist in the opposite orientation, e.g., an inverse complementary sequence compared to the reference sequence). It is also preferred, but not required, that the TFBSs of the functional variant are on the same strand as the reference sequence. Therefore, in a preferred embodiment, the functional variant comprises TFBSs of the same TFs, in the same order, position, and orientation as the reference sequence, and on the same strand as the reference sequence. It is also understood that sequences located between TFBSs (in some cases referred to as spacer sequences, or similar sequences) have a relatively small impact on the function of the CRE or CRM. Such sequences can typically vary considerably, and their lengths can also differ. However, in a preferred embodiment, the spacing (i.e., the distance between adjacent TFBSs) is substantially the same in the functional variant as in the reference sequence (e.g., the variation does not exceed 20%, preferably not more than 10%, and more preferably substantially the same). Clearly, in some cases, functional variants of the CRE can exist in the opposite direction; for example, it can be the reverse complement of the aforementioned CRE, or a variant thereof.
[0237] The level of sequence identity between functional variants and the reference sequence can also be an indicator or a preserved function. High levels of sequence identity in the TFBS of the CRE, CRM, or promoter are generally more important than sequence identity in the spacer sequence (where little or no sequence conservation is needed). However, it is understandable that even within the TFBS, a considerable degree of sequence variation can be accommodated, since the sequences in a functional TFBS do not need to perfectly match the shared sequence.
[0238] The ability of one or more TFs to bind to TFBS in a specific functional variant can be determined by any relevant means known in the art, including but not limited to electromigration-transfer assay (EMSA), binding assay, chromatin immunoprecipitation (ChIP), and ChIP-sequencing (ChIP-seq). In a preferred embodiment, the ability of one or more TFs to bind to a specific functional variant is determined by EMSA. Methods for performing EMSA are well known in the art. Sambrook et al., cited above, describe suitable methods. Many relevant articles describing this procedure are available, such as Hellman and Fried, Nat Protoc. 2007; 2(8):1849–1861.
[0239] "CNS-specific" or "CNS-specific expression" refers to the ability of cis-regulatory elements, cis-regulatory modules, or promoters to preferentially or primarily enhance or drive gene expression in CNS cells (or CNS-derived cells) compared to other tissues (e.g., liver, kidney, spleen, heart, muscle, and lung). Gene expression can be in the form of mRNA or protein. In a preferred embodiment, CNS-specific expression is characterized by negligible expression in other (i.e., non-CNS) tissues or cells, meaning the expression is highly CNS-specific.
[0240] The ability of a CRE, CRM, or promoter to function as a CNS-specific CRE, CRM, or promoter can be readily assessed by a person skilled in the art. Therefore, a person skilled in the art can easily determine whether any variant of a particular CRE, CRM, or promoter described above still retains its function (i.e., it is a functional variant as defined above). For example, any particular CRM to be assessed can be operatively linked to a minimal promoter (e.g., located upstream of CMV-MP or SEQ ID NO: 12 or 13) and the ability of the cis-regulatory element to drive CNS-specific expression of a gene (typically a reporter gene) can be measured. Alternatively, a variant of the CRE or CRM can be substituted into a synthetic CNS-specific promoter to replace the reference CRE or CRM, and the effect of CNS-specific expression driven by the modified promoter can be determined and compared with the unmodified form. Similarly, the ability of a promoter to drive CNS-specific expression can be readily assessed by a person skilled in the art (e.g., as described in the examples below). The expression level of a gene driven by a variant of the reference promoter can be compared with the expression level driven by the reference promoter. In some implementations, the variant can be said to remain functional if the CNS-specific expression level driven by the variant promoter is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% of the expression level driven by the reference promoter. Suitable nucleic acid constructs and reporter gene assays for assessing enhanced CNS-specific expression can be readily constructed, and suitable methodologies are provided in the examples listed below.
[0241] CNS specificity can be identified, where the expression of a gene (e.g., a therapeutic gene or a reporter gene) preferentially or primarily occurs in CNS-derived cells. Preferential or primary expression can be defined, for example, as a significantly higher expression level in CNS-derived cells than in other cell types (i.e., non-CNS-derived cells). For example, suitably, expression in CNS-derived cells is at least 5-fold higher than expression in non-CNS cells, preferably at least 10-fold higher, and in some cases, 50-fold or more higher. For convenience, appropriately, CNS-specific expression can be demonstrated by comparing expression levels in different non-CNS cell lines (e.g., primary CNS cells or CNS-derived cell lines, such as SH-Sy5y, Neuro2A, U87-MG) with expression levels in muscle-derived cell lines such as C2C12 or H2K cells (skeletal muscle) or H9C2 cells (heart), liver-derived cell lines (e.g., Huh7 or HepG), kidney-derived cell lines (e.g., HEK-293), cervical tissue-derived cell lines (e.g., HeLa), and / or lung-derived cell lines (e.g., A549).
[0242] Compared to non-tissue-specific promoters such as CMV-IE, the synthetic CNS-specific promoters of the present invention preferably exhibit reduced expression in non-CNS-derived cells, suitably in C2C12, H9C2, Huh7, HEK-293, HeLa, and / or A549 cells. The synthetic CNS-specific promoters of the present invention preferably exhibit 50% or less, suitably 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 1% or less activity in non-CNS-derived cells (suitably in C2C12, H9C2, Huh7, HEK-293, HeLa, and / or A549) compared to the CMV-IE promoter. Generally, it is preferred to minimize expression in non-CNS-derived cells, but in some cases this may be unnecessary. Even if the synthetic CNS-specific promoters of the present invention show high expression in, for example, one or two non-CNS cells, it can still be considered a CNS-specific promoter as long as its overall expression is high across a range of CNS and non-CNS cells.
[0243] The synthesized CNS-specific promoters of the present invention are preferably suitable for promoting CNS-specific expression in the CNS of a subject, such as driving transgene expression, preferably therapeutic transgene expression. The preferred synthesized CNS-specific promoters of the present invention are suitable for promoting CNS-specific transgene expression and have an activity in CNS cells of at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, or 400% of the activity of the Synapsin-1 promoter. In some embodiments, the synthesized CNS-specific promoters of the present invention are suitable for promoting CNS-specific transgene expression at a level of at least 100% of the Synapsin-1 promoter activity, preferably 150%, 200%, 300%, or 500% of the Synapsin-1 promoter activity. Appropriately, this CNS-specific expression is identified in CNS-derived cells, such as SH-Sy5y, Neuro2A, U87-MG cell lines, or primary CNS cells (appropriately, primary human neurons, astrocytes, oligodendrocytes, microglia, and / or ependymal cells).
[0244] The synthesized CNS-specific promoters of the present invention can also promote CNS-specific expression of genes in CNS-derived cells, such as SH-Sy5y, Neuro2A, U87-MG cell lines or primary CNS cells (suitably primary human neurons, astrocytes, oligodendrocytes, microglia and / or ependymal cells), at levels of at least 50%, 100%, 150% or 200% compared to CMV-IE.
[0245] As used herein, the term "nucleic acid" generally refers to an oligomer or polymer (preferably a linear polymer) of any length consisting essentially of nucleotides. A nucleotide unit typically comprises a heterocyclic base, a glycosyl group, and at least one, such as one, two, or three phosphate groups, including modified or substituted phosphate groups. Heterocyclic groups may in particular include purine and pyrimidine bases, such as adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), which are widely found in naturally occurring nucleic acids, other naturally occurring bases (e.g., xanthine, inosine, hypoxanthine), and chemically or biochemically modified (e.g., methylated), non-natural, or derived bases. Glycosyl groups may in particular include pentose groups, such as ribose and / or 2-deoxyribose, which are commonly found in naturally occurring nucleic acids, or arabinose, 2-deoxyarabinose, threoose, or hexose groups, as well as modified or substituted glycosyl groups. Nucleic acids as referred to herein may include naturally occurring nucleotides, modified nucleotides, or mixtures thereof. Modified nucleotides may include modified heterocyclic bases, modified sugar moieties, modified phosphate groups, or combinations thereof. Modifications to phosphate groups or sugars may be introduced to improve stability, resistance to enzymatic degradation, or other useful properties. The term "nucleic acid" further preferably includes DNA, RNA, and DNA-RNA hybrid molecules, specifically including hnRNA, pre-mRNA, mRNA, cDNA, genomic DNA, amplification products, oligonucleotides, and synthetic (e.g., chemically synthesized) DNA, RNA, or DNA-RNA hybrids. Nucleic acids may be naturally occurring, for example, present in or isolated from nature; or they may be non-natural, for example, recombinant, i.e., produced by recombinant DNA technology, and / or partially or wholly synthesized chemically or biochemically. "Nucleic acid" may be double-stranded, partially double-stranded, or single-stranded. If single-stranded, the nucleic acid may be a sense strand or an antisense strand. Furthermore, nucleic acids may be circular or linear.
[0246] When referring to nucleic acids, "separate" means a nucleic acid molecule or nucleic acid sequence that is not normally found in nature in its entirety or in part; or a sequence that exists in nature but has a heterologous sequence associated with it; or a molecule that is separate from a chromosome.
[0247] The terms “identity” and “sameness” refer to the sequence similarity between two aggregate molecules, such as two nucleic acid molecules, like two DNA molecules. Sequence alignment and determination of sequence identity can be performed using, for example, a basic local alignment search tool (BLAST) originally described by Altschul et al. 1990 (J Mol Biol 215:403-10), such as the “Blast 2 sequence” algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174:247-250).
[0248] The methods for sequence alignment used for comparison are well known in the art. Various procedures and alignment algorithms are described in, for example: Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444; Higgins and Sharp (1988) Gene 73:237-44; Higgins and Sharp (1989) CABIOS 5:151-3; Corpet et al. (1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) Comp. Appl. Biosci. 8:155-65; Pearson et al. (1994) Methods Mol.Biol.24:307-31; Tatiana et al.(1999)FEMS Microbiol.Lett.174:247-50. Detailed sequence alignment methods and considerations for homology calculations can be found, for example, in Altschul et al.(1990)J.Mol.Biol.215:403-10.
[0249] The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST™; Altschul et al. (1990)) is available from several sources, including the NCBI (Bethesda, MD) and the Internet, and can be used in conjunction with several sequence analysis programs. Descriptions on how to use the program to determine sequence identity can be found in the "Help" section of BLAST™ on the Internet. For comparison of nucleic acid sequences, the "Blast 2 Sequence" function of the BLAST™ (Blastn) program can be used with the default parameters. When evaluated in this way, nucleic acid sequences with greater similarity to the reference sequence will show increasingly larger percentages of identity. Typically, the percentage of sequence identity is calculated over the entire length of the sequence.
[0250] For example, the optimal global alignment can be found appropriately using the Needleman-Wunsch algorithm with the following scoring parameters: match score: +2, mismatch score: -3; gap penalty: gap open 5, gap spread 2. Appropriately, the identity percentage of the optimal global alignment is calculated by multiplying the ratio of the number of aligned bases to the total length of the alignment by 100, where the alignment length includes both matches and mismatches.
[0251] The term "transcription factor binding site" (TFBS) is well known in the art. It will be apparent to those skilled in the art that TFBS sequences can be modified as long as they are intended to bind to a transcription factor (TF). Common sequences of various TFBSs disclosed herein are known in the art, and those skilled in the art can readily use this information to identify alternative TFBSs. Furthermore, those skilled in the art can readily determine experimentally the ability of a TF to bind to a specific putative sequence (e.g., by EMSA and other methods well known in the art and discussed herein).
[0252] The meaning of "shared sequence" is well known in the art. In this application, unless the context otherwise requires, shared sequences are referred to by the following notation. Consider the following exemplary DNA sequences:
[0253] A[CT]N{A}YR
[0254] A indicates that A is always found at this position; [CT] indicates that the position is C or T; N indicates that the position is any base; {A} indicates that the position is any base other than A. Y indicates any pyrimidine, and R indicates any purine.
[0255] In this application, "synthetic" refers to nucleic acid molecules that do not exist in nature. The synthetic nucleic acids of this invention are artificially produced, typically through recombinant techniques or de novo synthesis. Such synthetic nucleic acids may contain naturally occurring sequences (e.g., promoters, enhancers, introns, and other such regulatory sequences), but these sequences exist in a non-natural context. For example, synthetic genes (or portions of genes) typically contain one or more discontinuous nucleic acid sequences found in nature (chimeric sequences), and / or may contain substitutions, insertions, and deletions, and combinations thereof.
