A method for detecting and quantifying RNA

Abstract

The present invention relates to an aptamer nucleic acid molecule, a complex comprising the aptamer and a fluorophore small molecule, a method for detecting RNA, DNA or other target molecules in or outside of cells, and a kit comprising the aptamer. The aptamer of the present invention can specifically bind to a fluorophore small molecule and significantly increase the fluorescence intensity of the fluorophore small molecule under excitation of light at a suitable wavelength.

Description

Technical Field

[0001] This invention relates to an aptamer nucleic acid molecule, a method for detecting intracellular or extracellular RNA, DNA, or other target molecules, and a kit containing the aptamer. The aptamer of this invention can specifically bind to a fluorophore molecule and significantly enhance its fluorescence intensity under appropriate wavelength light excitation. Background Technology

[0002] In living cells, RNA possesses unique structures, diverse biological functions, and complex temporal and spatial distributions. The identification, function, and regulation of different RNA species and their modified forms have become international frontiers. Developing technologies for real-time tracking and analysis of these RNAs is crucial for understanding various cellular life processes.

[0003] Currently, the more mature techniques for RNA imaging mainly include the following: RNA fluorescence in situ hybridization (FISH), molecular beacon technology, the RNA-binding protein-fluorescent protein (MCP-FPs) system, and fluorescent RNA technology. Among these, FISH has long been widely used to study the intracellular level and distribution of RNA. It involves fluorescently labeling specific RNA molecules through molecular hybridization, followed by imaging. However, its operation is complex and includes an elution step, limiting its application to immobilized or dead cells and preventing real-time monitoring of dynamic RNA changes in living cells. Molecular beacon technology, on the other hand, was the earliest developed live-cell RNA imaging technique. It uses a stem-loop dual-labeled oligonucleotide probe with a hairpin structure at both the 5' and 3' ends. When it binds to target RNA, the quenching effect of the quenching group at one end on the fluorescent group is eliminated, resulting in fluorescence, or the FRET of the fluorescent groups at both ends disappears. However, molecular beacons suffer from drawbacks such as low fluorescence signal, difficulty in cell entry, easy degradation, significant non-specific aggregation in the cell nucleus, susceptibility to RNA secondary structure, and the need for custom-designed oligonucleotide probes for each RNA molecule. These limitations restrict the widespread application of this technology. Currently, the main method for live-cell RNA imaging utilizes the MCP-FPs system. MCP-FPs can specifically recognize and bind to mRNA molecules fused with multiple copies of the MS2 sequence, monitoring mRNA synthesis and distribution in real time by detecting the signal of the fluorescent protein (Ozawa et al. Nature Methods. 2007.4: 413-419). However, MCP-FPs without bound mRNA molecules produce high background fluorescence, resulting in a low signal-to-noise ratio for this method. Subsequently, scientists added a nuclear localization signal to the MCP-FPs fusion protein, allowing GFP-MS2 without bound mRNA molecules to localize in the cell nucleus, which to some extent reduced non-specific fluorescence in the cytoplasm and improved the signal-to-noise ratio of detection.

[0004] In 2003, Professor Roger Tsien, one of the Nobel laureates in Chemistry for his work on fluorescent proteins, proposed that RNA aptamers could specifically recognize, bind to, and activate dye molecules, thereby enabling the visualization of RNA. Based on this principle, his research group screened and obtained malachite green (MG) dye molecules that could bind to and activate the triphenylmethane dye, achieving a fluorescence enhancement of up to 2360 times. Unfortunately, since MG itself is a biological staining agent, it cannot be used for live-cell RNA labeling. Encouraged and inspired by this discovery, scientists have developed other RNA aptamer-fluorophore complexes over the past decade, including fluorescent RNAs based on Hoechst derivatives, cyanine dyes, fluorophore-quenching groups (FQ), and fluorescent protein chromophore derivatives. Compared to other RNA imaging techniques, RNA labeling and imaging can be achieved simply by fusing the RNA aptamer coding sequence with the target RNA coding sequence and adding dye molecules, without the need to introduce other nucleic acid or protein molecules. Therefore, it is the most direct RNA imaging method and the most promising technology for ideal live-cell RNA labeling and imaging.

[0005] In 2011, S. Jaffrey's research group used the SELEX method to obtain a nucleic acid aptamer called "Spinach" using DFHBI (3,5-difluoro-4-hvdroxybenzyli-dene imidazolinone), a derivative of the green fluorescent protein chromophore HBI, as a screening target. The binding of Spinach to DFHBI significantly enhanced the fluorescence signal of DFHBI. Using the Spinach-DFHBI complex, they achieved the first-ever tracking of target RNA in mammalian cells (Paige et al. Science. 2011. 333: 642-646). This group replaced one stem-loop structure in "Spinach" with a nucleic acid aptamer that can specifically bind to cellular metabolites, developing a tool based on the Spinach-DFHBI complex for detecting cellular metabolites (Paige et al. Science. 2012. 335: 1194). To date, this method has been successfully used to monitor and analyze RNA dynamics in bacteria, yeast, and mammalian cells. Subsequently, the research group optimized the nucleic acid aptamer molecule and fluorophore, obtaining Spinach2-DFHBI-1T, which further improved the properties of the new complex. In 2014, the group combined SELEX with flow cytometry and screened for Broccoli (Filonov et al. Journal of the American Chemical Society. 2014. 136: 16299-16308). Compared with the previous Spinach-DFHBI and Spinach2-DFHBI-1T, Broccoli-DFHBI-1T showed significant improvements in fluorescence intensity and stability. However, Broccoli-DFHBI-1T still suffered from severe magnesium ion dependence and poor photostability. In 2020, the group further optimized DFHBI-1T, obtaining a new fluorophore BI, and finally obtained a new complex Broccoli-BI (Li et al. Angewandte Chemie International Edition in English. 2020. 59: 4511-4518). In 2017, the research group also developed the Corn-DFHO complex for detecting the activity of the RNA polymerase III promoter in mammalian cells (Song et al. Nature Chemical Biology. 2017.13: 1187-1194).

[0006] In 2019, a joint research team comprised of Professors Yang Yi and Zhu Linyong from China achieved a breakthrough in the field of fluorescent RNA. Based on a novel molecular design concept, they designed and synthesized a new fluorophore molecule, HBC, and screened for its highly compatible nucleic acid aptamer, Pepper. Simultaneously, they chemically modified HBC to obtain a series of derivatives, and the complexes bound to Pepper exhibited spectra covering cyan, green, orange, and red. The Pepper-HBC620 complex emitted bright red fluorescence and exhibited good photostability, enabling SIM super-resolution imaging.

[0007] In summary, all currently used RNA labeling technologies have their own drawbacks. MCP-FPs labeling technology suffers from strong background fluorescence and low signal-to-noise ratio due to non-specific binding. RNA labeling technologies based on aptamer-fluorophore-quencher complexes have only been successfully applied to RNA in bacteria and have not yet been implemented in mammalian cells. RNA labeling technologies based on single fluorophores and nucleic acid aptamers appear to be the perfect RNA labeling technology; however, they are limited by the limited number of bioorthogonal fluorescent RNAs available, the fact that most complexes are located in the green band, exhibit strong magnesium ion dependence, and poor photostability, thus limiting their widespread use. Therefore, the research and industry communities have consistently sought more efficient fluorophore-nucleic acid aptamer complexes that can overcome the shortcomings of previous fluorophore-nucleic acid aptamer complexes for real-time labeling of RNA or DNA in living cells.

[0008] Brief description of the invention

[0009] This invention provides a nucleic acid aptamer molecule, a DNA molecule encoding the nucleic acid aptamer molecule, a complex of the nucleic acid aptamer molecule and a fluorophore molecule, and the use of the complex.

[0010] The technical solution provided by this invention is as follows:

[0011] 1. A nucleic acid aptamer molecule, said aptamer molecule comprising the following nucleotide sequence (a), (b), or (c):

[0012] (a) The nucleotide sequence is: N1UGUAGUAN9-N 10 -N 11 GGAAGAAUUGAUCUCGGN 29 Among them, N1, N9, N 10 N 11 and N 29 Represents a nucleotide fragment with a length of ≥1, and N1 and N 29 At least one base pair in the nucleotide sequence forms a complementary pair, N9 and N uAt least one base pair in the nucleotide sequence forms a complementary pair;

[0013] (b) A nucleotide sequence that has at least 58% identity with the nucleotide sequence defined in (a);

[0014] (c) The nucleotide sequence specified in (a) does not include N1, N9, or N 10 N 11 and N 29 The position of (a) is a nucleic acid aptamer molecule that has undergone substitution, deletion and / or addition of one or more nucleotides and has aptamer function.

[0015] 2. The nucleic acid aptamer molecule according to claim 1, wherein the sequence has at least 58%, 63%, 67%, 71%, 75%, 79%, 83%, 94%, 96%, 98% or 100% identity with the Paprika structural nucleotide sequence of (a).

[0016] 3. The nucleic acid aptamer molecule according to claim 1, wherein the nucleotide sequence (c) is the Paprika structural nucleotide sequence defined in (a) excluding N1, N9, and N. 10 N 11 and N 29 Nucleic acid aptamer molecules are obtained by substitution, deletion and / or addition of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides.

[0017] 4. The nucleic acid aptamer molecule according to claim 3, wherein the nucleotide sequence (c) is the nucleotide sequence defined in (a) excluding N1, N9, and N 10 N 11 and N 29 The position of the nucleic acid aptamer molecule is obtained by substituting 7, 6, 5, 4, 3, 2 or 1 nucleotides.

[0018] 5. The nucleic acid aptamer molecule according to any one of claims 1-4, wherein N1 and N in nucleotide sequence (a) 29 During complementary pairing, the orientation of the N1 nucleotide sequence is 5'-3', N 29 The nucleotide sequence orientation is 3'-5'; N9 and N 11 During complementary pairing, the orientation of the N9 nucleotide sequence is 5'-3', N 11 The orientation of the nucleotide sequence is 3'-5'.