[0256] As used herein, “complementary” or “complementarity” refers to the Watson-Crick base pairing of two nucleic acid sequences. For example, sequence 5'-AGT-3' binds to its complementary sequence 3'-TCA-5'. The complementarity between two nucleic acid sequences can be “partial,” meaning only some bases bind to their complements, or it can be complete, meaning every base in the sequence binds to its complementary base.
[0257] As used herein, the term "application" refers to the introduction of a foreign substance into a human or animal body. For example, application can be intravenous, intra-arterial, or intracranial.
[0258] In this application, “transfection” refers to any process that intentionally introduces nucleic acid into cells, including the introduction of viral and non-viral vectors, and includes or is equivalent to transformation, transduction, and similar terms and processes. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors; electroporation (Fromm et al. (1986) Nature 319:791-3); liposome transfection (Feigner et al. (1987) Proc. Natl. Acad. Sci. USA 84:7413-7); microinjection (Mueller et al. (1978) Cell 15:579-85); Agrobacterium-mediated transfer (Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803-7); direct DNA uptake; whisker-mediated transformation; and microprojectile bombardment (Klein et al. (1987) Nature 327:70).
[0259] As used herein, the phrase “transgenic” refers to a foreign nucleic acid sequence. In one instance, a transgenic is a gene encoding an industrially or pharmaceutically useful compound, or a gene encoding an desired trait. In another instance, a transgenic encodes a useful nucleic acid, such as an antisense nucleic acid sequence, in which expression of the antisense sequence suppresses expression of the target nucleic acid sequence. Transgenics preferably encode therapeutic products, such as proteins.
[0260] The term "vector" is well known in the art and, herein, refers to a nucleic acid molecule, such as double-stranded DNA, in which a nucleic acid sequence according to the invention has been inserted. Suitablely, a vector can be used to transport the inserted nucleic acid molecule into a suitable host cell. A vector typically contains all the necessary elements to allow transcription of the inserted nucleic acid molecule, and preferably to translate the transcript into a polypeptide. A vector typically contains all the necessary elements such that, once the vector enters the host cell, it can replicate independently of or simultaneously with the host chromosomal DNA; multiple copies of the vector and its inserted nucleic acid molecule can be produced. The vectors of the present invention can be free vectors (i.e., not integrated into the host cell genome) or vectors integrated into the host cell genome. This definition includes both non-viral and viral vectors. Non-viral vectors include, but are not limited to, plasmid vectors (e.g., pMA-RQ, pUC vectors, bluescript vectors (pBS), and pBR322 or derivatives thereof lacking bacterial sequences (minicircles)), transposon-based vectors (e.g., PiggyBac (PB) vectors or Sleeping Beauty (SB) vectors), etc. Larger vectors, such as artificial chromosomes (bacterial (BAC), yeast (YAC), or human (HAC)), can be used to accommodate larger inserts. Viral vectors are derived from viruses, including but not limited to retroviruses, lentiviruses, adeno-associated viruses, adenoviruses, herpesviruses, hepatitis virus vectors, etc. Typically, but not necessarily, viral vectors are replication-defective because they have lost the ability to reproduce in specific cells, as the viral genes necessary for replication have been removed from the viral vector. However, some viral vectors can also be tuned to replicate specifically in specific cells (e.g., cancer cells) and are often used to trigger cell-specific (tumor) lysis. Virosomes are non-limiting examples of vectors containing both viral and non-viral elements, particularly those combining liposomes with inactivated HIV or influenza viruses (Yamada et al., 2003). Another example involves viral vectors mixed with cationic lipids.
[0261] As used herein, the terms “operably linked,” “operably connected,” or equivalent expressions refer to the arrangement of various nucleic acid elements such that these elements are functionally connected and can interact with each other in a desired manner. Such elements may include, but are not limited to, promoters, CREs (e.g., enhancers or other regulatory elements), promoter elements, polyadenylated sequences, one or more introns and / or exons, and the coding sequence of the gene of interest to be expressed. When properly oriented or operably linked, these nucleic acid sequence elements work together to regulate each other’s activity and may ultimately affect the expression level of the expression product. Regulation refers to increasing, decreasing, or maintaining the activity level of a particular element. The position of each element relative to other elements can be indicated by the 5' and 3' ends of each element or their upstream or downstream position to another element or location (e.g., a TSS or promoter element), and the distance between any particular elements can be indicated by the number of nucleotides or base pairs between the elements. As understood by those skilled in the art, operably linked implies functional activity and is not necessarily related to a natural positional association. In fact, when used in nucleic acid expression cassettes, CREs are typically located upstream of promoter elements (although this is usually the case, it should absolutely not be interpreted as limiting or excluding locations within the nucleic acid expression cassette), but this is not necessarily the case in vivo. For example, regulatory element sequences naturally present downstream of genes whose transcription is affected can function in the same way when located upstream of the promoter. Therefore, depending on the specific implementation, the regulatory or enhancing effect of a regulatory element can be location-independent.
[0262] As used herein, a "spacer sequence" or "spacer region" is a nucleic acid sequence that separates two functional nucleic acid sequences (e.g., TFBS, CRE, CRM, promoter elements, etc.). It can essentially be any sequence, as long as it does not prevent the functional nucleic acid sequence (e.g., cis-regulatory elements) from performing its desired function (e.g., if it includes a silencer sequence that prevents the binding of a desired transcription factor, or similar situations). Typically, it is non-functional because its presence is solely to space adjacent functional nucleic acid sequences from each other. In some embodiments, the spacer region can be 75, 50, 40, 30, 30, or 10 nucleotides long or less.
[0263] As used herein, the term “pharmaceutically acceptable” is consistent with the art and means compatible with other components of a pharmaceutical composition and harmless to its recipient.
[0264] "Therapeutic effective dose" and similar phrases refer to the dose or plasma concentration in a subject that provides the desired specific pharmacological effect (e.g., expression of a therapeutic gene in the CNS). A therapeutic effective dose is not necessarily effective for treating the conditions described herein, even if such a dose is considered therapeutically effective by those skilled in the art. Therapeutic effective doses can vary depending on the route of administration and dosage form, the subject's age and weight, and / or the disease or condition being treated.
[0265] As used herein, the term "AAV vector" is well-known in the art and generally refers to the nucleic acid sequence of an AAV vector, including a variety of nucleic acid sequences. As used herein, an AAV vector typically includes a heterologous nucleic acid sequence not derived from AAV as part of the vector. This heterologous nucleic acid sequence typically includes the promoter disclosed herein, as well as other sequences of interest for cellular genetic transformation. Generally, the heterologous nucleic acid sequence has at least one, and usually two, reversed AAV terminal repeat (ITR) sequences flanking it. "AAV virion," "AAV virus," "AAV virus particle," or "AAV vector particle" refers to a viral particle consisting of at least one AAV capsid polypeptide (including variant AAV capsid polypeptides and non-variant parental capsid polypeptides) and a coated polynucleotide AAV vector. If the particle includes a heterologous nucleic acid (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene to be delivered to mammalian cells), it may be called an "AAV vector particle" or simply "AAV vector." Therefore, the production of AAV virions or AAV particles necessarily includes the production of AAV vectors, as such vectors are contained within the AAV virions or AAV particles. ITRs can originate from the same serotype as the capsid, selected from any serotype listed in Table 1, or they can originate from a different serotype than the capsid. AAV vectors typically have more than one ITR. In a non-limiting example, an AAV vector has a viral genome containing two ITRs. In one embodiment, these ITRs belong to the same serotype as each other. In another embodiment, the ITRs belong to different serotypes. Non-limiting examples include zero, one, or two ITRs having the same serotype as the capsid. Independently, each ITR can be about 100 to about 150 nucleotides in length. The length of an ITR can be about 100-105 nucleotides, 106-110 nucleotides, 111-115 nucleotides, 116-120 nucleotides, 121-125 nucleotides, 126-130 nucleotides, 131-135 nucleotides, 136-140 nucleotides, 141-145 nucleotides, or 146-150 nucleotides. In one embodiment, the length of an ITR is 140-142 nucleotides. Non-restricted examples of ITR lengths are 102, 105, 130, 140, 141, 142, and 145 nucleotides.
[0266] As used herein, the term "microRNA" refers to any type of interfering RNA, including but not limited to endogenous microRNAs and artificial microRNAs (e.g., synthetic miRNAs). Endogenous microRNAs are small RNAs naturally encoded in the genome that regulate the production and utilization of mRNA. Artificial microRNAs can be any type of RNA sequence, other than endogenous microRNAs, that regulates mRNA activity. A microRNA sequence can be an RNA molecule composed of any one or more of these sequences. microRNA (or “miRNA”) sequences have been described in publications such as Lim, et al, 2003, Genes & Development, 17, 991-1008; Lim et al, 2003, Science, 299, 1540; Lee and Ambrose, 2001, Science, 294, 862; Lau et al, 2001, Science, 294, 858-861; Lagos-Quintana et al, 2002, Current Biology, 12, 735-739; Lagos-Quintana ei a / ., 2001, Science, 294, 853-857; and Lagos-Quintana et al., 2003, RNA, 9, 175-179. Examples of microRNAs include any fragment of a larger RNA or miRNA, siRNA, stRNA, sncRNA, tncRNA, snoRNA, smRNA, shRNA, snRNA, or other small non-coding RNA. See, for example, U.S. Patent Applications 20050272923, 20050266552, 20050142581, and 20050075492. A “microRNA precursor” (or “pre-miRNA”) refers to a nucleic acid having a stem-loop structure containing a microRNA sequence. A “mature microRNA” (or “mature miRNA”) includes microRNA cleaved from a microRNA precursor (“pre-miRNA”) or synthesized (e.g., synthesized in a laboratory via cell-free synthesis) and is approximately 19 to approximately 27 nucleotides in length; that is, the length of a mature microRNA can be 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, or 27 nt. Mature microRNAs can bind to target mRNAs and inhibit their translation.
[0267] The term “treatment” means to reduce, improve, or eliminate one or more signs, symptoms, or effects of a disease or condition. Therefore, as used herein, “treatment” includes any treatment of a disease in mammals, particularly humans, and includes: (a) preventing a subject who is susceptible to or at risk of developing the disease but has not yet been diagnosed with it from becoming ill; (b) suppressing the disease, i.e., preventing its development; and (c) alleviating the disease, i.e. leading to its remission.
[0268] "Administering" a drug to a subject includes any route by which the drug is introduced or delivered to the subject to exert its intended function. Administration can be performed via any suitable route, including oral, intranasal, intraocular, ophthalmic, parenteral (intravascular, intramuscular, intraperitoneal, or subcutaneous), or topical. Administration includes self-administration and administration by another person. Intravenous or intra-arterial administration is of particular significance in this invention.
[0269] The terms “individual,” “subject,” and “patient” are used interchangeably and refer to any individual subject suffering from a disease or condition requiring treatment. For the purposes of this disclosure, a subject may be a primate, preferably a human, or other mammal such as a dog, cat, horse, pig, goat, or cow.
[0270] The term "specific activity in a region or tissue" refers to a promoter that has major activity in that region or tissue, meaning it is more active in that region or tissue than in other regions or tissues.
[0271] Example
[0272] Example 1
[0273] AAV9 was used to investigate CNS transduction and vector biodistribution of CNS1-8 (SEQ ID NO:1-4,23-26) operatively linked to GFP.
[0274] AAV plasmid preparation:
[0275] hSyn.GFP plasmid containing ssAAV2 inverted terminal repeats was obtained from Addgene and used to generate the control AAV vector (Synapsin-1). (The process was repeated in the original text.) (Thermo Fisher Scientific, Germany) cloned the CNS 1-8 (SEQ ID NO: 1-4, 23-26) promoter into the hSyn.GFP plasmid to replace the hSyn promoter. All plasmid DNA was cloned using PureLink according to the manufacturer's instructions. TMPrepared using the HiPure Plasmid Maxiprep Kit (#K210007; Thermo Fisher Scientific, Germany), and quantified using an Omega FLUOstar spectrophotometer (BMG Labtech, UK).
[0276] AAV vector preparation:
[0277] A recombinant AAV2 / 9 vector encoding GFP (referred to as AAV9 throughout) was generated using a standard triple plasmid transfection method. In short, the virus-producing human embryonic kidney (HEK) 293T cells were co-transfected with three plasmids: pGFP (SEQ ID NO: 1-4, 23-26) controlled by different promoters, pGD9 encoding the AAV9 capsid, and pHGTI containing helper functions, using polyethyleneimine (PEI) (#24765; Polysciences, UK) at a stock concentration of 1 mg / ml in a molar ratio of 1:3:1. After 72 hours, cells were collected and lysed. Cell lysates and supernatants were treated with nucleases, filtered, and then... Purification was performed via affinity chromatography on a plus (GE Healthcare Ltd, UK) using Primeview 5.0 software and POROS™ CaptureSelect™ AAVX resin (Thermo Fisher Scientific, Germany). AAV carrier titration:
[0278] All carrier preparations were carried out in accordance with... Instructions from the manufacturer of Universal qPCR Master Mix (#M3003; New England Biolabs, UK) are available at QuantStudio. TM GFP transgenes were titrated by qPCR on a 3-System Real-Time PCR instrument (ThermoFisher Scientific, UK). Data were analyzed using QuantStudio design and analysis software V5. Primers designed for amplifying the GFP transgene segments (Table 5) were used to determine the number of vector genomes. All vectors were titrated to 1x10⁻⁶. 13 One vector genome / mL (vg / mL).
[0279] Animal program:
[0280] All animal experiments were conducted under the guidance of the University College London (UCL) Ethics Review Committee, in accordance with UK Home Office regulations and the Animal (Scientific Procedures) Act 1986. Distantly bred CD1 mice (Charles River, UK) were housed in individually ventilated cages (IVCs) in the Central Biological Services Unit at UCL under standard conditions: 12-hour light-dark cycles, constant temperature (21-23°C), humidity (60% ± 5%), and free access to pelleted food and water. Experimental breeding pairs were time-mated at 6 weeks of age, and the newborn pups were used for these promoter studies. Pups were weaned at P21 and euthanized at P35 for tissue analysis.
[0281] Animal injection:
[0282] All pups were injected on the day of birth (P0). Before using any injection method, the pups underwent brief hypothermic anesthesia. For each injection method and vector type, four mice were injected, along with four uninjected controls. Each mouse was uniquely identified by a tattoo on its paw. The pups were warmed to normal temperature before returning to their mothers.
[0283] Intracranial injection of viral vector into newborn cubs:
[0284] Using a 33-gauge Hamilton needle (Fisher Scientific, UK), 5 μl of viral vector (5 x 10⁻⁶) was delivered. 10 (One viral genome / pup) was injected into the lateral ventricle of the pup's brain using established coordinates (Kim, Ji-Yoen et al., 2013), which are incorporated herein by reference. Injection into the ventricle bypasses the blood-brain barrier.
[0285] Newborn cubs were intravenously injected with viral vectors:
[0286] 20 μl of viral vector (2 x 10) 11 (One viral vector / pup) was injected into the superficial temporal vein of the pup. The vein was observed using fiber optic transmission illumination, and the injection was performed using a 33-gauge Hamilton needle and a stereoanatomical microscope (Zeiss, Germany).
[0287] Perfusion and tissue preparation:
[0288] Animals were anesthetized with isoflurane (5% induction chamber, 1.5% maintenance via nasal cone). Cardiac perfusion was performed by incising the right atrium and injecting 10 mL of autoclaved PBS (phosphate-buffered saline) into the left ventricle until liver bleaching was achieved. The brain and visceral organs were halved to allow for different processing techniques according to the following experiments. The half used for immunohistochemistry was post-fixed in 4% paraformaldehyde (PFA) for 48 hours, transferred to 30% sucrose solution, and cryoprotected at 4°C until sectioning. The half of the brain was mounted on a cryostat (Thermo Fisher HM430) at a thickness of 40 mm in the coronal or sagittal plane and stored in TBSAF (Tris-buffered saline (TBS), 30% ethylene glycol, 15% sucrose, 0.05% sodium azide) at 4°C. The half of the brain and visceral organ tissue used for molecular biological evaluation experiments was rapidly frozen in dry ice and stored at -80°C. Following standard DNA and / or RNA extraction protocols, vector copy number (VCN) and gene expression (cDNA) qPCR analyses were performed, respectively.
[0289] Tissue analysis of GFP expression:
[0290] GFP expression in the mouse brain was assessed by immunohistochemistry (IHC) and immunofluorescence (IHF). Free-floating IHC was used for immunoperoxidase staining with diaminobenzidine (DAB).
[0291] Brain slices were selected for whole-brain analysis or representative slices were selected from different brain regions (olfactory bulb, prefrontal cortex, striatum, hippocampus, midbrain, and cerebellum). All washing steps were performed three times at room temperature (RT) using 1xTBS.
[0292] All brain sections were washed and then treated with 30% H2O2 (Sigma Aldrich, UK) in 1x TBS for 30 min, and blocked with 15% normal goat serum (Vector Laboratories, UK) in TBST (1xTBS, 0.3% Triton X-100) for 30 min at room temperature. The samples were incubated with the primary antibody (rabbit or chicken anti-GFP antibody from Table 6) for 12–14 h with constant stirring on an orbital shaker at 4°C. The sections were washed and incubated with the corresponding biotinylated secondary antibody (anti-rabbit or anti-chicken biotinylated secondary antibody from Table 6) on an orbital shaker for 2 h at room temperature. The sections were washed and incubated with avidin-biotin solution (ABC Vector Stain, Vector Laboratories, UK). The sections were washed and the reaction was visualized with DAB (Sigma Aldrich, UK) (10 mg DAB in 20 mL TBS, 6 mL 30% H2O2). The reaction was stopped after a maximum of 7 minutes using ice-cold 1x TBS, and then fixed onto a glass slide. Free-floating immunofluorescence:
[0293] Use a protocol similar to that used for DAB immunoperoxidase staining. Wash sections in 1x TBS and block in 15% normal goat serum for 30 min. Incubate sections with selected primary antibodies diluted in 10% normal goat serum TBST (transgenic markers and cell type markers, rabbit / chicken anti-GFP and rabbit / chicken anti-tyrosine hydroxylase from Table 6) overnight at 4°C. Wash sections in TBS and incubate at room temperature for 2 h with secondary fluorophores diluted in 10% normal goat serum (anti-chicken / rabbit Alexa powder secondary antibodies from Table 6). Wash sections, treat with DAPI (4',6-diamidinyl-2-phenylindole, Sigma Aldrich, UK) for 2 min, transfer to ice-cold 1x TBS, and then fix onto glass slides.
[0294] Microscopic examination:
[0295] Light microscopy and fluorescence imaging were performed using a Leica DM4000B. All images were taken with a Leica DFC420 camera and Leica Application Suite V3.7 software, keeping the light intensity, exposure, microscope calibration, and photographic camera settings constant (Leica Microsystems, UK).
[0296] Threshold analysis was used to quantitatively measure the GFP staining intensity of 10 non-overlapping RGB images of selected brain regions (cortex, hippocampus, striatum, midbrain, and cerebellum) at x40 magnification. Foreground immunostaining was defined by averaging the highest and lowest signals, and the mean percentage area of immunoreactivity for each region of interest was calculated using Image-Pro 10 software (Media Cybernetics, USA).
[0297] The quantification of midbrain dopaminergic (mDA) neurons was performed by counting TH-positive neurons and vector-driven GFP-expressing cells, and the percentage of double-positive neurons was calculated.
[0298] qRT-PCR is used for vector expression analysis:
[0299] Using TRIzol TM RNA was extracted from the brain and organs using the Plus RNA Purification Kit (Thermo Fisher Scientific, Germany) or the RNeasymini Kit (Qiagen, UK) and quantified on an Omega FLUOstar (BMG Labtech, UK). Contaminating DNA was removed from total RNA (1–2 μg) using the DNAse I Purification Kit (NEB, UK), followed by reverse transcription using a high-capacity cDNA reverse transcription kit (Applied Bioscience, Thermo Fisher Scientific, Germany). qPCR was performed with 10 ng of cDNA on a Quantstudio™ Real-Time PCR System (Applied Biosystems, UK) using a Luna Taqman mastermix (NEB, UK) and 300 nM primers (Table 5).
[0300] Quantification of GFP transcripts was achieved by comparison with standard curves generated from amplification of GFP and mGAPDH transcript-specific plasmid constructs. mGAPDH was used as an endogenous control, and relative fold changes were calculated using methods for vector genome copy number analysis.
[0301] Table 5: Primer sequences used for viral vector titration and qRT-PCR
[0302] GFP F GGCACAAGCTGGAGTACAAC(SEQ ID NO:15) GFP R AGTTCACCTTGATGCCGTTC(SEQ ID NO:16) GFP probe (FAM)-AGCCACAACGTCTATATCATGGCCG (SEQ ID NO:17) mouse GAPDH F ACGGCAAATTCAACGGCAC(SEQ ID NO:18) Mouse GAPDH R TAGTGGGGTCTCGCTCCTGG(SEQ ID NO:19) Mouse GAPDH probe (VIC)-TTGTCATCAACGGGAAGCCCATCA(SEQ ID NO:20)
[0303] FAM and VIC are fluorescent reporter dyes attached to the probe.
[0304] Table 6: Antibodies used for IHC or IHF
[0305]
[0306]
[0307] CNS 1-8 Component Design
[0308] The promoter in this invention was designed using a hybrid approach combining bioinformatics analysis and literature review.
[0309] CNS-5_v2, CNS-6_v2, CNS-7_v2, and CNS-8_v2 (SEQ ID NO:5-8) are longer versions of promoters CNS-5, CNS-6, CNS-7, and CNS-8 (SEQ ID NO:23-26). That is, CNS-5_v2, CNS-6_v2, CNS-7_v2, and CNS-8_v2 (SEQ ID NO:5-8) have been shortened, and the minimal promoter SYNP_CRE151 (SEQ ID NO:12) has been added to this shorter version, resulting in CNS-5, CNS-6, CNS-7, and CNS-8 (SEQ ID NO:23-26). Due to the high sequence similarity between the longer and shorter versions of these synthetic promoters (e.g., CNS-5_v2 and CNS-5), similar expression can be expected.
[0310] result
[0311] GFP expression from the CNS-1-CNS-8 promoter (SEQ ID NO: 1-4; 23-26) and the control promoter Syn1 (SEQ ID NO: 14) was initially assessed in sagittal sections, and the results showed... Figures 2A-2B In the study, all promoters tested showed expression in the CNS, with intensity and distribution spanning different brain regions.
[0312] In animals injected with ICV, CNS-1 (SEQ ID NO:1) showed the strongest expression, CNS-3 (SEQ ID NO:3) showed the weakest expression, and the remaining promoters were between these two extremes. Notably, CNS-1 (SEQ ID NO:1) expression was stronger and more uniform in the brain than the control promoter Syn1 (SEQ ID NO:14).
[0313] In animals that received IV injections, CNS-4 (SEQ ID NO:4) showed the strongest expression, CNS-3 (SEQ ID NO:3) showed the weakest expression, and the remaining promoters were in between these two extremes. Promoters CNS-1-CNS-8 (SEQ ID NO:1-4,23-26) all showed weaker expression than the control promoter Syn1.
[0314] Therefore, the application method (ICV and IV) affects both the strength and distribution of the CNS promoter.
[0315] Then, GFP expression of the CNS-1-CNS-8 (SEQ ID NO: 1-4; 23-26) promoter delivered by ICV and the control promoter Syn1 (SEQ ID NO: 14) was evaluated in coronal sections, and the results were shown in... Figures 3A-3B Similarly, all tested promoters showed CNS expression, with intensity and distribution spanning different brain regions. Promoters CNS-1, CNS-2 (SEQ ID NO:1-2), and CNS-7 (SEQ ID NO:25) showed the strongest expression, CNS-3 (SEQ ID NO:3) showed the weakest expression, and the remaining promoters were between these two extremes. Promoters CNS-1 (SEQ ID NO:1), CNS-2 (SEQ ID NO:2), and CNS-7 (SEQ ID NO:25) showed expression levels similar to the control promoter Syn1.