[0019] 6. The nucleic acid aptamer molecule according to claim 5, wherein when N1 and N 29When at least one fragment in the sequence is ≥5 nucleotide bases in length, then N1 and N 29 At least two pairs of nucleotide bases in the nucleotide sequence form complementary pairs; when N9 and N 11 When at least one fragment in the sequence is ≥5 nucleotide bases in length, then N9 and N 11 The nucleotide sequence contains at least two pairs of complementary bases.

[0020] 7. The nucleic acid aptamer molecule according to any one of claims 1-6, wherein the nucleotide substitutions for the general formula Paprika are selected from one of the following: U2A, U2C, U2G, G3A, G3U, G3C, U4A, U4C, U4G, A5U, A5C, A5G, G6A, G6U, G6C, U7A, U7C, U7G, A8U, A8C, A8G, G12A, G12U, G12C, G13A, G13U, G13C, A14U, A14C, A14G, A15U, A15C, A15G. G16A, G16U, G16C, A17U, A17C, A17G, A18U, A18C, A18G, U19A, U19C, U19G, U20A, U20C, U20G, G21A, G21U, G21C, A22U, A22C, A22G, U23A, U23C, U23G, C24A, C24U, C24G, U25A, U25C, U25G, C26A, C26U, C26G, G27A, G27U, G27C, G28A, G28U, G28C, A5U / U25A, A5C / U25G, A5G / U25C, G6A / C24U, G6U / C24A, G6C / C24G, U4A / G12A, U4A / G13U, U4A / G16A, U4A / U20C, U4A / A22C, G12A / G13U, G12A / G16A, G12A / U20C, G12A / A22C, G13U / G16A, G13U / U20C, G13U / A22C, G16A / U20C, G16A / A22C, U20C / A22C, U4A / G12A / G13U, U4A / G12A / G16A, U4A / G12A / G16A, U4A / G12A / A22C, G12A / G13U / G16A, G12A / G13U / U20C, G12A / G13U / A22C, G13U / G16A / U20C, G13U / G16A / A22C, G 16A / U20C / A22C, U4A / G12A / G13U / G16A / U20C, U4A / G12A / G13U / G16A / A22C, U4A / G13U / G16A / U20C / A22C, U4A / G12A / G16A / U20C / A22C, U4A / G12A / G13U / U20C / A22C , A5U / U25A / U4A / G12A / G13U, A5U / U25A / U4A / G12A / G16A, A5U / U25A / / U4A / G12A / G16A,G6A / C24U / U4A / G12A / A22C, G6A / C24U / G12A / G13U / G16A, G6A / C24U / G12A / G13U / U20C, G6A / C24U / G12A / G13U / A22C.

[0021] 8. The nucleic acid aptamer molecule according to claim 7, wherein the nucleotide substitutions for the general formula Paprika are selected from one of the following: U2A, U2C, U2G, U4A, U4C, U4G, A5C, A5G, G6U, U7A, U7C, U7G, A8U, A8C, A8G, G12A, G12U, G12C, G13A, G13U, G13C, A14U, A14C, A14G, A15U, A15C, A15G, G16A, G16U, G16C, A17U, A17C, A17G. A18U, A18C, U19A, U19C, U19G, U20A, U20C, U20G, G21A, G21U, A22U, A22C, A22G, U23A, U23C, U23G, C24A, C24U, C24G, U25A, U25C, C26A, C26U, G27A, G27U, G27C, G28A, G28U, G28C, A5U / U25A, A5C / U25G, A5G / U25C, G6A / C24U, G6U / C24A, G6C / C24G, U4A / G12A, U4A / G13U, U4A / G16A, U4A / U20C, U4A / A22C, G12A / G13U, G12A / G16A, G12A / U20C, G12A / A22C, G13U / G16A, G13U / U20C, G13U / A22C, G16A / U20C, G16A / A22C, U20C / A22C, U4A / G12A / G13U, U4A / G12A / G16A, U4A / G12A / G16A, U4A / G12A / A22C, G12A / G13U / G16A, G12A / G13U / U20C, G12A / G13U / A22C, G13U / G16A / U20C, G13U / G16A / A22C, G16A / U20C / A22C, U4A / G12A / G13U / G16A / U20C, U4A / G12A / G13U / G16A / A22C, U4A / G13U / G16A / U20C / A22C, U4A / G12A / G16A / U20C / A22C, U4A / G12A / G13U / U20C / A22C, A5U / U25A / U4A / G 12A / G13U, A5U / U25A / U4A / G12A / G16A, A5U / U25A / / U4A / G12A / G16A, G6A / C24U / U4A / G12A / A22C, G6A / C24U / G12A / G13U / G16A, G6A / C24U / G12A / G13U / U20C, G6A / C24U / G12A / G13U / A22C.

[0022] 9. The nucleic acid aptamer molecule according to claim 8, wherein the nucleotide substitutions for the general formula Paprika are selected from one of the following: U2A, U2C, U2G, U4A, U4C, U4G, A5C, A5G, G6U, U7C, U7G, A8U, A8C, A8G, G12A, G12U, G12C, G13A, G13U, G13C, A14U, A14C, A14G, A15U, A15C, A15G, G16A, G16U, G16C, A17U, A17C, A17G, U19A, U19C, U20A, U20C, U20G, G21U, A22U, A22C, A22G, U23A, U23C, U23G, C24A, C24G, U25C, C26U, G27A, G27U, G27C, G28A, G28U, G28C, A5U / U25A, A5C / U25G, A5G / U25C, G6A / C24U, G6U / C24A, G6C / C24G, U4A / G12A, U4A / G13U, U4A / G16A, U4A / U20C, U4A / A22C, G12A / G13U, G12A / G16A, G12A / U20C, G12A / A 22C, G13U / G16A, G13U / U20C, G13U / A22C, G16A / U20C, G16A / A22C, U20C / A22C, U4A / G12A / G13U, U4A / G12A / G16A, U4A / G12A / G16A, U4A / G12A / A22C, G12A / G13U / G16A, G12A / G13U / U20C, G12A / G13U / A22C, G13U / G16A / U20C, G13U / G16A / A22C, G16A / U20C / A22C, U4A / G12A / G13U / G16A / U20C, U4A / G12A / G13U / G16A / A22C, U4A / G13U / G16A / U20C / A22C, U4A / G12A / G16A / U20C / A22C, U4A / G12A / G13U / U20C / A22C, A5U / U25A / U4A / G12A / G13U, A5U / U25A / U4A / G12A / G16A, A5U / U25A / / U4A / G12A / G16A, G6A / C24U / U4A / G12A / A22C, G6A / C24U / G12A / G13U / G16A, G6A / C24U / G12A / G13U / U20C, G6A / C24U / G12A / G13U / A22C.

[0023] 10. The nucleic acid aptamer molecule according to claims 1-9, wherein N1 and N in nucleotide sequence (a) 29 The nucleotide sequence at that location is either F30 or a tRNA scaffold RNA sequence.

[0024] 11. The nucleic acid aptamer molecule according to any of the preceding claims, wherein the aptamer molecule is an RNA molecule or a base-modified RNA molecule.

[0025] 12. The nucleic acid aptamer molecule according to any of the preceding claims, wherein the aptamer molecule is a DNA-RNA hybrid molecule or a base-modified DNA-RNA molecule.

[0026] 13. The nucleic acid aptamer molecule according to any one of the preceding claims, wherein the aptamer function means that the nucleic acid aptamer can increase the fluorescence intensity of the fluorophore molecule by at least 2 times, at least 5-10 times, at least 20-50 times, at least 100-200 times, at least 200-1000 times, or at least 1000-5000 times under excitation light of a suitable wavelength.

[0027] 14. The nucleic acid aptamer molecule according to claim 1, further comprising a tandem strand capable of binding multiple fluorophore molecules, said tandem strands being linked together by spacer sequences of appropriate length, the number of which may be 2, 3, 4, 5, 6, 7, 8, or more. The nucleotides of said tandem strands may be selected from, but are not limited to, sequences SEQ ID No: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14.

[0028] 15. A complex of a nucleic acid aptamer molecule and a fluorophore molecule, wherein the nucleic acid aptamer molecule is the nucleic acid aptamer molecule according to any one of claims 1-14, and the fluorophore molecule has the structure described in formula (I):

[0029]

[0030] The electron donor portion -D is -NX1-X2, where X1 is selected from hydrogen, alkyl, or modified alkyl, and X2 is selected from hydrogen, alkyl, or modified alkyl. X1 and X2 are optionally connected to each other and together with the N atom form an alicyclic ring.

[0031] The conjugated system E is formed by at least one conjugated connection selected from double bonds, triple bonds, aromatic rings, and aromatic heterocycles, wherein each hydrogen atom contained herein is optionally independently substituted by a substituent selected from halogen atoms, hydroxyl groups, amino groups, primary amino groups, secondary amino groups, hydrophilic groups, alkyl groups, and modified alkyl groups, wherein the substituents are optionally connected to each other to form alicyclic or alicyclic rings.

[0032] X1 and X2 are independently linked to the conjugate structure E to form alicyclic heterocycles;

[0033] The electron acceptor A portion has a ring structure as shown in formula (I-1-a):

[0034]

[0035] Ra is independently selected from hydrogen, halogen atom, nitro, alkyl, aryl, heteroaryl, hydrophilic group or modified alkyl; Rb is independently selected from hydrogen, halogen atom, hydroxyl, carboxyl, amino, nitro, alkyl, aryl, heteroaryl, hydrophilic group or modified alkyl, or is a group formed by conjugation of a double bond with at least one of an aromatic ring or aromatic heterocycle.