[0316] GFP expression of the CNS-1-CNS-8 (SEQ ID NO:1-4,23-26) promoter delivered via IV was also evaluated in coronal sections, and the results showed that... Figures 4A-4B Similarly, all tested promoters showed expression in the CNS, with intensity and distribution spanning different brain regions. Promoter CNS-3 (SEQ ID NO:3) showed the strongest expression, CNS-8 (SEQ ID NO:26) showed the weakest expression, and the remaining promoters were between these two extremes.
[0317] Then, GFP expression of the CNS-1-CNS-8 (SEQ ID NO:1-4,23-26) promoter delivered by ICV and the control promoter Syn1 (SEQ ID NO:14) was observed at higher magnification in coronal sections. The results showed... Figure 5A- As shown in Figure B. At higher magnification, CNS-1 (SEQ ID NO:1), CNS-2 (SEQ ID NO:2), and CNS-7 (SEQ ID NO:25) showed extensive intracranial expression, with CNS-1 (SEQ ID NO:1) showing the strongest expression. This expression of CNS-1 (SEQ ID NO:1) and CNS-2 (SEQ ID NO:2) appears to be primarily neuronal. Figure 11 As shown, when GFP was driven by CNS-1 (SEQ ID NO:1) during ICV delivery, double staining of CNS cell types also confirmed that GFP was primarily expressed in neurons. When driven by CNS-7 (SEQ ID NO:25), GFP expression was observed in neurons and astrocytes. CNS-3 (SEQ ID NO:3) and CNS-4 (SEQ ID NO:4) showed weaker expression, localized in the cortex and hippocampus. The expression of CNS-3 (SEQ ID NO:3) and CNS-4 (SEQ ID NO:4) appeared to be primarily in neurons and astrocytes. CNS-5 (SEQ ID NO:23) showed strong activity in the cortex, striatum, hippocampus, and midbrain, but lower activity in the cerebellum. CNS-6 (SEQ ID NO:24) and CNS-8 (SEQ ID NO:26) showed strong activity in the hippocampus, followed by the cortex and midbrain, with less expression in other tested brain sites. The expression of CNS-6 (SEQ ID NO:24) and CNS-8 (SEQ ID NO:26) appears to be primarily neuronal.
[0318] GFP expression of the CNS-1-CNS-8 (SEQ ID NO:1-4,23-26) promoter delivered via IV was also observed at higher magnification in coronal sections, and the results showed Figures 6A-6BCNS-1 (SEQ ID NO:1) was highly active in the cortex and hippocampus. Low levels of CNS-2 (SEQ ID NO:2) were expressed in most tested areas, except the midbrain. CNS-3 (SEQ ID NO:3) and CNS-4 (SEQ ID NO:4) were expressed in the cortex, striatum, and hippocampus, with CNS-4 (SEQ ID NO:4) expressed in the midbrain, while CNS-3 (SEQ ID NO:3) was not expressed in the midbrain. CNS-5 (SEQ ID NO:23) showed minimal expression in all tested brain regions. CNS-6 (SEQ ID NO:24) was expressed in the hippocampus, midbrain, and cerebellum. CNS-7 (SEQ ID NO:25) was expressed in the cortex, hippocampus, and midbrain. CNS-8 (SEQ ID NO:26) was active in the hippocampus and midbrain.
[0319] Expression of the CNS1-8 (SEQ ID NO:1-4,23-26) promoter and the control promoter Syn1 delivered via ICV in the midbrain was observed at higher magnification, and the results showed Figures 7A-7B In the midbrain, CNS1-4 (SEQ ID NO:1-4) and Syn1 (SEQ ID NO:14) showed some GFP expression. Double staining for dopaminergic neuronal markers (TH+) indicated that some GFP expression from the Syn1 (SEQ ID NO:14) promoter localized to dopaminergic neurons, but only a portion of the GFP expression from CNS1-4 (SEQ ID NO:1-4) localized to dopaminergic neurons. CNS-6 (SEQ ID NO:24) and CNS-7 (SEQ ID NO:25) showed very little expression in the midbrain. CNS-5 (SEQ ID NO:23) showed expression in the midbrain, but this expression did not appear to localize to dopaminergic neurons. A large portion of the GFP expression driven by the CNS-8 (SEQ ID NO:26) promoter localized to dopaminergic neurons.
[0320] Expression of the CNS1-8 (SEQ ID NO: 1-4, 23-26) promoter delivered via IV was also observed in the midbrain, with results shown below. Figures 7A-7BCNS-1-4 (SEQ ID NO:1-4) showed very little GFP expression in the midbrain, and most of the GFP-positive cells were not dopaminergic neurons. CNS-5 (SEQ ID NO:23), CNS-6 (SEQ ID NO:24), and CNS-7 (SEQ ID NO:25) did not show any GFP expression in the midbrain after IV delivery. On the other hand, CNS-8 (SEQ ID NO:26) showed strong expression in the midbrain, and many of the cells showing GFP expression were dopaminergic neurons.
[0321] Figure 9 The biodistribution of transgenic GFP delivered via ICV and IV under the control of CNS-1-8 (SEQ ID NO:1-4,23-26) and the control promoter Syn-1 (SEQ ID NO:14) in different tissues is shown.
[0322] In ICV delivery, CNS-1-4 (SEQ ID NO: 1-4) showed activity in the heart, while the remaining tested promoter CNS-5-8 (SEQ ID NO: 23-26) showed no activity in the heart. In IV delivery, CNS-1-4 (SEQ ID NO: 1-4) showed activity in the heart, while the remaining tested promoter CNS-5-8 (SEQ ID NO: 23-26) showed no activity in the heart. The control promoter Syn-1 also showed very low activity in the heart in both ICV and IV delivery.
[0323] In ICV delivery, CNS-1-4 (SEQ ID NO:1-4), CNS-6 (SEQ ID NO:24), CNS-8 (SEQ ID NO:26), and the control promoter Syn-1 (SEQ ID NO:14) showed activity in the liver, while the remaining tested promoters did not. In IV delivery, CNS-1-4 (SEQ ID NO:1-4), CNS-6 (SEQ ID NO:24), CNS-8 (SEQ ID NO:26), and the control promoter Syn-1 (SEQ ID NO:14) showed activity in the liver, while the remaining tested promoters did not.
[0324] In ICV delivery, CNS1-3 (SEQ ID NO:1-3) and CNS-8 (SEQ ID NO:26) showed activity in the kidneys, while CNS-4-7 (SEQ ID NO:4,23-25) and the control promoter Syn-1 (SEQ ID NO:14) did not show activity in the kidneys. In IV delivery, CNS-2-3 (SEQ ID NO:2-3) and CNS-8 (SEQ ID NO:26) showed activity in the kidneys, while the remaining tested promoters and the control promoter Syn-1 (SEQ ID NO:14) did not.
[0325] In ICV delivery, CNS-3 (SEQ ID NO:3) showed activity in skeletal muscle, while CNS-1-2 (SEQ ID NO:1-2) and CNS-4-8 (SEQ ID NO:4,23-26) did not. In IV delivery, CNS-1-3 (SEQ ID NO:1-3) showed activity in skeletal muscle, while CNS-4-8 (SEQ ID NO:4,23-26) did not. The control promoter Syn-1 (SEQ ID NO:14) did not show activity in skeletal muscle.
[0326] In ICV delivery, CNS-1 (SEQ ID NO:1) and CNS-7-8 (SEQ ID NO:25-26) showed activity in the spleen, while CNS-2-6 (SEQ ID NO:2-4,23-24) and the control promoter Syn-1 (SEQ ID NO:14) did not show activity in the spleen. In IV delivery, CNS-2 (SEQ ID NO:2) and CNS-7-8 (SEQ ID NO:25-26) showed activity in the spleen, while CNS-1 (SEQ ID NO:1), CNS-3-6 (SEQ ID NO:3-4,23-24) and the control promoter Syn-1 (SEQ ID NO:14) did not show activity in the spleen.
[0327] The percentage of GFP immunoreactivity per square millimeter was measured in different regions of the brain, and the results showed... Figure 10As before, GFP was administered via ICV and IV via CNS-1 (SEQ ID NO:1), CNS-2 (SEQ ID NO:2), CNS-3 (SEQ ID NO:3), CNS-4 (SEQ ID NO:4), CNS-5 (SEQ ID NO:23), CNS-6 (SEQ ID NO:24), CNS-7 (SEQ ID NO:25), CNS-8 (SEQ ID NO:26), and the control promoter Syn-1 (SEQ ID NO:14). In ICV delivery, the control promoters Syn-1 (SEQ ID NO:14), CNS-1 (SEQ ID NO:1), and CNS-2 (SEQ ID NO:2) showed a very high percentage of GFP immunoreactivity in the cortex, followed by CNS-7 (SEQ ID NO:25) and CNS-4 (SEQ ID NO:4), while the remaining tested promoters showed very little or no GFP immunoreactivity in the cortex. In IV delivery, the control promoter Syn-1 (SEQ ID NO:14) showed a high percentage of GFP immunoreactivity in the cortex, but the other tested promoters showed very little or no GFP immunoreactivity in the cortex.
[0328] In ICV delivery, CNS-1 (SEQ ID NO:1) and CNS-2 (SEQ ID NO:2) showed very high percentages of GFP immunoreactivity in the striatum, followed by CNS-4 (SEQ ID NO:4), CNS-5 (SEQ ID NO:23), and CNS-7 (SEQ ID NO:25). The remaining tested promoters showed very little or no GFP immunoreactivity in the striatum. In IV delivery, CNS-2 (SEQ ID NO:2) and CNS-3 (SEQ ID NO:3) showed low percentages of GFP immunoreactivity in the striatum, while the remaining tested promoters showed very little or no GFP immunoreactivity in the striatum. The control promoter Syn-1 (SEQ ID NO:14) showed very high GFP immunoreactivity in the striatum in both ICV and IV delivery.
[0329] In ICV delivery, CNS-1-8 (SEQ ID NO:1-4,23-26) showed moderate to high percentage GFP immunoreactivity in the hippocampus, and a higher percentage of GFP immunoreactivity in the hippocampus than the control promoter Syn-1 (SEQ ID NO:14). In IV delivery, CNS-1-8 (SEQ ID NO:1-4,23-26) showed very little or no GFP immunoreactivity in the hippocampus, while the control promoter Syn-1 (SEQ ID NO:14) showed very high GFP immunoreactivity in the hippocampus.
[0330] In ICV delivery, CNS-1 (SEQ ID NO:1) and CNS-2 (SEQ ID NO:2) showed very high percentages of GFP immunoreactivity in the midbrain, followed by CNS-7 (SEQ ID NO:25), CNS-5 (SEQ ID NO:23), and CNS-4 (SEQ ID NO:4), while the remaining tested promoters showed very little or no GFP immunoreactivity in the cortex. In IV delivery, CNS-1-8 (SEQ ID NO:1-4, 23-26) showed very little or no GFP immunoreactivity in the midbrain, while the control promoter Syn-1 (SEQ ID NO:14) showed very high GFP immunoreactivity in the midbrain. Notably, CNS-8 (SEQ ID NO:26) showed activity in dopaminergic neurons in the midbrain during IV delivery, such as... Figure 8B As shown, it exhibits very low GFP immunoreactivity in the midbrain.
[0331] In ICV delivery, CNS-1-8 (SEQ ID NO:1-4,23-26) showed moderate to low percentages of GFP immunoreactivity in the cerebellum. The percentages of GFP immunoreactivity for CNS-1 (SEQ ID NO:1) and CNS-5-8 (SEQ ID NO:23-26) were higher than that for the control promoter Syn 1 (SEQ ID NO:14). In IV delivery, the control promoter Syn-1 (SEQ ID NO:14) showed a high percentage of GFP immunoreactivity in the cerebellum, but the remaining tested promoters showed very low or no GFP immunoreactivity in the cerebellum.
[0332] Notably, CNS-1 (SEQ ID NO:1) showed a high or moderate percentage of GFP immunoreactivity in each of all tested brain regions delivered via ICV. Similarly, CNS-2 (SEQ ID NO:2) showed a high percentage of GFP immunoreactivity in four of the five tested regions (excluding the cerebellum) delivered via ICV. CNS-8 (SEQ ID NO:26) showed a very low percentage of GFP immunoreactivity or no GFP immunoreactivity in each of all tested brain regions, but still appeared to be expressed in dopaminergic neurons.
[0333] Example 2
[0334] The biodistribution of the transgenic GFP under CNS-8 (SEQ ID NO:26) control was further investigated at higher doses (referred to herein as high doses) in IV and ICV delivery. Intracranial and intravenous injections were performed as described in Example 1, but 5 x 10⁻⁶ ppm was injected in the intracranial injection. 11 One viral genome / pup, injected intravenously at 2x10 12 One viral genome / pup (10 times higher dose). The dose used for IV and ICV delivery in Example 1 is referred to herein as the low dose.
[0335] like Figure 2B and Figure 12 As shown, the biodistribution of GFP under CNS-8 control at low doses during ICV and IV delivery (Example 1) is very similar to the biodistribution of GFP under CNS-8 control at high doses during ICV and IV delivery (Example 2).
[0336] Similarly, as Figure 3B , Figure 5B and Figure 13A As shown, in coronal sections, during ICV delivery, at both high and low magnifications, the biodistribution of GFP under CNS-8 (SEQ ID NO:26) control at low doses was very similar to that under CNS-8 control at high doses.
[0337] like Figure 4B , Figure 6B and Figure 13B As shown, in coronal sections, during IV delivery, at both high and low magnifications, the biodistribution of GFP under CNS-8 (SEQ ID NO:26) control at low doses was very similar to that under CNS-8 control at high doses.
[0338] Similarly, as Figure 7B , Figure 8B and Figure 14AAs shown, in both ICV and IV delivery, GFP expression in the midbrain under CNS-8 (SEQ ID NO:26) control was very similar to that under CNS-8 (SEQ ID NO:26) control in the high-dose administration. Quantification of GFP-positive dopaminergic neurons also supports this, showing no difference in the percentage of GFP-positive dopaminergic neurons between low and high doses in both ICV and IV delivery. Figure 14B As shown. Therefore, there was no overall difference in GFP expression under the control of the CNS-8 promoter (SEQ ID NO:26) between low and high doses, indicating that low doses were sufficient to show GFP expression in dopaminergic neurons, and increasing the dose did not lead to higher GFP expression. Appropriately, the lowest dose that shows the desired expression pattern is likely preferred.
[0339] Comparing the biodistribution of transgenic GFP under CNS-8 (SEQ ID NO:26) control in different tissues, it was found that dose affected GFP expression when administered at low or high doses. In the liver, GFP expression was very similar with different doses of ICV delivery, but lower with low doses of IV delivery. In the heart, no GFP expression was detected with low doses of either ICV or IV delivery, while GFP expression was detected with high doses of IV delivery. Similarly, in skeletal muscle, no GFP expression was detected with low doses of either ICV or IV delivery, while GFP expression was detected with high doses of both ICV and IV delivery. However, in the spleen, higher GFP expression was detected with low doses of both IV and ICV delivery compared to high doses. Similarly, in the kidney, higher GFP expression was detected with low doses of both IV and ICV delivery compared to high doses. These data suggest that administration of different doses of viral genome may lead to different expression patterns and levels in tissues outside the CNS.
[0340] Therefore, changing the dosage does not alter the expression and level of GFP in the CNS, but it does change the expression pattern and level in tissues outside the CNS. Thus, it is possible to find an optimal dosage based on the required expression pattern and level in tissues outside the CNS, while maintaining the expression pattern and level in the CNS. For example, if activity in the CNS, as well as in the liver, spleen, and kidneys, is required, a low dose can be administered via ICV or IV. Alternatively, if activity in the CNS, as well as at least in the heath and skeletal muscle, is required, a high dose can be administered via IV delivery.
[0341] Example 3
[0342] Tissue expression patterns of the faf1 and pitx3 genes were investigated in a single-cell transcriptome dataset, with CRE / proximal promoters from CNS-5, CNS-5_v2, CNS-2, CNS-3, and CNS-4 designed from these genes (Zeisel et al., 2018). Due to their proximity to genes, CRE / proximal promoters are expected to assist in gene regulation (He et al., 2014). Providing information on the regulation of expression of nearby genes by CRE / proximal promoters offers an indication of the possible expression patterns of synthetic promoters containing CRE / proximal promoters.
[0343] The single-cell transcriptome dataset (Zeisel et al., 2018) contains single-cell RNA sequencing from 500,000 cells of any cell type from the adult mouse CNS and PNS. This resource is publicly available at mousebrazilin.org / genesearch.html and provides a useful tool for determining the probable expression of the synthetic promoters CNS-5, CNS-5_v2, CNS-2, CNS-3, and CNS-4 in the PNS. Adding genes that design CRE / proximal promoters for CNS-5, CNS-5_v2, CNS-2, CNS-3, and CNS-4 to the webtool... Figure 16A and 16B The expression patterns of the faf1 and pitx3 genes are shown in the figure. The gray gradient represents the intensity of RNA expression detected in the database (Zeisel et al., 2018). faf1 is expressed in many PNS neurons, therefore synthetic promoters containing CREs or proximal promoters designed from the faf1 gene, such as CNS-5 and CNS-5_v2, are expected to be strongly expressed in the PNS. pitx3 is expressed in sympathetic PNS neurons, therefore synthetic promoters containing CREs designed from the pitx3 gene, such as CNS-2, CNS-3, or CNS-4, are expected to be expressed in sympathetic PNS neurons. Similar analysis of lmx1b and pitx2 showed no expression in the PNS, exceeding the cutoff score of the analysis (trinization score less than 0.95; data not shown), so CNS-1, CNS-6, CNS-6_v2, CNS-7, CNS-7_v2, CNS-8, and CNS-8_v2 are not expected to be active in PNS neurons.
[0344] References
[0345] Boussicault,L.et al.(2016)‘CYP46A1,the rate-limiting enzyme forcholesterol degradation,is neuroprotective in Huntington’s disease’,Brain,139(3),pp.953–970.doi:10.1093 / brain / awv384.
[0346] Djelti,F.et al.(2015)‘CYP46A1 inhibition,brain cholesterolaccumulation and neurodegeneration pave the way for Alzheimer’s disease’,Brain,138(8),pp.2383–2398.doi:10.1093 / brain / awv166.
[0347] Hammond,S.L.et al.(2017)‘Cellular selectivity of AAV serotypes forgene delivery in neurons and astrocytes by neonatal intracerebroventricularinjection’,PLoS ONE,12(12),pp.1–22.doi:10.1371 / journal.pone.0188830.
[0348] He,B.et al.(2014)‘Global view of enhancer-promoter interactome inhuman cells’,Proceedings of the National Academy of Sciences of the UnitedStates of America,111(21).doi:10.1073 / pnas.1320308111.
[0349] Jakobsson,J.and Lundberg,C.(2006)‘Lentiviral vectors for use in thecentral nervous system’,Molecular Therapy.The American Society of GeneTherapy,13(3),pp.484–493.doi:10.1016 / j.ymthe.2005.11.012.
[0350] Kacher,R.et al.(2019)‘CYP46A1 gene therapy deciphers the role ofbrain cholesterol metabolism in Huntington’s disease’,Brain:a journal ofneurology,142(8),pp.2432–2450.doi:10.1093 / brain / awz174.
[0351] Kim,Ji-Yoen;Ash,Ryan T.;CAballos-Diaz;CArolina,Levites,Yona;Golde,Todd E.;Smirnakis,Stelios M.;Jankowsky,J.L.(2013)‘Viral transduction of theneonatal brain delivers controllable genetic mosaicism for visualizing andmanipulating neuronal circuits in vivo’,European Journal of Neuroscience,37(8),pp.1203–1220.doi:10.1111 / ejn.12126.Viral.
[0352] Tanguy,Y.et al. (2015) 'Systemic AAVrh10 provides higher transgene expression than AAV9 in the brain and the spinal cord of neonatal mice', Frontiers in Molecular Neuroscience, 8(JULY), pp.1–10.doi:10.3389 / fnmol.2015.00036.
[0353] Zeisel,A.et al.(2018)'Molecular Architecture of the Mouse NervousSystem',Cell,174(4),p.999–1014.e22.doi:10.1016 / j.cell.2018.06.021.
[0354] Sequence information
[0355] Table 1 – CNS-specific promoters
[0356]
[0357]
[0358]
[0359]
[0360]
[0361]
[0362]
[0363]
[0364]
[0365]
[0366]
[0367] Table 2. Cis-regulatory elements (CREs) included in the promoters in Table 1
[0368]
[0369]
[0370]
[0371]
[0372] Table 3 – Minimal / Proximal Promoters Included in the Promoters in Table 1
[0373]
[0374]
[0375] Table 4 – Overview of synthesized CNS-specific promoters
[0376]
[0377]
[0378] Synapsin-1 (SEQ ID NO:14)
[0379] GAGGGCCCTGCGTATGAGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGGGTGGGGGTGCCTACCTGACGACCGACCCCGACCCACTGGACAAGCACCCAACCCCCATTCCCCAAATTGCGCATCCCCTATCAGAGAGGGGGAGGGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGCGGACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGCCAC CGCCGCCTCAGCACTGAAGGCGCGCTGACGTCACTCGCCGGTCCCCCGCAAACTCCCTTCCGGCCACCTTGGTCGCGTCCCGCGCCGCCGCCGGCCCAGCCGGACCGCACCACGCGAGGCGCGAGATAGGGGGGCACGGGCGCGACCATCTGCCGCTGCGGCGCCGGCGACTCAGCGCTGCCTCAGTCTGCGGTGGGCAGCGGAGGAGTCGTGTCGTGCCTGAGAGCGCAGTCG sequence list <110> Asco Biotech <120> Regulatory nucleic acid sequences <130> P266016WO <150> GB2005732.9 <151> 2020-04-20 <160> 31 <170> PatentIn version 3.5 <210> 1 <211> 696 <212> DNA <213> Artificial sequence <220> <223> CNS-1 promoter <400> 1 ctgggcagag agggggcatc gggggcatgg ctaggggcca gcactgtgct tcctgggcgc 60 ctcacctcct ccctgactcc tggagactcc cagcccctgt ctgggagatg agcatttagg 120 aatctgcttg tgcaggggtg gtgggagggg ccggggtgga gggcgcatcc ccacggggag 180 attggatgga aatggcctgc cagtgtgtgt gtgagtgtgc gcctgtggca gcagcagagt 240 aaacagccgc tgccctgtcc tctctgcggc cgtggccagg tacacaggcc tgtttggaca 300 gctgccttgt ctgtccgtct gtttgggaga tgctggctga tagatgggga tgggcggact 360 gttaacccct cgttgcctgc actgctatgt gcttcctgcc tcatccatgg ggtagaaggt 420 agccagaagg tggtcctggc tgtgccccca gctcctctct aggggggaaa cctctagttc 480 tgagtcaggg acagagtgag gagggctcca gggcatcaag agcttgctcc tccccgcacc 540 agggagccaa ggacagagga gaagggggtc ttccccagtg gtgactaggg gcagaatatg 600 tctctgagtg agtgtctgga gccctcctca ccccaacacc atggggctgg gcataaaagt 660 cagggcagag ccatctattg cttacatttg cttctg 696 <210> 2 <211> 709 <212> DNA <213> Artificial Sequence <220> <223> CNS-2 Promoter <400> 2 ggtgtgtgga agggtgagag gcacacacac agacactgaa agaatcctag gcctggtagg 60 cacttaacaa atgtctgtta cagaccagaa ttttattgct gttagagacc caagcccctc 120 ataggaacag tgagaaacag gtgcagaaag gcggagtaac tttatctaaa gtcataggct 180 ccctgaatag cagagctgac acctacaagg aagcgttgga gaccagatct accagctagc 240 ctccctgaga ccacgaggtg gcgccgcagc accggctgtg gccgatgcca gccaggtagc 300 cggtttccca cgtcccccgc acgcacgcac ctctttgctg caggaatccc gggctgcccc 360 gacctggagt agggggggtg gtgagtggga ctgagtccct agaagcctgg accctcactt 420 cgttcctgta catccagctc gcctgtagac agtgggggag gatgaaggga agaggactca 480 agcgcaactt tgaatcatca cgccttcgac agtccgcgca cgtttatttc atttatcttt 540 gaaaacgagg gaggggaagc ctggagaagg cgggatgggc caagggtgag ttggcccccg 600 gggagctggt ccctgttcct ggctttagtc ccaggggcgc ggtctgtgtg tagggcgggc 660 tgggcataaa agtcagggca gagccatcta ttgcttacat ttgcttctg 709 <210> 3 <211> 768 <212> DNA <213> Artificial Sequence <220> <223> CNS-3 Promoter <400> 3 tgctaccaga gccgggagag ctgctcggag acgcctccgg ggtgcgggct ggacatgagc 60 agcggctgcc ggtcctggga ctaggccccg ccattttgga tccgctgaca ggtcagcgaa 120 gtctcttcct agagttccgg tgtcgtgaag gccgccctga catcgcaata gggaattagt 180 gggaagggcc cttaaattgg gcgagccaag gtggggggag gattggaaca gagacaaaag 240 ggaggagaga cggacagcga caagtggaga aaatcggcga aacttgagtg gcagagaagt 300 ctgagcgctg agacccggcg gccccgtgcg ccttcccacc tggcgccgat ccactttcct 360 cggggtagcg gcccaaccca cttcgctgcc agccgatccc ttttacccgt ggctaccggg 420 accactctac tctcgcccac ttggctctgc ctaagcgtcc tagccggagc gcggtctctg 480 ccacgtgggg aggggcgcgg ccgagttgct gaagagcgct tctgattggc cagagggcgg 540 ggttcttggc gtctcgccgg ccagacccct ccctcaaagg cggggcctgg agatccacag 600 ctggaaaggg cggagcccca gcagggcagc tggaaagggg cggggcctga cgcgcgcggc 660 tcgccgcggc gggctggggg cgccctggtc tgccataaag tgaatgggcg ccggctgggg 720 gtggcagtac gcggtgaggc tcactccctc cgagagtcca ggagcgcc 768 <210> 4 <211> 736 <212> DNA <213> Artificial sequence <220> <223> CNS-4 promoter <400> 4 aaggagaatg gtaaacagca ggagcgaagc ggctgaggag aaagaagagg aaagaaaggc 60 gagacgtggg aggattggaa cagagacaaa agggaggaga gacggacagc gacaagtgga 120 gaaaatcggc gaaacttgag tggcagagaa gtctgagcgc tgagacccgg cggccccgtg 180 cgccttccca cctggcgccg atccactttc ctcggggtag cggcccaacc cacttcgctg 240 ccagccgatc ccttttaccc gtggctaccg ggaccactct actctcgccc acttggctct 300 gcctaagcgt cctagccgga gcgcggtctc tgccacgtgg ggaggggcgc ggccgagttg 360 ctgaagagcg cttctgattg gccagagggc ggggttcttg gcgtctcgcc ggccagaccc 420 ctccctcaaa ggcggggcct ggagatccac agctggaaag ggcggagccc cagcagggca 480 gctggaaagg ggcggggcct gacgcgcgcg gctcgccgcg gcgggctggg ggcgccctgg 540 tctgccataa agtgaatggg cgccggctgg gggtggcagt acgcggtgag gctcactccc 600 tccgagagtc caggagcgcc cgagcggaga ggcggcccgg gagcaggggg gcggccccca 6�0 ctccggccgg gtgcccggcc cctggcccct gcctgccctc tagatcgccg ccgcagccgc 720 cgctactggg agtctg 736 <210> 5 <211> 1744 <212> DNA <213> Artificial Sequence <220> <223> CNS-5 v2 Promoter <400> 5 ttgtaatggg aataagggca ggactcctgg gtataagtag ctcagctgat cccaccctgc 60 ttctatgtgt taattcattt attcattcat tcaacaagca tttgttgaaa tgctctttgt 120 gtcaggctca gcaggaagca gtggcaataa aatggtgaac aagaaagact cggggtttct 180 tcatctatgt tgatgtctgc agagaacagt atcagccttc taggaagttt gtaatcagat 240 acattgttag agagatactt atctagtaaa ttcctactca tcctataagg ctcaaaacaa 300 atgcctctat gaaaccttcc gtgattccct caggcagagt taagagcttc cttcctggg 360 cctctatctc cttccattag tattataact gtttaccagt ttcccctcta gactaaattt 420 ctcaaaagag agaatgaggt ctctttcagt cttctttgca tctttaaact agcctgggtc 480 ccagcctgtt tgatgaaaga aacaagaaca ctgatacaag ccacagcccc ttggcaaaaa 540 agatacccaa tagcaatggc aatgtaaaat cagttttagt aaatgaatca agaattctga 600 tgctttaggg aaagtaatgt gaacctggca ccattaacaa attcagaact cttcttctta 660 ggagctctct aactgaacag acagagggat gtcaacccct aattcagctt gatcgtatct 720 cagcaacac atttaatgag acagtgggaa aaagagagct gtccactttt aaatcagcat 780 atttctaact aaacaatggc aatggctaaa tctttaaaat gcctatttct ctcaagaaca 840 ctgcaatgga acatttagac tttgggaag agattagtga tttacattgc tatctcactg 900 atttaattta atgctctc siaccaaac acacatgtgc cgaagaggct actaagaac 960 ccaacatgca gagttctcta taagtgcagc cgacagtgtt gactgaact aaacttggaa 1020 atccagggca ctaatgcaca atcagca ataaacggc atctctttgg caatattaa 1080 tttaaaaaag agaagaga caggcaga tcaggcactg tctgttttgg caggcacc 1140 attctgcatt tcaaagcatt gtccctgca atatccaggt tactgtgcta gatctcgac 1200 tattatatcg cagttgtgag agggaggggca aagatgtgtt tactcagtga ttaggccctt 1260 agaataagcc tctagctcct agagacag ctcatcht attcattttgg gccattcc 1320 aaagcctagg agattaaac atccatgctg agagacaag cgaatgcaga cggtgaaaaa 1380 gaaataaaaa ttctttaaaa actctgagat gactcatta ttttccaca aggaacttt 1440 aggaaagtgt ttagttagag aaaaacccac attgacctct ctctaaaccc ttaatctttc 1500 ctttgtggtg gcactgcttt gtggtaagcg actggctcgc ctcgcccctc ttttcactgg 1560 aagctgagag aaaaaagact ctggagaaac agttttcgtt ccagggacac aaacccctga 1620 cactgttaaa catgagatgc caggaaaaca cacttaaaaa aaaaattccc actttaagct 1680 ttagactgaa tgtgagaaag gagatgataa aaagagtatc acaagagaat cttcaggctg 1740 tggg 1744 <2:10> 6 <2:11> 1104 <2:12> DNA <2:13> Artificial Sequence <2:20> <2:23> CNS-6 v2 Promoter <4:00> 6 tttggcactg tgagcagttt acttgacaaa ttctgtcaaa tatttgcttt ctgaaatctc 60 gagaattggt tgaatataat tgtacttaat gtttgcaaaa taaataaata tgggactaag 120 gacgttctat cattaatttg tcagaaaaga gagttgtcat ttctgaaaat ttaatgtcat 180 tgaagctcta tttccaatag caaaggagca ctattgctaa tagacttcag agcttgaaat 240 aaataaatct ttggaatcct gttgcatctc ttggggtgtg acatttgaca gtcttttata 300 gcacagaacg aaacaagttt gtgagctgga attcaattgt ggcgtattga ttccttgcat 360 cagtcattat tccctgctga ttgacaggtg aaaattggtt acgttaagta tttcatatgt 420 tatattggct gacatttgct tgcctgctct tgtgtcaata ttgttgtaaa gatctccagc 480 tttatgagat agcaatagac actgactgtg gcttttgtgt gatgttccag tgtttttcct 540 gacataattt aagacatatt aaaaaccagc agcatcttcc ctcttgagaa gcttaatgcc 600 aatattattg tcttccaggg gaagatcatg tatgctcata atcgggtgct aatttccacc 660 agtacgctca tgtttaggca ttaggcacta taactgtaaa attgagcctt cttgattgat 720 tcatgtcaag cctcatctcg gctcctgcag gggaagtcat ccggctgacc ctttttacac 780 taaaagaaga gatttgtgtt cctttctttc acctggaacc atcaaattga ctgaataatc 840 tgtaatacat tagtgctgac atttgttagg gagaattaaa caagacacag taatcattcc 900 ccagaataaa aattgtgttt gatttccagc agagttctat taaagggagg acagaatctg 960 tctcttccaa ggtggaaaat cgtgaatatt ccctgcatta atgaaccaag ttaacacttt 1020 aattgcttat agaaccgagt tctccaatga cagcattaaa agatagggag gctctgattt 1080 atggtcaaca cagatttgta accc 1104 <210> 7 <211> 1910 <212> DNA <213> Artificial sequence <220> <223> CNS-7 v2 promoter <400> 7 tcaacatgga taaccaaagt tcttaaaact acgctttcaa tgaacacata tcctttgagc 60 aagactaata atgaggaatg ggagccagct cctgtgatat ttatgcaact actaaattct 120 cactgaagtc aatgggagtt tgcttacgta agggctgcaa actttagcct ccagagatta 180 aaggggaaaa aaatccttaa actctttcaa cattaatatt gcctgtaagg aatccagcca 240 tgacctaagc catggagctt tctgaaccta gcaagtagaa gggtaaacag taaacaccag 300 ttattttaag cacaatctaa tcagagttca atgagaagca atattatatt tgatctctaa 360 ggtattaata cttgtatatc actattagac atctttatgt agtccattat ccaaacaatg 420 gcttaagtct gtggtattta ataaatcaag tttccatggc cgtgagactg agtgggagtg 480 gggatgaagc cttttttctt catttttt tcctcaggtg cattctgtg ttatataag 540 agaagtgtgg ccttccttct catagcacta aaagtgagat aatccctgtg taagaaatca 600 gtaagtacgg tctgcttaat ctagtcccag tgtgaaactg ttgacattg ttctttttc 660 tatcattatg tgactgggcc tgtttgtgc tggattaggc acaaatctcc tatgcagcac 720 atttggcatg ttactagtag tttaacttca ttaataatgt atgagaaaa tgtaatccat 780 gawaggaag haaagaaag tattttttttttttttgct tctcccaat cctttggaat 840 gagtattat tcacatttt atgtttg ttatattt cattcact tccatagtga 900 tatttaaaaa agaactttg gcaatgctt gcaaaaaca caccttttac aattttaat 960 gtgatttact gatggccaga acttgttaaa catagtagga aattaataat ttattcatct 1020 tattcattt tcaggccgt aaacgctcct tctgagtcat tcccaataac aagaatttct 1080 accagtaaag ctattaacag gcatcaaat aggggagtgc taattaaga tgagattgta 1140 aaagcaaata agaacatacg cagactcgca taggagtgca atgatcgtt tctgattgaa 1200 atgtttatag ctaaatgagt ttggctgaat taaacacaaa tgttccaaaa gataagccgt 1260 agctggtgct tcttttttct gttttttaag ctgctttaca gacgaaaatg gaactatatt 1320 tggaacaatg cttctgttt ttccatacta ttgatatttg tggaaagtca caaaatggcc 1380 taaggaagct aagctcgccc caagcagtgg tcacttacaa gtactttgtgt actctgtact 1440 cctgtcacat ttgggcgatc agagcaacag ctggggagac ttttcaaca aagatgagtg 1500 tcagataatc ctgatgagat tccacatcca acatcttttg taattatgtc acattcagct 1560 gtaatggaat aattcaagct gaaagaacaa gctttgatcc tttcttaaac ctttccctgt 1620 ggactggcta tctaaaagat ttaaagatat ttctgttaca agatctagtg