[0036] Each Y1 is independently selected from -O-, -S-, -(S=O)-, and -(NR-). i )-, where R i Selected from hydrogen, amino, alkyl, or modified alkyl;

[0037] Each Y2 is independently selected from =O, =S, =S=O, and =NR. i , where R i Selected from hydrogen, alkyl, or modified alkyl;

[0038] Each Y3 is independently selected from =O, =S, =S=O, and =NR. i , where R i Selected from hydrogen, alkyl, or modified alkyl;

[0039] Alternatively, each Y3 can be independently defined as =C(R). e (CN); where R e Selected from hydrogen, ester group, amide group, sulfonic acid group, sulfonamide group, and sulfonate group;

[0040] in,

[0041] The "alkyl" is C1-C. 30 A straight-chain or branched alkyl group; preferably, C1-C6. 10Straight-chain or branched alkyl; preferably, C1-C7 straight-chain or branched alkyl; preferably, C1-C5 straight-chain or branched alkyl; preferably, selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, isopentyl, 1-ethylpropyl, neopentyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, isohexyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl, 2-ethylbutyl, n-heptyl, 2-methylhexyl, 3- Methylhexyl, 2,2-dimethylpentyl, 3,3-dimethylpentyl, 2,3-dimethylpentyl, 2,4-dimethylpentyl, 3-ethylpentyl or 2,2,3-trimethylbutyl;

[0042] The "modified alkyl" refers to any carbon atom of an alkyl group selected from halogen atoms, -O-, -OH, -CO-, -CS-, -NO2, -CN, -S-, -SO2-, -(S=O)-, The modified alkyl group is obtained by replacing at least one of the following groups: phenyl, phenylene, primary amino, secondary amino, tertiary amino, quaternary ammonium salt, saturated or unsaturated monocyclic or bicyclic cyclic hydrocarbon group, biaromatic heterocycle, and bridged aliphatic heterocycle. The modified alkyl group has 1 to 30 carbon atoms, and its carbon-carbon single bond is optionally and independently replaced by a carbon-carbon double bond or a carbon-carbon triple bond.

[0043] The substitution of carbon atoms refers to the substitution of carbon atoms or carbon atoms together with hydrogen atoms thereon by corresponding groups;

[0044] The "alicyclic ring" is a saturated or unsaturated 4- to 10-membered monocyclic or polycyclic alicyclic ring;

[0045] The "aliphatic ring" is a saturated or unsaturated 4- to 10-membered monocyclic or polycyclic aliphatic ring containing at least one heteroatom selected from N, O, S or Si. When the aliphatic ring contains an S atom, it is -S-, -SO- or -SO2-. The aliphatic ring may be optionally substituted with a halogen atom, nitro group, alkyl group, aryl group, hydrophilic group or modified alkyl group.

[0046] The "aryl or aromatic ring" is a 5- to 10-membered monocyclic or fused bicyclic aromatic group;

[0047] The "heteroaryl or aromatic heterocyclic" refers to a 5- to 10-membered monocyclic or fused bicyclic heteroaromatic group containing at least one heteroatom selected from N, O, S, or Si.

[0048] The halogen atoms are each independently selected from F, Cl, Br, and I;

[0049] The "hydrophilic group" is a hydroxyl group, a sulfonic acid group, a carboxyl group, a phosphite group, a primary amino group, a secondary amino group, or a tertiary amino group;

[0050] The “bridged alicyclic ring” is a 5- to 20-membered bridged alicyclic ring containing at least one heteroatom selected from N, O, or S.

[0051] The “ester group” is an R(C=O)OR' group;

[0052] The “phosphite group” RP(=O)(OH)2 group;

[0053] The “sulfonic acid group” is an RSO3H group;

[0054] The “sulfonate group” is an RSO3 R' group;

[0055] The “sulfonate amino group” is an RSO2NR'R” group;

[0056] The "primary amine" is an RNH2 group;

[0057] The "secondary amino" is an RNHR' group;

[0058] The "tertiary amino" is an RNR'R" group;

[0059] The “quaternary ammonium salt group” R R'R”R”'N+ group;

[0060] Each R, R', R”, R”' is independently a single bond, alkyl, alkylene, modified alkyl or modified alkylene, wherein the modified alkyl or modified alkylene is a group obtained by replacing any carbon atom of a C1-C10 (preferably C1-C6) alkyl or alkylene with a group selected from -O-, -OH, -CO-, -CS-, -(S=O)-.

[0061] Optionally, the modified alkyl or modified alkylene group is independently a group containing at least one group selected from -OH, -O-, ethylene glycol unit (-(CH2CH2O)n-), C1-C8 alkyl, C1-C8 alkoxy, C1-C8 acyloxy, C1-C8 haloalkyl, monosaccharide group, disaccharide group, polysaccharide group, -O-CO-, -NH-CO-, -(-NH-CHR””-CO-)n-, -SO2-O-, -SO-, -SO2-NH-, -SS-, -CH=CH-, halogen atom, cyano, nitro, o-nitrophenyl, benzoylmethyl, phosphate ester group, wherein n is 1-100, preferably 1-50, more preferably 1-30, more preferably 1-10; R”” is a residue of H or α amino acid; the “phosphate ester group” has the definition as described above;

[0062] The “monosaccharide unit” is a sugar unit that cannot be easily hydrolyzed into smaller sugar molecules;

[0063] The "disaccharide unit" is a sugar unit formed by the dehydration of two monosaccharides;

[0064] The “polysaccharide unit” is a sugar unit formed by the dehydration of more than ten monosaccharides;

[0065] Optionally, the C1-C8 alkyl group is methyl, ethyl, propyl, or isopropyl; the C1-C8 alkoxy group is methoxy, ethoxy, propoxy, or isopropoxy; the C1-C8 acyloxy group is acetoxy, ethyl, propyl, or isopropyl; and the C1-C8 haloalkyl group is trifluoromethyl, chloromethyl, or bromomethyl.

[0066] Optionally, the alicyclic ring is selected from azacyclic butane, pyrrolidine, piperidine, tetrahydrofuran, tetrahydropyran, morpholine, and thiomorpholine.

[0067] Optionally, the conjugate system E is selected from the structures of the following formulas (I-2-1) to (I-2-39):

[0068]

[0069]

[0070] Optionally, the conjugated system E and -NX1-X2 form an alicyclic heterocycle as shown in (I-3-1) (I-3-5):

[0071]

[0072] Alternatively, the conjugate system E and -NX1-X2 form the structure shown in (I-3-6):

[0073]

[0074] Optionally, the electron acceptor portion is selected from one of the following formulas (I-4-1) to (I-4-42):

[0075]

[0076]

[0077] 16. Optionally, the fluorescent probe described above is characterized in that the fluorescent probe formula (I) is selected from compounds of the following formula:

[0078]

[0079]

[0080]

[0081]

[0082] 17. The complex according to claim 16, wherein the fluorophore molecule is selected from the group consisting of I-5-1, I-5-2, I-5-3, I-5-4, I-5-5, I-5-6, I-5-7, I-5-8, I-5-9, I-5-10, I-5-11, I-5-12, I-5-13, I-5-14, I-5-15, I-5-16, I-5-17, I-5-18, I-5-19, I-5-20, I-5-21, I-5-22, I-5-23, I-5-24, I-5-25, I-5-26, I-5-27, I-5-28, I-5-29, I-5-30, I-5-31, I-5-32, I-5-33, I-5-34, I-5-35, I-5-36, I-5-37, I-5-38, I-5-39, I-5-40, I-5-41, I-5-42, I-5-43, I-5-44, I-5-45, I-5-46, I-5-47, I-5-48, I-5-49, I-5-50, I-5-51, I-5-52, I-5-53, I-5-54, I-5-55, I-5-56, I-5-57, I-5-58, I-5-59, I-5-60, I-5-61, I-5-62, I-5-63, I-5-64, I-5-65, I-5-66, I-5-67, I-5-68, I-5-69, I-5-70, I-5-71, I-5-72, I-5-73, I-5-74, I-5-75, I-5-76, I-5-77, I-5-78, I-5-79, I-5-80, I-5-81, I-5-82, I-5-83, I-5-84.

[0083] 18. The complex according to any one of claims 15-17, wherein the aptamer molecule in the complex comprises nucleotide sequences SEQ ID No: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 and 14.

[0084] 19. A complex according to any one of claims 15-18 for the detection or labeling of a target nucleic acid molecule in vitro or in vivo.

[0085] 20. A DNA molecule that transcribes the nucleic acid aptamer molecule according to any one of claims 1-14.

[0086] 21. An expression vector comprising the DNA molecule of claim 20.

[0087] 22. A host cell comprising the expression system of claim 21.

[0088] 23. A kit comprising the nucleic acid aptamer molecule of any one of claims 1-14 and / or the expression vector of claim 21 and / or the host cell of claim 22 and / or the complex of any one of claims 15-18.

[0089] 24. A method for detecting target molecules, comprising the steps of:

[0090] a) Adding the complex according to any one of claims 15-18 to a solution containing the target molecule;

[0091] b) Excite the complex with light of a suitable wavelength;

[0092] c) Detect the fluorescence of the complex.

[0093] 25. A method for extracting and purifying RNA, comprising extracting and purifying RNA using the complex according to any one of claims 15-18.

[0094] The inventors have designed novel nucleic acid aptamer molecules to form novel fluorophore-nucleic acid aptamer complexes. After the aptamer molecules bind to the fluorophore molecules, they significantly enhance the fluorescence intensity of the fluorophore molecules under appropriate wavelength excitation light. These complexes overcome the shortcomings of previous fluorophore-nucleic acid aptamer complexes and can be effectively used for real-time RNA / DNA labeling in living cells. The nucleic acid aptamers of this invention exhibit strong affinity for fluorophore molecules and demonstrate excellent photostability and temperature stability. These nucleic acid aptamer-fluorophore molecule complexes can be used for real-time labeling and imaging of RNA / DNA in prokaryotic and eukaryotic cells, detecting protein-RNA interactions, exploring the relationship between mRNA content and protein in cells, or for tagging RNA extraction and purification. Attached Figure Description

[0095] Figure 1 Secondary structure prediction of nucleic acid aptamer molecules. (A) Predicted general structures of Paprika, including N1 and N2 that can form stem structures. 29 N9 and N can form stem-ring structures. 10 and N 11 (B) Predicted structure of Paprika-1, N1 and N 29 The base sequence is shown in the dashed box corresponding to stem 1 in the figure, N9, N 10 and N 11 The base sequence is shown in the dashed box corresponding to the "stem-loop".