tttcctcaga 1680 gaagtcatgc ttctgaagca tcgtgatcta caagaacaat atcaagtttg ccaaacacat 1740 ttctgaaagc atcgtgtttt ggggggaggg gttgtattta atgaagatat caataatatg 1800 ctatgcttca atttcatct aggtgatcaa gattcatttt cttgttctgt catccaaata 1860 ggcagacaga aaagtgattg aaatacatta tggagatgtg tcattgcaca 1910 <210> 8 <211> 540 <212> DNA <213> Artificial sequence <220> <223> CNS-8 v2 promoter <400> 8 gctggtgctt cttttttctg ttttttaagc tgctttacag acgaaaatgg aactatattt 60 ggaacaatgc tttctgtttt tccatactat tgatatttgt ggaaagtcac aaaatggcct 120 aaggaagcta agctcgcccc aagcagtggt cacttacaag tacttttgta ctctgtactc 180 ctgtcacatt tgggcgatca gagcaacagc tggggagact ttttcaacaa agatgagtgt 240 cagataatcc tgatgagatt ccacatccaa catcttttgt aattatgtca cattcagctg 300 taatggaata attcaagctg aaagaacaag ctttgatcct ttcttaaacc tttccctgtg 360 gactggctat ctaaaagatt taaagatatt tctgttacaa gatctagtgt ttcctcagag 420 aagtcatgct tctgaagcat cgtgatctac aagaacaata tcaagtttgc caaacacatt 480 tctgaaagca tcgtgttttg gggggagggg ttgtatttaa tgaagatatc aataatatgc 540 <210> 9 <211> 643 <212> DNA <213> Artificial sequence <220> <223> CRE0004_Lmx1b <400> 9 ctgggcagag agggggcatc gggggcatgg ctaggggcca gcactgtgct tcctgggcgc 60 ctcacctcct ccctgactcc tggagactcc cagcccctgt ctgggagatg agcatttagg 120 aatctgcttg tgcaggggtg gtgggagggg ccggggtgga gggcgcatcc ccacggggag 180 attggatgga aatggcctgc cagtgtgtgt gtgagtgtgc gcctgtggca gcagcagagt 240 aaacagccgc tgccctgtcc tctctgcggc cgtggccagg tacacaggcc tgtttggaca 300 gctgccttgt ctgtccgtct gtttgggaga tgctggctga tagatgggga tgggcggact 360 gttaacccct cgttgcctgc actgctatgt gcttcctgcc tcatccatgg ggtagaaggt 420 agccagaagg tggtcctggc tgtgccccca gctcctctct aggggggaaa cctctagttc 480 tgagtcaggg acagagtgag gagggctcca gggcatcaag agcttgctcc tccccgcacc 540 agggagccaa ggacagagga gaagggggtc ttccccagtg gtgactaggg gcagaatatg 600 tctctgagtg agtgtctgga gccctcctca ccccaacacc atg 643 <210> 10 <211> 656 <212> DNA <213> Artificial Sequence <220> <223> CRE0003_Pitx3 <400> 10 ggtgtgtgga agggtgagag gcacacacac agacactgaa agaatcctag gcctggtagg 60 cacttaacaa atgtctgtta cagaccagaa ttttattgct gttagagacc caagcccctc 120 ataggaacag tgagaaacag gtgcagaaag gcggagtaac tttatctaaa gtcataggct 180 ccctgaatag cagagctgac acctacaagg aagcgttgga gaccagatct accagctagc 240 ctccctgaga ccacgaggtg gcgccgcagc accggctgtg gccgatgcca gccaggtagc 300 cggtttccca cgtcccccgc acgcacgcac ctctttgctg caggaatccc gggctgcccc 360 gacctggagt agggggggtg gtgagtggga ctgagtccct agaagcctgg accctcactt 420 cgttcctgta catccagctc gcctgtagac agtgggggag gatgaaggga agaggactca 480 agcgcaactt tgaatcatca cgccttcgac agtccgcgca cgtttatttc atttatcttt 540 gaaaacgagg gaggggaagc ctggagaagg cgggatgggc caagggtgag ttggcccccg 600 gggagctggt ccctgttcct ggctttagtc ccaggggcgc ggtctgtgtg tagggc 656 <210> 11 <211> 215 <212> DNA <213> Artificial sequence <220> <223> CRE0002_Gbf1 <400> 11 tgctaccaga gccgggagag ctgctcggag acgcctccgg ggtgcgggct ggacatgagc 60 agcggctgcc ggtcctggga ctaggccccg ccattttgga tccgctgaca ggtcagcgaa 120 gtctcttcct agagttccgg tgtcgtgaag gccgccctga catcgcaata gggaattagt 180 gggaagggcc cttaaattgg gcgagccaag gtggg 215 <210> 12 <211> 53 <212> DNA <213> Artificial sequence <220> <223> SYNP_CRE151 <400> 12 gggctgggca taaaagtcag ggcagagcca tctattgctt acatttgctt ctg 53 <210> 13 <211> 553 <212> DNA <213> Artificial sequence <220> <223> CRE0001v1_Pitx3 <400> 13 gggaggattg gaacagagac aaaagggagg agagacggac agcgacaagt ggagaaaatc 60 ggcgaaactt gagtggcaga gaagtctgag cgctgagacc cggcggcccc gtgcgccttc 120 ccacctggcg ccgatccact ttcctcgggg tagcggccca acccacttcg ctgccagccg 180 atccctttta cccgtggcta ccgggaccac tctactctcg cccacttggc tctgcctaag 240 cgtcctagcc ggagcgcggt ctctgccacg tggggagggg cgcggccgag ttgctgaaga 300 gcgcttctga ttggccagag ggcggggttc ttggcgtctc gccggccaga cccctccctc 360 aaaggcgggg cctggagatc cacagctgga aagggcggag ccccagcagg gcagctggaa 420 aggggcgggg cctgacgcgc gcggctcgcc gcggcgggct gggggcgccc tggtctgcca 480 taaagtgaat gggcgccggc tgggggtggc agtacgcggt gaggctcact ccctccgaga 540 gtccaggagc gcc 553 <210> 14 <211> 467 <212> DNA <213> Artificial sequence <220> <223> Synapsin-1 <400> 14 gagggccctg cgtatgagtg caagtgggtt ttaggaccag gatgaggcgg ggtgggggtg 60 cctacctgac gaccgacccc gacccactgg acaagcaccc aacccccatt ccccaaattg 120 cgcatcccct atcagagagg gggaggggaa acaggatgcg gcgaggcgcg tgcgcactgc 180 cagcttcagc accgcggaca gtgccttcgc ccccgcctgg cggcgcgcgc caccgccgcc 240 tcagcactga aggcgcgctg acgtcactcg ccggtccccc gcaaactccc cttcccggcc 300 accttggtcg cgtccgcgcc gccgccggcc cagccggacc gcaccacgcg aggcgcgaga 360 taggggggca cgggcgcgac catctgcgct gcggcgccgg cgactcagcg ctgcctcagt 420 ctgcggtggg cagcggagga gtcgtgtcgt gcctgagagc gcagtcg 467 <210> 15 <211> 20 <212> DNA <213> Artificial sequence <220> <223> GFP forward primer <400> 15 ggcacaagct ggagtacaac 20 <210> 16 <211> 20 <212> DNA <213> Artificial sequence <220> <223> GFP reverse primer <400> 16 agttcacctt gatgccgttc 20 <210> 17 <211> 25 <212> DNA <213> Artificial sequence <220> <223> GFP probe <220> <221> misc_feature <222> (1)..(1) <223> FAM <400> 17 agccacaacg tctatatcat ggccg 25 <210> 18 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Mouse GAPDH forward primer <400> 18 acggcaaatt caacggcac 19 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Mouse GAPDH reverse primer <400> 19 tagtggggtc tcgctcctgg 20 <210> 20 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Mouse GAPDH probe <220> <221> misc_feature <222> (1)..(1) <223> VIC <400> 20 ttgtcatcaa cgggaagccc atca 24 <210> twenty one <211> 974 <212> DNA <213> Artificial sequence <220> <223> CNS-1 + CMV-IE UTR and introns <400> twenty one ctgggcagag agggggcatc gggggcatgg ctaggggcca gcactgtgct tcctgggcgc 60 ctcacctcct ccctgactcc tggagactcc cagcccctgt ctgggagatg agcatttagg 120 aatctgcttg tgcaggggtg gtgggagggg ccggggtgga gggcgcatcc ccacggggag 180 attggatgga aatggcctgc cagtgtgtgt gtgagtgtgc gcctgtggca gcagcagagt 240 aaacagccgc tgccctgtcc tctctgcggc cgtggccagg tacacaggcc tgtttggaca 300 gctgccttgt ctgtccgtct gtttgggaga tgctggctga tagatgggga tgggcggact 360 gttaacccct cgttgcctgc actgctatgt gcttcctgcc tcatccatgg ggtagaaggt 420 agccagaagg tggtcctggc tgtgccccca gctcctctct aggggggaaa cctctagttc 480 tgagtcaggg acagagtgag gagggctcca gggcatcaag agcttgctcc tccccgcacc 540 agggagccaa ggacagagga gaagggggtc ttccccagtg gtgactaggg gcagaatatg 600 tctctgagtg agtgtctgga gccctcctca ccccaacacc atggggctgg gcataaaagt 660 cagggcagag ccatctattg cttacatttg tcagatcgcc tggagacgcc atccacgctg 720 ttttgacctc catagaagac accgggaccg atccagcctc cgcggccggg aacggtgcat 780 tggaacgcgg attccccgtg ccaagagtga cgtaagtacc gcctatagac tctataggca 840 cacccctttg gctcttatgc atgaacggtg gagggcagtg tagtctgagc agtactcgtt 900 gctgccgcgc gcgccaccag acataatagc tgacagacta acagactgtt cctttccatg 960 ggtcttttct gcag 974 <210> 22 <211> 868 <212> DNA <213> Artificial sequence <220> <223> CNS-4 + CMV-IE UTR and intron <400> 22 aaggagaatg gtaaacagca ggagcgaagc ggctgaggag aaagaagagg aaagaaaggc 60 gagacgtggg aggattggaa cagagacaaa agggaggaga gacggacagc gacaagtgga 120 gaaaatcggc gaaacttgag tggcagagaa gtctgagcgc tgagacccgg cggccccgtg 180 cgccttccca cctggcgccg atccactttc ctcggggtag cggcccaacc cacttcgctg 240 ccagccgatc ccttttaccc gtggctaccg ggaccactct actctcgccc acttggctct 300 gcctaagcgt cctagccgga gcgcggtctc tgccacgtgg ggaggggcgc ggccgagttg 360 ctgaagagcg cttctgattg gccagagggc ggggttcttg gcgtctcgcc ggccagaccc 420 ctccctcaaa ggcggggcct ggagatccac agctggaaag ggcggagccc cagcagggca 480 gctggaaagg ggcggggcct gacgcgcgcg gctcgccgcg gcgggctggg ggcgccctgg 540 tctgccataa agtgaatggg cgccggctgg gggtggcagt acgctcagat cgcctggaga 600 cgccatccac gctgttttga cctccataga agacaccggg accgatccag cctccgcggc 660 cgggaacggt gcattggaac gcggattccc cgtgccaaga gtgacgtaag taccgcctat 720 agactctata ggcacacccc tttggctctt atgcatgaac ggtggagggc agtgtagtct 780 gagcagtact cgttgctgcc gcgcgcgcca ccagacataa tagctgacag actaacagac 840 tgttcctttc catgggtctt ttctgcag 868 <210> 23 <211> 835 <212> DNAttaaatgctc ttccaaacca aacacacatg tgccgaagag gctactaaga aacccaacat 120 gcagagttct ctataagtgc agccgacagt gttgactgaa actaaacttg gaaatccagg 180 gcactaatgc acaatatcaa gcaataaaac ggcatctctt tggcaatatt taatttaaaa 240 aagaagaaag agacaggcga agatcaggca ctgtctgttt tggaggatca accattctgc 300 atttcaaagc attggtccct gcaatatcca ggttactgtg ctagaatctc gactattata 360 tcgcagttgt gagagggagg gcaaagatgt gtttactcag tgattaggcc cttagaataa 420 gccttagct cctagagaga cagctcacca cttattcatt tgggccaatt cacaaagcct 480 aggaagatta aacatccatg ctgagaagac aagcgaatgc agacggtgaa aaagaaataa 540 aaattcttta aaaactctga gatgacttca ttatttttcc acaaggaaac tttaggaaag 600 tgttagtta gagaaaacc cacattgacc tctctctaaa cccttaatct ttcctttgtg 660 gtggcactgc tttgtggtaa gcgactggct cgcctcgccc ctcttttcac tggaagctga 720 gagaaaaaag actctggaga aacagttttc gttccaggga cacaaacccc tgacactgtt 780 aagggctggg cataaaagtc agggcagagc catctattgc ttacatttgc ttctg 835 <210> 24 <211> 812 <212> DNA <213> Artificial sequence <220> <223> CNS-6 promoter <400> 24 gaaaatttaa tgtcattgaa gctctatttc caatagcaaa ggagcactat tgctaataga 60[[ID=!7]] cttcagagct tgaaataaat aaatctttgg aatcctgttg catctcttgg ggtgtgacat 120 ttgacagtct tttatagcac agaacgaaac aagtttgtga gctggaattc aattgtggcg 180 tattgattcc ttgcatcagt cattattccc tgctgattga caggtgaaaa ttggttacgt 240 taagtatttc atatgttata ttggctgaca tttgcttgcc tgctcttgtg tcaatattgt 300 tgtaaagatc tccagcttta tgagatagca atagacactg actgtggctt ttgtgtgatg 360 ttccagtgtt tttcctgaca taatttaaga catattaaaa accagcagca tcttccctct 420 tgagaagctt aatgccaata ttattgtctt ccaggggaag atcatgtatg ctcataatcg 480 ggtgctaatt tccaccagta cgctcatgtt taggcattag gcactataac tgtaaaattg 540 agccttcttg attgattcat gtcaagcctc atctcggctc ctgcagggga agtcatccgg 600 ctgacccttt ttacactaaa agaagagatt tgtgttcctt tctttcacct ggaaccatca 660 aattgactga ataatctgta atacattagt gctgacattt gttagggaga attaaacaag 720 acacagtaat cattccccag aataaaaatt gtgtttgatg ggctgggcat aaaagtcagg 780 gcagagccat ctattgctta catttgcttc tg 812 <210> 25 <211> 487 <212> DNA <213> Artificial sequence <220> <223> CNS-7 promoter <400> 25 tgagactgag tgggagtggg gatgaagcct tttttcttca tttttttttc ctcaggtgca 60 attctgtgtt aatataagag aagtgtggcc ttccttctca tagcactaaa agtgagataa 120 tccctgtgta agaaatcagt aagtacggtc tgcttaatct agtcccagtg tgaaactgtt 180 gacatttgtt cttttttcta tcattatgtg actgggcctg ttttgtgctg gattaggcac 240 aaatctccta tgcagcacat ttggcatgtt actagtagtt taacttcatt aataatgtat 300 gaagaaaatg taatccatga caaggaagca aagaaaagta tttttttttt tttttgcttc 360 tcccaaatcc tttggaatga gtaattattc aacattttat gtttgatgtt atattttaca 420 attcaacttc catagggctg ggcataaaag tcagggcaga gccatctatt gcttacattt 480 gcttctg 487 <210> 26 <211> 593 <212> DNA <213> Artificial sequence <220> <223> CNS-8 promoter <400> 26 gctggtgctt cttttttctg ttttttaagc tgctttacag acgaaaatgg aactatattt 60 ggaacaatgc tttctgtttt tccatactat tgatatttgt ggaaagtcac aaaatggcct 120 aaggaagcta agctcgcccc aagcagtggt cacttacaag tacttttgta ctctgtactc 180 ctgtcacatt tgggcgatca gagcaacagc tggggagact ttttcaacaa agatgagtgt 240 cagataatcc tgatgagatt ccacatccaa catcttttgt aattatgtca cattcagctg 300 taatggaata attcaagctg aaagaacaag ctttgatcct ttcttaaacc tttccctgtg 360 gactggctat ctaaaagatt taaagatatt tctgttacaa gatctagtgt ttcctcagag 420 aagtcatgct tctgaagcat cgtgatctac aagaacaata tcaagtttgc caaacacatt 480 tctgaaagca tcgtgttttg gggggagggg ttgtatttaa tgaagatatc aataatatgc 540 gggctgggca taaaagtcag ggcagagcca tctattgctt acatttgctt ctg 593 <210> 27 <211> 284 <212> DNA <213> Artificial sequence <220> <223> CMV-IE 5' UTR and intron <400> 27 tcagatcgcc tggagacgcc atccacgctg ttttgacctc catagaagac accgggaccg 60 atccagcctc cgcggccggg aacggtgcat tggaacgcgg attccccgtg ccaagagtga 120 cgtaagtacc gcctatagac tctataggca cacccctttg gctcttatgc atgaacggtg 180 gagggcagtg tagtctgagc agtactcgtt gctgccgcgc gcgccaccag acataatagc 240 tgacagacta acagactgtt cctttccatg ggtcttttct gcag 284 <210> 28 <211> 782 <212> DNA <213> Artificial sequence <220> <223> CRE0005_faf1_truncation <400> 28 ggaacattta gactttggga aagagattag tgatttacat tgctatctca ctgatttaat 60 ttaaatgctc ttccaaacca aacacacatg tgccgaagag gctactaaga aacccaacat 120 gcagagttct ctataagtgc agccgacagt gttgactgaa actaaacttg gaaatccagg 180 gcactaatgc acaatatcaa gcaataaaac ggcatctctt tggcaatatt taatttaaaa 240 aagaagaaag agacaggcga agatcaggca ctgtctgttt tggaggatca accattctgc 300 atttcaaagc attggtccct gcaatatcca ggttactgtg ctagaatctc gactattata 360 tcgcagttgt gagagggagg gcaaagatgt gtttactcag tgattaggcc cttagaataa 420 gcctctagct cctagagaga cagctcacca cttattcatt tgggccaatt cacaaagcct 480 aggaagatta aacatccatg ctgagaagac aagcgaatgc agacggtgaa aaagaaataa 540 aaattcttta aaaactctga gatgacttca ttattttcc acaaggaaac tttaggaaag 600 tgtttagtta gagaaaaacc cacattgacc tctctctaaaa cccttaatct ttcctttgtg 660 gtggcactgc tttgtggtaa gcgactggct cgcctcgccc ctcttttcac tggaagctga 720 gagaaaaaag actctggaga aacagttttc gttccaggga cacaaacccc tgacactgtt 780 aa 782 <210> 29 <211> 759 <212> DNA <213> Artificial Sequence <220> <223> CRE0006_Pitx2_Truncated <400> 29 gaaaatttaa tgtcattgaa gctctatttc caatagcaaa ggagcactat tgctaataga 60 cttcagagct tgaaataaat aaatctttgg aatcctgttg catctcttgg ggtgtgacat 120 ttgacagtct tttatagcac agaacgaaac aagtttgtga gctggaattc aattgtggcg 180 tattgattcc ttgcatcagt cattattccc tgctgattga caggtgaaaa ttggttacgt 240 taagtatttc atatgttata ttggctgaca tttgcttgcc tgctcttgtg tcaatattgt 300 tgtaaagatc tccagcttta tgagatagca atagacactg actgtggctt ttgtgtgatg 360 ttccagtgtt tttcctgaca taatttaaga catattaaaa accagcagca tcttccctct 420 tgagaagctt aatgccaata ttattgtctt ccaggggaag atcatgtatg ctcataatcg 480 ggtgctaatt tccaccagta cgctcatgtt taggcattag gcactataac tgtaaaattg 540 agccttcttg attgattcat gtcaagcctc atctcggctc ctgcagggga agtcatccgg 600 ctgacccttt ttacactaaa agaagagatt tgtgttcctt tctttcacct ggaaccatca 660 aattgactga ataatctgta atacattagt gctgacattt gttagggaga attaaacaag 720 acacagtaat cattccccag aataaaaatt gtgtttgat 759 <210> 30 <211> 434 <212> DNA <213> Artificial sequence <220> <223> CRE0007_Pitx2_truncated <400> 30 tgagactgag tgggagtggg gatgaagcct tttttcttca tttttttttc ctcaggtgca 60 attctgtgtt aatataagag aagtgtggcc ttccttctca tagcactaaa agtgagataa 120 tccctgtgta agaaatcagt aagtacggtc tgcttaatct agtcccagtg tgaaactgtt 180 gacatttgtt cttttttcta tcattatgtg actgggcctg ttttgtgctg gattaggcac 240 aaatctccta tgcagcacat ttggcatgtt actagtagtt taacttcatt aataatgtat 300 gaagaaaatg taatccatga caaggaagca aagaaaagta tttttttttt tttttgcttc 360 tcccaaatcc tttggaatga gtaattattc aacattttat gtttgatgtt atattttaca 420 attcaacttc cata 434 <210> 31 <211> 540 <212> DNA <213> Artificial sequence <220> <223> CRE0008_Pitx2_truncated <400> 31 gctggtgctt cttttttctg ttttttaagc tgctttacag acgaaaatgg aactatattt 60 ggaacaatgc tttctgtttt tccatactat tgatatttgt ggaaagtcac aaaatggcct 120 aaggaagcta agctcgcccc aagcagtggt cacttacaag tacttttgta ctctgtactc 180 ctgtcacatt tgggcgatca gagcaacagc tggggagact ttttcaacaa agatgagtgt 240 cagataatcc tgatgagatt ccacatccaa catcttttgt aattatgtca cattcagctg 300 taatggaata attcaagctg aaagaacaag ctttgatcct ttcttaaacc tttccctgtg 360 gactggctat ctaaaagatt taaagatatt tctgttacaa gatctagtgt ttcctcagag 420 aagtcatgct tctgaagcat cgtgatctac aagaacaata tcaagtttgc caaacacatt 480 tctgaaagca tcgtgttttg gggggagggg ttgtatttaa tgaagatatc aataatatgc 540
Claims
1. A synthetic CNS-specific promoter comprising the sequence according to SEQ ID NO: 8 or 26.
2. An expression cassette comprising a synthetic CNS-specific promoter according to claim 1, wherein the synthetic CNS-specific promoter is operatively linked to a nucleic acid sequence encoding an expression product.
3. A vector comprising the synthesized CNS-specific promoter according to claim 1 or the expression cassette according to claim 2.
4. The vector according to claim 3 is a viral vector.
5. The vector according to claim 4, wherein the vector is a lentiviral vector.
6. The carrier according to claim 4, wherein the carrier is an AAV carrier.
7. The vector according to claim 4, wherein the vector is a retroviral vector.
8. The vector according to claim 4, wherein the vector is an adenovirus vector.
9. A virus comprising the vector according to any one of claims 4-8.
10. A pharmaceutical composition comprising the synthetic CNS-specific promoter according to claim 1, the expression cassette according to claim 2, the vector according to any one of claims 3-8, or the virion according to claim 9.
11. Use of the synthetic CNS-specific promoter according to claim 1, the expression cassette according to claim 2, the vector according to any one of claims 3-8, the virion according to claim 9, or the pharmaceutical composition according to claim 10 in the preparation of a medicament for treating CNS diseases or conditions.
12. A cell comprising the synthetic CNS-specific promoter according to claim 1, the expression cassette according to claim 2, the vector according to any one of claims 3-8, or the virion according to claim 9.
13. Use of the synthetic CNS-specific promoter according to claim 1, the expression cassette according to claim 2, the vector according to any one of claims 3-8, the virion according to claim 9, or the pharmaceutical composition according to claim 10 in the preparation of a pharmaceutical composition for treating CNS diseases or conditions.
14. A method for producing an expression product for non-therapeutic purposes, the method comprising providing an expression cassette according to claim 2 in CNS cells and expressing the expression product present in the expression cassette.
15. The method of claim 14, wherein the expression product is expressed in dopaminergic neurons.
16. A method for expressing a therapeutic transgene in CNS cells for non-therapeutic purposes, the method comprising introducing an expression cassette according to claim 2, a vector according to any one of claims 3-8, or a virion according to claim 9 into CNS cells.
17. A method for non-therapeutic purposes of expressing an expression product in dopaminergic neurons, the method comprising introducing an expression cassette according to claim 2 into the dopaminergic neurons, wherein the expression cassette comprises a sequence according to SEQ ID NO: 8 or SEQ ID NO: 26.
Citation Information
Patent Citations
Methods and products for expression of micro RNAs
US20050075492A1
Microrna as ligands and target molecules
US20050142581A1
Reagents and methods for identification of RNAi pathway genes and chemical modulators of RNAi
US20050266552A1
Mature microRNA prediction method using bidirectional hidden markov model and medium recording computer program to implement the same
US20050272923A1
Process for amplifying, detecting, and / or-cloning nucleic acid sequences
US4683195A