[0096] Figure 2 Secondary structure prediction of Paprika-1. (A) Secondary structure prediction of F30-Paprika-1; (B) Secondary structure prediction of tRNA-Paprika-1.

[0097] Figure 3 Spectroscopic property identification of the Paprika-1-I-5-57 complex. (A) Imaging of the Paprika-1-I-5-57 complex in an NMR tube; (B) Fluorescence excitation and emission spectra of the Paprika-1-I-5-57 complex; (C) Absorption spectra of the Paprika-1-I-5-57 complex and the fluorophore I-5-57; (D) Determination of the dissociation constant of the binding of Paprika-1 and I-5-57.

[0098] Figure 4 Stability assessment of the Paprika-1-I-5-57 complex. (A) pH stability determination of the Paprika-1-I-5-57 complex; (B) pH stability determination of the Paprika-1-I-5-57 complex against Mg. 2+ Determination of dependence; (C) Temperature stability determination of Paprika-1-I-5-57 complex (with additional 5 mM Mg) 2+ (D) Paprika-1-I-5-57 complex against K + Dependence determination.

[0099] Figure 5 The activation effects of Paprika-2 and Paprika-3 with different modifications on the Paprika-1 sequence on I-5-57. (A) Schematic diagram of the secondary structure of the Paprika-2 aptamer containing deoxyribonucleotides (light-colored in the figure); (B) Schematic diagram of the secondary structure of the Paprika-3 aptamer containing 2'F modification (light-colored in the figure); (C) Quantitative analysis of the activation effects of Paprika-2 and Paprika-3 on I-5-57. The "control" is the Paprika-2 or Paprika-3 aptamer replaced with buffer solution.

[0100] Figure 6The activation effects of different Paprika-1 tandem combinations on I-5-57. (A) Paprika-1 in series 1 to obtain Paprika-4 tandem combinations; (B) Paprika-1 in series 2 to obtain Paprika-5 tandem combinations; (C) Paprika-1 in series 3 to obtain Paprika-4 tandem combinations; (D) Activation effects of different Paprika-4 tandem combinations obtained in series 1 on I-5-57; (E) Activation effects of different Paprika-5 tandem combinations obtained in series 2 on I-5-57; (F) Activation effects of different Paprika-4 tandem combinations obtained in series 3 on I-5-57.

[0101] Figure 7 The effect of the F30-Paprika-1-I-5-57 complex on RNA labeling in bacteria (scale bar: 10 μm).

[0102] Figure 8 The Circular-Paprika-1 and I-5-57 complex is expressed in mammalian cells (scale bar: 50 μm).

[0103] Figure 9 The F30-Paprika-1 and I-5-57 complex is expressed in mammalian cells (scale bar: 50 μm).

[0104] Figure 10 The Paprika-1-I-5-57 complex was used to label the localization of U6 spliceosome RNA (scale bar: 10 μm).

[0105] Figure 11 The Paprika-1-I-5-57 complex was used to label the mRNA localization of fibrous actin ACTB (scale bar: 10 μm).

[0106] Figure 12 Quantitative results of Paprika-1 for RNA extraction and purification. Invention Details

[0108] This invention is described in detail herein by reference to the definitions and embodiments described below. All contents of patents and publications mentioned herein, including all sequences disclosed in such patents and publications, are expressly incorporated herein by reference. Hereinafter, “nucleotide” and “nucleotide base” are used interchangeably and have the same meaning.

[0109] The following is a detailed explanation of some of the terms used in this application.

[0110] Nucleic acid aptamer molecules

[0111] The "nucleic acid aptamer molecule" described in this invention is also called an "aptamer molecule". This nucleic acid aptamer molecule comprises (a) a nucleotide sequence as follows:

[0112] N1UGUAGUAN9-N 10 -N 11 GGAAGAAUUGAUCUCGGN 29 (corresponding to) Figure 1 A is a Paprika structure; or (b) a sequence having at least 58% identity with the nucleotide sequence described in (a); wherein N1 and N 29 The nucleotide sequence contains at least one base pair that forms an inverse complementary pair, meaning the orientation of the N1 nucleotide sequence is 5'-3', N 29 The nucleotide sequence orientation is 3'-5'. When N1 and N... 29 When at least one nucleotide base is ≤4, at least one complementary base pair is required; when N1 and N 29 For at least one nucleotide to be ≥5 bases long, at least two complementary base pairs are required. Specifically, N9 and N... 11 The nucleotide sequence contains at least one base pair that forms an inverse complementary pair, meaning the orientation of the N9 nucleotide sequence is 5'-3', N 11 The nucleotide sequence orientation is 3'-5'. When N9 and N... 11 When at least one nucleotide base is ≤4, at least one complementary base pair is required; when N9 and N 11 For at least one nucleotide to be ≥5 bases long, at least two complementary base pairs are required. Among them, N... 10 (a) is a nucleotide base of any length and composition; or (c) is a substitution, deletion and / or addition of 1-10 nucleotides at any position in the nucleotide sequence (a).

[0113] Nucleic acid aptamer molecules contain substitutions for nucleotides of the general formula Paprika, selected from one of the following groups: U2A, U2C, U2G, G3A, G3U, G3C, U4A, U4C, U4G, A5U, A5C, A5G, G6A, G6U, G6C, U7A, U7C, U7G, A8U, A8C, A8G, G12A, G12U, G12C, G13A, G13U, G13C, A14U, A14C, A14G, A15U, A15C, A15G, G16A, G16U, G16C, A17U, A17C, A17G, A18U, A18C, A18G, U19A, U19C, U19G, U20A, U20C. U20G, G21A, G21U, G21C, A22U, A22C, A22G, U23A, U23C, U23G, C24A, C24U, C24G, U25A, U25C, U25G, C26A, C26U, C26G, G27A, G27U, G27C, G28A, G28U, G28C, A5U / U25A, A5C / U25G, A5G / U25C, G6A / C24U, G6U / C24A, G6C / C24G, U4A / G12A, U4A / G13U, U4A / G16A, U4A / U20C, U4A / A22C, G12A / G13U, G12A / G16A, G12A / U20C, G12A / A22C, G13U / G16A, G13U / U20C, G13U / A22C, G16A / U20C, G16A / A22C, U20C / A22C, U4A / G12A / G13U, U4A / G12A / G16A, U4A / G12A / G16A, U4A / G12A / A22C, G12A / G13U / G16A, G12A / G13U / U20C, G12A / G13U / A22C, G13U / G16A / U20C, G13U / G16A / A22C, G16A / U20C / A22C, U4A / G12A / G13U / G16A / U20C, U4A / G12A / G13U / G16A / A22C, U4A / G13U / G16A / U20C / A22C, U4A / G12A / G16A / U20C / A22C, U4A / G12A / G13U / U20C / A22C, A5U / U25A / U4A / G12A / G13U, A5U / U25A / U4A / G12A / G16A, A5U / U25A / / U4A / G12A / G16A, G6A / C24U / U4A / G12A / A22C, G6A / C24U / G12A / G13U / G16A,G6A / C24U / G12A / G13U / U20C and G6A / C24U / G12A / G13U / A22C (i.e., the aptamer molecular structures in Table 1). These mutants can specifically bind to fluorophore molecules and, after binding, can significantly increase the fluorescence intensity of the fluorophore molecules under appropriate wavelength excitation light. The nucleotide sequence corresponds to... Figure 1 The position in A.

[0114] The above mutations indicate nucleotide substitutions at the corresponding sites in the aptamer nucleotide sequence of the general formula Paprika. For example, U2A means that the 2nd uridine nucleotide U in Paprika is replaced by adenine nucleotide A, which is Paprika-U2A in Table 1; Paprika-A5U / U25A means that the 5th adenine nucleotide A in Paprika is replaced by uridine nucleotide U, and at the same time, the 25th uridine nucleotide U in Paprika is replaced by adenine nucleotide A, which is Paprika-A5U / U25A in Table 1.

[0115] Table 1: Aptamer structures of the Paprika general formula with substitutions of 5, 4, 3, 2, or 1 nucleotides.

[0116]

[0117]

[0118]

[0119]

[0120] Aptamers are single-stranded nucleic acid molecules that have a secondary structure consisting of one or more base-pairing regions (stems) and one or more unpaired regions (loops). Figure 1 A). The nucleic acid aptamer molecule described in this invention comprises a... Figure 1 The secondary structure predicted by A. This secondary structure contains two stem structures, two loop structures, and one stem-loop structure. Stem 1 serves to stabilize the overall structure of the nucleic acid aptamer molecule and can be replaced by any nucleotide base pairs of any length and composition that can form the stem structure. The 5' or 3' end of the stem 1 structure can be fused with any target RNA molecule for extracellular or intracellular detection of the target RNA molecule. In a preferred embodiment of the invention, the 5' end of the nucleic acid aptamer molecule is fused with a 5S RNA sequence (Genebank: NR_023377.1); in another preferred embodiment of the invention, the 5' end of the nucleic acid aptamer molecule is fused with an ACTB RNA sequence (ACCESSION NM_001101).

[0121] Figure 1 The stem-loop structure in A plays a role in stabilizing the overall structure of the nucleic acid aptamer molecule and can be replaced with other nucleotide base pairs of any length and composition that can form a stem-loop structure. The aptamer molecule described in this invention may also contain insertions into N9-N... 10 -N 11 The other nucleotide sequence at the location, which the inserted nucleotide sequence replaces Figure 1 The stem-loop structure in A yields... Figure 1 Structure B (SEQ ID NO: 1). The nucleotide sequence can specifically recognize / bind to target molecules. When the target molecule is absent, the binding ability of the aptamer molecule to the fluorophore molecule is weak, resulting in weak fluorescence of the fluorophore molecule; when the target molecule is present, the binding of the target molecule to the aptamer promotes the binding of the aptamer to the fluorophore molecule, significantly improving the fluorescence of the fluorophore molecule under appropriate wavelength excitation light. The target molecule can be a small molecule, a cell surface signaling molecule, etc. These nucleic acid aptamers bind to specific target molecules non-covalently, which mainly relies on intermolecular ionic forces, dipole forces, hydrogen bonds, van der Waals forces, electron-positron interactions, stacking interactions, or a combination of the above forces. The stem-loop structure can be replaced with an RNA sequence that recognizes the target molecule for extracellular or intracellular detection of the target molecule.

[0122] In a preferred embodiment of the present invention, the nucleic acid aptamer molecule is preferably a SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14, which are mutant sequences of fluorophores that can bind to fluorophore molecules and significantly enhance their fluorescence under excitation light of a suitable wavelength.

[0123] The nucleic acid aptamer molecule of this invention may further include a nucleotide sequence to increase its stability. In a preferred embodiment of this invention, F30 scaffold RNA (SEQ ID NO: 2) is used, and its connection to the nucleic acid aptamer molecule is as follows: Figure 2 As shown in A; in another preferred embodiment of the present invention, tRNA scaffold RNA (SEQ ID NO: 3) is used, and its connection with the nucleic acid aptamer molecule is as follows. Figure 2 As shown in B.

[0124] The "nucleic acid aptamer molecule" described in this invention is an RNA molecule, or a DNA-RNA hybrid molecule in which some nucleotides are replaced with deoxyribonucleotides. The nucleotides can be their D and L enantiomers, and also include their derivatives, including but not limited to 2'-F, 2'-amino, 2'-methoxy, 5'-iodo, and 5'-bromo-modified polynucleotides. Nucleic acids include various modified nucleotides.

[0125] identity

[0126] "Identity" in this invention describes the correlation between two nucleotide sequences. The identity calculation of the two aptamer nucleotide sequences in this invention does not include N1, N9, and N in sequence (a). 10 N 11 N 29 For the purposes of this invention, the degree of identity between two nucleotide sequences is determined using the Needle program, preferably version 3.0.0 or later, of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends in Genetics 16: 276-277), specifically the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453). Optional parameters used are a gap penalty of 10, a gap extension penalty of 0.5, and an EBLOSUM62 substitution matrix (EMBOSS version of BLOSUM62). The percentage identity is calculated using the Needle output labeled "longest identity" (obtained using the -nobrief option) as follows:

[0127] (identical residues × 100) / (alignment length - total number of gaps in alignment).

[0128] For example, in Table 1 of this invention, the sequences of Paprika(U2A) and Paprika(U2C) are Paprika(U2A): N1 A GUAGUAN9-N 10 -N 11 GGAAGAAUUGAUCUCGGN 29 And Paprika (U2C): N1 C GUAGUAN9-N 10 -N 11 GGAAGAAUUGAUCUCGGN 29 When comparing their identity, according to the definition of this invention, it should not include... N1, N9- N 10 -N H and N 29 The nucleotide bases are different, so their sequence identity comparison result is 96% (difference of 1 nucleotide).

[0129] Fluorescent molecules

[0130] The "fluorophore molecule" described in this invention is also called a "fluorophore" or "fluorescent molecule." In this invention, a "fluorophore molecule" is a type of fluorophore molecule that can be conditionally activated. They exhibit a low quantum yield in the absence of a nucleic acid aptamer. In specific embodiments, when not bound to a specific aptamer, the quantum yield of the fluorophore is less than 0.1, more preferably less than 0.01, and most preferably less than 0.001; when the fluorophore is bound to a specific aptamer, the quantum yield increases by more than 2 times, more preferably more than 10 times, and most preferably more than 100 times. The fluorophore molecule is preferably water-soluble, non-toxic to cells, and easily permeable to membranes. The fluorophores of this invention are preferably capable of entering the cytoplasm or periplasm through the cell membrane or cell wall via active transport or passive diffusion. In embodiments of this invention, the fluorophore can permeate the outer and inner membranes of Gram-negative bacteria, the cell wall and cell membrane of plant cells, the cell wall and cell membrane of fungi, the cell membrane of animal cells, and the GI and endothelial cell membranes of living animals.

[0131] The nucleic acid aptamer molecule described in this invention can specifically bind to a fluorophore, significantly increasing its fluorescence value under excitation at a specific wavelength. The fluorophore molecule is selected from structure (I):

[0132]

[0133] The electron donor portion -D is -NX1-X2, where X1 is selected from hydrogen, alkyl, or modified alkyl, and X2 is selected from hydrogen, alkyl, or modified alkyl. X1 and X2 are optionally connected to each other and together with the N atom form an alicyclic ring.

[0134] The conjugated system E is formed by at least one conjugated connection selected from double bonds, triple bonds, aromatic rings, and aromatic heterocycles, wherein each hydrogen atom contained herein is optionally independently substituted by a substituent selected from halogen atoms, hydroxyl groups, amino groups, primary amino groups, secondary amino groups, hydrophilic groups, alkyl groups, and modified alkyl groups, wherein the substituents are optionally connected to each other to form alicyclic or alicyclic rings.

[0135] X1 and X2 are independently linked to the conjugate structure E to form alicyclic heterocycles;

[0136] The electron acceptor A portion has a ring structure as shown in formula (I-1-a):

[0137]

[0138] Ra is independently selected from hydrogen, halogen atom, nitro, alkyl, aryl, heteroaryl, hydrophilic group or modified alkyl; R bThe group is independently selected from hydrogen, halogen atom, hydroxyl group, carboxyl group, amino group, nitro group, alkyl group, aryl group, heteroaryl group, hydrophilic group or modified alkyl group, or is a group formed by conjugation of a double bond with at least one of aromatic ring or aromatic heterocycle;

[0139] Each Y1 is independently selected from -O-, -S-, -(S=O)-, and -(NR-). i )-, where R i Selected from hydrogen, amino, alkyl, or modified alkyl;

[0140] Each Y2 is independently selected from =O, =S, =S=O, and =NR. i , where R i Selected from hydrogen, alkyl, or modified alkyl;

[0141] Each Y3 is independently selected from =O, =S, =S=O, and =NR. i , where R i Selected from hydrogen, alkyl, or modified alkyl;

[0142] Alternatively, each Y3 can be independently defined as =C(R). e (CN); where R e Selected from hydrogen, ester group, amide group, sulfonic acid group, sulfonamide group, and sulfonate group;

[0143] in,

[0144] The "alkyl" is C1-C. 30 A straight-chain or branched alkyl group; preferably, C1-C6. 10 Straight-chain or branched alkyl; preferably, C1-C7 straight-chain or branched alkyl; preferably, C1-C5 straight-chain or branched alkyl; preferably, selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, isopentyl, 1-ethylpropyl, neopentyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, isohexyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl, 2-ethylbutyl, n-heptyl, 2-methylhexyl, 3- Methylhexyl, 2,2-dimethylpentyl, 3,3-dimethylpentyl, 2,3-dimethylpentyl, 2,4-dimethylpentyl, 3-ethylpentyl or 2,2,3-trimethylbutyl;

[0145] The "modified alkyl" refers to any carbon atom of an alkyl group selected from halogen atoms, -O-, -OH, -CO-, -CS-, -NO2, -CN, -S-, -SO2-, -(S=O)-, The modified alkyl group is obtained by replacing at least one of the following groups: phenyl, phenylene, primary amino, secondary amino, tertiary amino, quaternary ammonium salt, saturated or unsaturated monocyclic or bicyclic cyclic hydrocarbon group, biaromatic heterocycle, and bridged aliphatic heterocycle. The modified alkyl group has 1 to 30 carbon atoms, and its carbon-carbon single bond is optionally and independently replaced by a carbon-carbon double bond or a carbon-carbon triple bond.

[0146] The substitution of carbon atoms refers to the substitution of carbon atoms or carbon atoms together with hydrogen atoms thereon by corresponding groups;

[0147] The "alicyclic ring" is a saturated or unsaturated 4- to 10-membered monocyclic or polycyclic alicyclic ring;

[0148] The "aliphatic ring" is a saturated or unsaturated 4- to 10-membered monocyclic or polycyclic aliphatic ring containing at least one heteroatom selected from N, O, S or Si. When the aliphatic ring contains an S atom, it is -S-, -SO- or -SO2-. The aliphatic ring may be optionally substituted with a halogen atom, nitro group, alkyl group, aryl group, hydrophilic group or modified alkyl group.

[0149] The "aryl or aromatic ring" is a 5- to 10-membered monocyclic or fused bicyclic aromatic group;

[0150] The "heteroaryl or aromatic heterocyclic" refers to a 5- to 10-membered monocyclic or fused bicyclic heteroaromatic group containing at least one heteroatom selected from N, O, S, or Si.

[0151] The halogen atoms are each independently selected from F, Cl, Br, and I;

[0152] The "hydrophilic group" is a hydroxyl group, a sulfonic acid group, a carboxyl group, a phosphite group, a primary amino group, a secondary amino group, or a tertiary amino group;

[0153] The “bridged alicyclic ring” is a 5- to 20-membered bridged alicyclic ring containing at least one heteroatom selected from N, O, or S.

[0154] The “ester group” is an R(C=O)OR' group;

[0155] The “phosphite group” RP(=O)(OH)2 group;

[0156] The “sulfonic acid group” is an RSO3H group;

[0157] The “sulfonate group” is an RSO3 R' group;

[0158] The “sulfonate amino group” is an RSO2NR'R” group;

[0159] The "primary amine" is an RNH2 group;

[0160] The "secondary amino" is an RNHR' group;

[0161] The "tertiary amino" is an RNR'R" group;

[0162] The “quaternary ammonium salt group” R R'R”R”'N+ group;

[0163] Each R, R', R”, R”' is independently a single bond, alkyl, alkylene, modified alkyl or modified alkylene, wherein the modified alkyl or modified alkylene is a group obtained by replacing any carbon atom of a C1-C10 (preferably C1-C6) alkyl or alkylene with a group selected from -O-, -OH, -CO-, -CS-, -(S=O)-.

[0164] Optionally, the modified alkyl or modified alkylene group is independently a group containing at least one group selected from -OH, -O-, ethylene glycol unit (-(CH2CH2O)n-), C1-C8 alkyl, C1-C8 alkoxy, C1-C8 acyloxy, C1-C8 haloalkyl, monosaccharide group, disaccharide group, polysaccharide group, -O-CO-, -NH-CO-, -(-NH-CHR””-CO-)n-, -SO2-O-, -SO-, -SO2-NH-, -SS-, -CH=CH-, halogen atom, cyano, nitro, o-nitrophenyl, benzoylmethyl, phosphate ester group, wherein n is 1-100, preferably 1-50, more preferably 1-30, more preferably 1-10; R”” is a residue of H or α amino acid; the “phosphate ester group” has the definition as described above;

[0165] The “monosaccharide unit” is a sugar unit that cannot be easily hydrolyzed into smaller sugar molecules;

[0166] The "disaccharide unit" is a sugar unit formed by the dehydration of two monosaccharides;

[0167] The “polysaccharide unit” is a sugar unit formed by the dehydration of more than ten monosaccharides;

[0168] Optionally, the C1-C8 alkyl group is methyl, ethyl, propyl, or isopropyl; the C1-C8 alkoxy group is methoxy, ethoxy, propoxy, or isopropoxy; the C1-C8 acyloxy group is acetoxy, ethyl, propyl, or isopropyl; and the C1-C8 haloalkyl group is trifluoromethyl, chloromethyl, or bromomethyl.

[0169] Optionally, the alicyclic ring is selected from azacyclic butane, pyrrolidine, piperidine, tetrahydrofuran, tetrahydropyran, morpholine, and thiomorpholine.

[0170] Optionally, the conjugate system E is selected from the structures of the following formulas (I-2-1) to (I-2-39):

[0171]

[0172]

[0173] Optionally, the conjugated system E and -NX1-X2 form an alicyclic heterocycle as shown in (I-3-1) (I-3-5):

[0174]

[0175] Alternatively, the conjugate system E and -NX1-X2 form the structure shown in (I-3-6):

[0176]

[0177] Optionally, the electron acceptor portion is selected from one of the following formulas (I-4-1) to (I-4-42):

[0178]

[0179]

[0180] Optionally, the fluorescent probe described above is characterized in that the fluorescent probe formula (I) is selected from compounds of the following formula:

[0181]

[0182]

[0183]

[0184]

[0185]

[0186] In a preferred embodiment of the present invention, the fluorophore molecules include I-5-1, I-5-2, I-5-3, I-5-4, I-5-5, I-5-6, I-5-7, I-5-8, I-5-9, I-5-10, I-5-11, I-5-12, I-5-13, I-5-14, I-5-15, I-5-16, I-5-17, I-5-18, I-5-19, I-5-20, I-5-21, I-5-22, I-5-23, I-5-24, I-5-25, I-5-26, I-5-27, I-5-28, I-5-29, I-5-30, I-5-31, I-5-32, I-5-33, I-5-34, I-5-35, I-5-36, I-5-37, I-5-38, I-5-39, I-5-40, I-5-41, I-5-42, I-5-43, I-5-44, I-5-45, I-5-46, I-5-47, I-5-48, I-5-49, I-5-50, I-5-51, I-5-52, I-5-53, I-5-54, I-5-55, I-5-56, I-5-57, I-5-58, I-5-59, I-5-60, I-5-61, I-5-62, I-5-63, I-5-64, I-5-65, I-5-66, I-5-67, I-5-68, I-5-69, I-5-70, I-5-71, I-5-72, I-5-73, I-5-74, I-5-75, I-5-76, I-5-77, I-5-78, I-5-79, I-5-80, I-5-81, I-5-82, I-5-83, I-5-84. In this invention, "increased fluorescence signal," "increased fluorescence," "increased fluorescence intensity," and "increased fluorescence intensity" refer to an increase in the quantum yield of the fluorophore under irradiation with excitation light of a suitable wavelength, or a shift in the maximum emission peak of the fluorescence signal (relative to the emission peak of the fluorophore itself in ethanol or aqueous solution), or an increase in the molar extinction coefficient, or two or more of the above.In a preferred embodiment of the present invention, the increase in quantum yield is at least 2 times; in another preferred embodiment of the present invention, the increase in quantum yield is at least 5-10 times; in another more preferred embodiment of the present invention, the increase in quantum yield is at least 20-50 times; in another more preferred embodiment of the present invention, the increase in quantum yield is at least 100-200 times; in another more preferred embodiment of the present invention, the increase in quantum yield is at least 500-1000 times; in another more preferred embodiment of the present invention, the increase in quantum yield is at least 1000-10000 times; in another more preferred embodiment of the present invention, the increase in quantum yield is greater than 10000 times; the light source used to excite the fluorophore to generate a fluorescence signal can be any suitable illumination device, such as LED lamps, incandescent lamps, fluorescent lamps, and lasers; the excitation light can be emitted directly from these devices or indirectly obtained through other fluorophores, such as the donor fluorophore of FRET or the donor luminescent group of BRET.

[0187] target molecules

[0188] The target molecules described in this invention can be any biological material or small molecule, including but not limited to: proteins, nucleic acids (RNA or DNA), lipid molecules, carbohydrates, hormones, cytokines, chemokines, metabolites, metal ions, etc. The target molecules can be molecules associated with diseases or pathogenic infections.

[0189] Through the aptamer molecules described in this invention, such as Figure 1 In the structure shown in B, the inserted nucleotide sequence replaces... Figure 1 N9 and N in A 10 N 11 The stem-loop structure of this nucleotide sequence allows it to specifically recognize and bind to target molecules. When the target molecule is absent, the aptamer molecule does not bind to the fluorophore molecule or has a weak binding affinity, failing to significantly enhance the fluorescence of the fluorophore molecule under appropriate wavelength excitation light. However, when the target molecule is present, the binding of the target molecule to the nucleotide sequence promotes the binding of the aptamer molecule to the fluorophore molecule, significantly enhancing the fluorescence of the fluorophore molecule under appropriate wavelength excitation light, thus enabling the detection, imaging, and quantitative analysis of the target molecule.

[0190] Target molecules can be the entire cell or molecules expressed on the entire cell surface. Typical cells include, but are not limited to, cancer cells, bacterial cells, fungal cells, and normal animal cells. Target molecules can also be viral particles. Currently, many aptamers for the above-mentioned target molecules have been identified, and they can be integrated into the multivalent nucleic acid aptamers of this invention. Reported RNA aptamers that can bind to target molecules include, but are not limited to: T4 RNA polymerase aptamer, HIV reverse transcriptase aptamer, and bacteriophage R17 capsid protein aptamer.

[0191] Target nucleic acid molecules

[0192] "Target nucleic acid molecule," also known as "target nucleic acid molecule," refers to the nucleic acid molecule to be detected, which can be intracellular or extracellular; including target RNA molecules and target DNA molecules. This invention achieves the purpose of detecting the content and distribution of target nucleic acid molecules by linking the target nucleic acid molecule to the nucleic acid aptamer molecule and by binding the fluorophore molecule to the nucleic acid aptamer molecule, significantly increasing the fluorescence value of the fluorophore molecule under excitation light of a suitable wavelength.

[0193] In this invention, "target RNA molecule" includes any RNA molecule, including but not limited to pre-mRNA, mRNA encoding the cell's own or exogenous expression products, pre-rRNA, rRNA, tRNA, hnRNA, snRNA, miRNA, siRNA, shRNA, sgRNA, crRNA, long non-coding RNA, MS2 RNA (containing the MCP recognition-binding sequence of phage capsid protein), PP7 RNA (containing the PCP recognition-binding sequence of phage capsid protein), and boxB RNA (containing the N recognition-binding sequence of λ phage transcription termination protein). The target RNA can be fused to the 5' or 3' end of the RNA aptamer molecule of this invention. N 25 -N 26 -N 27 Location .

[0194] In this invention, "sgRNA" refers to a single guide RNA (sgRNA) formed by modifying tracrRNA and crRNA in the CRISPR / Cas9 system. Its 5' end sequence of about 20 nt targets DNA sites through base pair complementarity, causing the Cas9 protein to induce DNA double-strand breaks at those sites.

[0195] tandem of nucleic acid aptamers

[0196] The nucleic acid aptamer molecule described in this invention may further comprise a tandem linker capable of binding multiple fluorophore molecules. The tandem linker is linked together by a spacer sequence of appropriate length, and the number of tandem Paprika-1 structures can be 2, 3, 4, 5, 6, 7, 8, 9, 10, or more. The tandem linker can take various forms; in a preferred embodiment of this invention, the tandem form is "tandem 1," such as... Figure 6 As shown in A, the preferred nucleotide sequences are SEQ ID NO: 6 and 7; where 2Paprika-4 represents a tandem unit 1 having two Paprika-4 structures; in another preferred embodiment of the invention, the tandem form is "tandem 2", such as Figure 6As shown in B, the preferred nucleotide sequences are SEQ ID NO: 8 and 9; where 2xPaprika-5 represents a tandem form 2 having two Paprika-5 structures; in another preferred embodiment of the invention, the tandem form is "tandem 3", such as Figure 6 As shown in C, the preferred nucleotide sequences are SEQ ID NO: 10 and 11; where 2x2Paprika-4 represents a tandem unit 3 having two 2Paprika-4 structures; regardless of the form, the spacer sequence between the tandem units can be changed.

[0197] The monomeric aptamer described in this invention refers to an aptamer containing only one Paprika-1 structure, that is, containing two stem structures, two loop structures, and one stem-loop structure. Figure 1 B) aptamers.

[0198] Multimeric aptamers refer to aptamers containing one or more Paprika-1 structures, including but not limited to... Figure 6 The aptamers shown are composed of several series connection configurations.

[0199] Aptamer-fluorophore complex

[0200] The aptamer-fluorophore complex of the present invention comprises one nucleic acid aptamer molecule and one or more fluorophore molecules. In one specific embodiment of the present invention, the molecular complex comprising one nucleic acid molecule and one fluorophore molecule is F30-Paprika-1-I-5-57.

[0201] In another specific embodiment of the invention, a tandem nucleic acid molecule forms a complex with multiple fluorophore molecules, such as the complex F30-4Paprika-4×(I-5-57) formed by F30-4Paprika-4 containing four aptamer units and four fluorophore molecules in a "tandem 1" configuration. The molecular complex can exist in vitro in two separate solutions, or in the same solution, or intracellularly.

[0202] Nucleic acid aptamer function

[0203] The aptamer function of this invention refers to its ability to significantly increase the fluorescence intensity of fluorophore molecules under excitation light of a suitable wavelength. Nucleic acid aptamers can be prepared using the commonly used experimental method (I) in the specific embodiments, and the fluorescence value can be detected according to the commonly used experimental method (II) in the embodiments. In a preferred embodiment of this invention, the increase in fluorescence intensity is at least 2 times; in another preferred embodiment, the increase in fluorescence intensity is at least 5-10 times; in another more preferred embodiment, the increase in fluorescence intensity is at least 20-50 times; in another more preferred embodiment, the increase in fluorescence intensity is at least 100-200 times; and in another more preferred embodiment, the increase in fluorescence intensity is at least 200-2000 times.

[0204] Nucleic acid aptamer secondary structure

[0205] The secondary structure of the nucleic acid aptamer in this patent was predicted using the mFold online analysis software (http: / / www.unafold.org / RNA_form.php). The stem structure in the secondary structure refers to a local double-stranded structure formed by complementary hydrogen bonding in certain regions within the single strand of the nucleic acid aptamer molecule. Generally, the formation of a double-stranded structure does not require all nucleotides in that region to be complementary; typically, N1 and N... 29 and N9 and N 11 A stem structure is formed when at least 50% of the nucleotides in one segment of a sequence undergo complementary pairing with another segment. If N1 and N... 29 If it is a single nucleotide, then N1 and N are required. 29 Only complete complementarity can form a stem structure (e.g.) Figure 1 (As shown in A).

[0206] DNA molecules expressing nucleic acid aptamers

[0207] The DNA molecule contains a DNA sequence that can encode the nucleic acid aptamer molecule of the present invention. The DNA molecule contains the nucleotide sequence R1TGTAGTAR9-R. 10 -R 11 GGAAGAATTGATCTCGGN 29 And its nucleotide sequence with at least 58% identity. R1 encodes N1 in the general formula Paprika, and R9 encodes N9 in the general Paprika structure. 10 The N in the general Paprika structure encoding formula 10 R 11 The N in the general Paprika structure encoding formula 11 R 29 The N in the general Paprika structure encoding formula29 The DNA molecule may further include a promoter that controls DNA transcription, and the promoter is operatively linked to a DNA sequence encoding a nucleic acid aptamer. In one embodiment of the invention, the DNA molecule includes a U6 promoter; in another embodiment, the DNA molecule includes a CMV promoter. The DNA molecule may further include a DNA sequence encoding any target nucleic acid molecule. In one embodiment of the invention, the DNA molecule encoding the target RNA includes a DNA sequence encoding fibrous actin ACTB (the sequences of the chimeric RNA are SEQ ID No: 14).

[0208] promoter

[0209] In this invention, "promoter" includes both eukaryotic and prokaryotic promoters. The promoter sequences of eukaryotic cells are completely different from those of prokaryotic cells. Generally, eukaryotic promoters cannot be recognized by RNA polymerases in prokaryotic cells to mediate RNA transcription. Similarly, prokaryotic promoters cannot be recognized by RNA polymerases in eukaryotic cells to mediate RNA transcription. The strength of different promoters varies greatly (strength refers to the ability to mediate transcription). Depending on the application, strong promoters can be used to achieve high levels of transcription. For example, high levels of expression are better for labeling, while lower levels of transcription allow cells to process transcription more effectively when evaluating transcriptional behavior. Depending on the host cell, one or more suitable promoters can be selected. For example, when used in *E. coli* cells, the T7 phage promoter, lac promoter, trp promoter, recA promoter, ribosomal RNA promoter, PR and PL promoters in λ phage, and other promoters, but not limited to: lacUV5 promoter, ompF promoter, bla promoter, lpp promoter, etc. Furthermore, a hybrid trp-1acUV5 promoter (tac promoter) or other E. coli promoters obtained through recombinant or synthetic DNA technology can be used to transcribe the RNA aptamer described in this invention. Some operator sequences inherent in bacteria can combine with promoter sequences to form inducible promoters, in which case specific inducers are required to induce DNA transcription. For example, the lac operator requires the addition of lactose or a lactose analog (IPTG) to induce its expression; other operators include trp, pro, etc.

[0210] As mentioned above, the regulatory sequence at the 5' end of the coding sequence of a DNA molecule is the promoter. Whether obtaining RNA aptamers through in vitro transcription or expressing aptamers in cultured cells or tissues, it is necessary to select an appropriate promoter based on its strength. Since in vivo expression of aptamers can be genetically manipulated, another type of promoter is the inducible promoter, which responds to specific environmental conditions to induce DNA transcription, such as expression in specific tissues, at specific times, or at specific developmental stages. These different promoters can be recognized by RNA polymerases I, II, or III.

[0211] Transcription initiation in eukaryotic cells requires suitable promoters, including but not limited to β-globulin promoters, CAG promoters, GAPDH promoters, β-actin promoters, actin promoters, Cstf2t promoters, SV40 promoters, PGK promoters, MMTV promoters, adenovirus Ela promoters, and CMV promoters. Transcription termination in eukaryotic cells depends on specific cleavage sites in the RNA sequence. Similarly, different RNA polymerase transcription genes have significantly different transcription terminators. However, screening for suitable 3' transcription terminator regions is a routine experimental skill in human-derived transcription.

[0212] Expression System

[0213] The "expression system" of this invention, also known as an "expression vector," comprises a DNA molecule integrated with an expression nucleic acid aptamer. The expression system of this invention can be a plasmid or a viral particle.

[0214] "Expression vector" recombinant viruses can be obtained by transfecting plasmids into virus-infected cells. Suitable vectors include, but are not limited to, viral vectors such as the λ vector system gt11, gt WES.tB, Charon 4, and plasmid vectors including pBR322, pBR325, pACYC177, pACYC184, pUC8, pUC9, pUC18, pUC19, pLG399, pR290, pKC37, pKC101, pBluescript II SK+ / - or KS+ / - (see Stratagene cloning system), pET28 series, pACYCDuet1, pCDFDuet1, pRSET series, pBAD series, pQE, pIH821, pGEX, pIIIEx426 RPR, etc.

[0215] Numerous host expression systems can be used to express the DNA molecules described in this invention. Primarily, the vector system must be compatible with the host cell used. Host vector systems include, but are not limited to: bacteria containing transformed bacteriophage DNA, plasmid DNA, or Cos plasmid DNA; yeast containing a yeast vector; virus-infected mammalian cells (e.g., adenovirus, adeno-associated virus, retrovirus); virus-infected insect cells (e.g., baculovirus); and plant cells infected with bacteria or transformed via particle bombardment. The strength and characteristics of the expression elements in the vectors vary considerably. Any one or more suitable transcription elements are selected depending on the host-vector system used.

[0216] Once the constructed DNA molecules are cloned into a vector system, they can be easily transferred into host cells. Depending on the vector or host cell system, methods include, but are not limited to, transformation, transduction, conjugation, fixation, and electroporation.

[0217] In one specific embodiment of the present invention, expression plasmids pET28a-T7-F30-Paprika-1 and pLKO.1-F30-Paprika-1 containing a DNA molecule encoding F30-Paprika-1 RNA are provided. In another specific embodiment of the present invention, expression plasmid pLKO.1-F30-5x (F30-2xPaprika-1) containing a DNA molecule encoding F30-2xPaprika-1 RNA is provided. In another specific embodiment of the present invention, expression plasmids pCDNA3.1 / hygro(+)-EGFP-F30-5x (F30-2xPaprika-1) and pCDNA3.1 / hygro(+)-ACTB-F30-5x (F30-2xPaprika-1) containing a DNA molecule encoding EGFP-F30-5x (F30-2xPaprika-1) and ACTB-F30-5x (F30-2xPaprika-1) are provided. In another specific embodiment of the present invention, an expression plasmid pLKO.1-Paprika-1-MS2 containing a DNA molecule encoding Paprika-1-MS2 is provided.

[0218] This invention also provides an expression vector that integrates a DNA molecule encoding a nucleic acid aptamer, but with a gap in the DNA sequence encoding the target RNA molecule. The gap in the DNA sequence encoding the target RNA molecule allows the user to select the DNA sequence of the target RNA molecule to be detected, such as the DNA sequence corresponding to GAPDH mRNA. The DNA sequence is inserted into this expression vector using standard recombinant DNA technology. The obtained expression vector is then introduced into host cells (transfection, transformation, infection, etc.) to detect the content and distribution of the target RNA.

[0219] host cells

[0220] In this invention, "host cell" includes, but is not limited to, bacteria, yeast, mammalian cells, insect cells, plant cells, zebrafish cells, fruit fly cells, and nematode cells. More preferably, the host cell is a cultured in vitro cell or a whole in vivo living tissue. The host cells in this invention include, but are not limited to, 297T, COS-7, BHK, CHO, HEK293, HeLa, H1299, fertilized egg stem cells, induced pluripotent stem cells, and primary cells directly isolated from mammalian tissues; the *E. coli* cells include, but are not limited to, BL21(DE3), BL21(DE3, Star), TOP10, Mach1, and DH5α; and the yeast cells include, but are not limited to, BY4741, BY4742, and AH109.

[0221] Detection array

[0222] The detection array of the present invention comprises one or more nucleic acid aptamer molecules of the present invention, wherein the nucleic acid aptamer molecules are anchored at discrete positions on the array surface, and the array surface is composed of a solid support, including but not limited to glass, metal, ceramic, etc. The nucleic acid aptamer molecules of the present invention can be anchored to the array surface by, but is not limited to, the following methods: (1) labeling the 5' or 3' end of the nucleic acid aptamer molecule with biotin, coating streptavidin on the array surface, and anchoring the nucleic acid aptamer molecule through the specific binding of biotin and streptavidin; (2) fusing the phage capsid protein MCP recognition-binding sequence MS2, the phage capsid protein PCP recognition-binding sequence PP7, or the λ phage transcription termination protein N recognition-binding sequence boxB RNA sequence into the 5', 3', or stem-loop structure of the nucleic acid aptamer molecule, and using the proteins MCP, PP7, or λ that they recognize and bind to. N Proteins are coated on the array surface via MS2 with MCP protein, PP7 with PCP protein, or boxBRNA with λ. N The specific action of the protein anchors the nucleic acid aptamer molecule; (3) an RNA or DNA sequence is fused to the 5' or 3' end of the nucleic acid aptamer molecule, and an RNA sequence complementary to the RNA sequence or a DNA sequence complementary to the DNA sequence is anchored on the array surface. The nucleic acid aptamer molecule is anchored on the array surface through the principle of molecular hybridization. The detection array can be used to detect the presence and concentration of the target molecule. Therefore, the nucleic acid aptamer molecule will bind to the fluorophore molecule only in the presence of the target molecule, significantly increasing its fluorescence intensity at a suitable excitation wavelength. Within a certain range, the higher the concentration of the target molecule, the higher the fluorescence intensity.

[0223] Reagent test kit

[0224] The kit of the present invention comprises the nucleic acid aptamer molecule and / or fluorophore molecule described in the present invention, and corresponding instructions; or comprises an expression system expressing the nucleic acid aptamer molecule and / or fluorophore molecule, and corresponding instructions; or comprises a host cell expressing the nucleic acid aptamer molecule expression system and / or fluorophore molecule, and corresponding instructions. The nucleic acid aptamer molecule and fluorophore molecule in the kit are present in separate solutions, or the nucleic acid aptamer molecule and fluorophore molecule are in the same solution. Detailed Implementation

[0225] The present invention will be further illustrated by the following examples. These examples are merely illustrative and do not constitute any limitation on the scope of the invention. The examples primarily employ conventional molecular biology cloning methods in genetic engineering, methods well-known to those skilled in the art, such as relevant chapters in Jane Rothschild et al.'s *Molecular Biology Laboratory Manual* and J. Sambrook and DW Russell's *Molecular Cloning: A Laboratory Manual* (3rd edition, August 2002, Science Press, Beijing). Those skilled in the art can readily implement the present invention by making slight modifications and variations according to specific circumstances, based on the following examples.

[0226] The pCDNA3.1 / hygro(+) plasmid vector used in the examples was purchased from Invitrogen, the pLKO.1-puro plasmid vector from Sigma, the pET28a plasmid vector from Novagen, and the pYES2.1TOPO TA plasmid vector from Invitrogen. All PCR primers used in the examples were synthesized, purified, and identified correctly by mass spectrometry by Shanghai Jierui Biotechnology Co., Ltd. The Taq DNA polymerase used in the examples was purchased from Shanghai Yisheng Biotechnology Co., Ltd., and the PrimeSTAR DNA polymerase was purchased from TaKaRa. Corresponding polymerase buffers and dNTPs were included with each purchase. Restriction endonucleases such as EcoRI, BamHI, BglII, HindIII, NdeI, XhoI, SacI, XbaI, and SpeI, as well as T4 ligase, T4 phosphorylase (T4 PNK), and T7 RNA polymerase were purchased from Fermentas, along with corresponding buffers. Kanamycin and ampicillin were purchased from Ameresco. The expression plasmids constructed in the examples were sequenced by J. Lee Sequencing.

[0227] The DNA purification kits used in these examples were purchased from BBI (Canada), the general plasmid extraction kits were purchased from Tiangen Biotech (Beijing) Co., Ltd., and HieffClone was used. TM One-Step Cloning Kit was purchased from Shanghai Yisheng Biotechnology Co., Ltd., and Eastep Super Total RNA Extraction Kit was purchased from Promega. BL21(DE3, Star) strain was purchased from Invitrogen. 293T / 17 cells and COS-7 cells were purchased from the Cell Bank of the Chinese Academy of Sciences Type Culture Collection Committee. 384-well and 96-well fluorescence detection blackboards were purchased from Grenier. DFHBI-1T and DFHO were purchased from Lucerna. All chemical reagents used in the examples were purchased directly from chemical reagent companies such as Titan Technology, Bidex Pharmaceuticals, and Leyan, without further purification. Drying solvents such as methanol and dichloromethane used in the experiments were purchased directly from Titan Technology without further processing.

[0228] The main instruments used in the examples are: SynergyNeo2 multi-functional microplate reader (Bio-Tek, USA), X-15R high-speed refrigerated centrifuge (Beckman, USA), Microfuge22R benchtop high-speed refrigerated centrifuge (Beckman, USA), PCR amplifier (Biometra, Germany), in vivo imaging system (Kodak, USA), photometer (Wako Corporation, Japan), nucleic acid electrophoresis system (Shenneng Bocai Company), Bruker Avance 600 (400MHz) nuclear magnetic resonance spectrometer, Micromass GCT™ mass spectrometer, Micromass LCT™ mass spectrometer, Leica SP8 laser confocal microscope, and Zeiss Elyra PS.1 super-resolution imaging microscope.

[0229] The abbreviations have the following meanings: "h" refers to hour, "min" refers to minute, "s" refers to second, "d" refers to day, "μL" refers to microliter, "ml" refers to milliliter, "L" refers to liter, "bp" refers to base pair, "mM" refers to millimole, and "μM" refers to micromolar.

[0230] Commonly used experimental methods and materials in the embodiments

[0231] (I) Preparation of nucleic acid aptamer molecules:

[0232] The cDNA corresponding to the RNA to be detected was amplified using primers containing the T7 promoter. RNA was obtained by transcription using the recovered double-stranded cDNA as a template, employing T7 RNA polymerase (purchased from Fermentas). To a 20 μL transcription system, 10 μL of 3M NaAc and 115 μL of DEPC water were added, mixed, and then 150 μL of a phenol-chloroform-isopropanol mixture (phenol:chloroform:isopropanol = 25:24:1) was added. The mixture was vortexed, centrifuged at 10,000 rpm for 5 min, and the supernatant was collected. An equal volume of chloroform solution was added, vortexed, and centrifuged at 10,000 rpm for 5 min. This process was repeated once. 2.5 volumes of anhydrous ethanol were added to the supernatant, and the mixture was incubated at -20°C for 30 min, centrifuged at 12,000 rpm for 5 min at 4°C, and the supernatant was discarded. The precipitate was washed twice with pre-cooled 75% anhydrous ethanol. After the ethanol has evaporated, add an appropriate amount of screening buffer to resuspend the precipitate, treat at 75°C for 5 min, and let stand at room temperature for at least 10 min before use in subsequent experiments.

[0233] (II) Functional detection of nucleic acid aptamers

[0234] Paprika or Paprika mutant nucleic acid aptamer molecules were prepared according to common experimental method (I). 2.5 μM of the nucleic acid aptamer molecule and 0.5 μM of the fluorophore molecule were incubated in detection buffer (40 mM HEPES, pH 7.4, 125 mM KCl, 5 mM MgCl2, 5% DMSO). The maximum excitation and emission peaks of the nucleic acid aptamer-fluorophore molecule complex were detected using a Synergy Neo2 multi-mode microplate reader. The fluorescence intensity of the nucleic acid aptamer-fluorophore molecule complex under its maximum excitation and emission conditions was then detected using the Synergy Neo2 multi-mode microplate reader. The control sample (1 μM fluorophore molecule without nucleic acid aptamer) was also measured under the same conditions, and the ratio of fluorescence intensity was calculated. For example, the maximum excitation peak of the complex formed by 2.5 μM Paprika-1 nucleic acid aptamer and 0.5 μM I-5-57 fluorophore molecule was 594 nm, and the maximum emission peak was 658 nm. The fluorescence intensity of the complex under excitation conditions of 594±10 nm and emission conditions of 658 nm±10 nm was 19567 using a Synergy Neo2 multi-functional microplate reader, while the fluorescence intensity of the control (0.5 μM I-5-57 fluorophore molecule) was 11 under the same detection conditions. Therefore, the activation factor of Paprika-1 nucleic acid aptamer for I-5-57 fluorophore molecule was 1779-fold.

[0235] (III) Construction of recombinant plasmids based on homologous recombination method

[0236] 1. Preparation of linearized vectors: Select appropriate cloning sites and linearize the vectors. Linearized vectors can be prepared by enzyme digestion or reverse PCR amplification.

[0237] 2. PCR amplification to prepare the insert fragment: By introducing a 15-25 bp (excluding restriction sites) homologous sequence from the linearized vector terminal end into the 5' end of the forward and reverse PCR primers of the insert fragment, the 5' and 3' ends of the insert fragment PCR product contain sequences that are completely identical to those at the two ends of the linearized vector.

[0238] 3. Concentration determination of linearized vector and insert fragment: The linearized vector and insert fragment amplification products were diluted several times with equal volumes. 1 μL of the original product and the diluted product were taken for agarose gel electrophoresis. The band brightness was compared with the DNA molecular weight standard (DNA Marker) to determine their approximate concentration.

[0239] 4. Recombination reaction

[0240] The optimal amount of carrier used in the recombination reaction system is 0.03 pmol; the optimal molar ratio of carrier to insert fragment is 1:2-1:3, that is, the optimal amount of insert fragment used is 0.06-0.09 pmol.

[0241]

[0242] X and Y are the linearized vector and insert fragment calculated according to the formula, respectively. After the system is prepared, mix all components thoroughly and react at 50°C for 20 min. When the insert fragment is >5kb, the incubation time can be extended to 25 min. After the reaction is complete, it is recommended to cool the reaction tube on ice for 5 min. The reaction product can be directly converted or stored at -20°C and thawed for conversion when needed.

[0243] (iv) Cell culture and transfection:

[0244] In this example, all 293T / 17 cells were cultured in a CO2 incubator using high-glucose medium (RPMI) containing 10% fetal bovine serum (FBS), streptomycin, and penicillin. All COS-7 cells were cultured in a CO2 incubator using high-glucose medium (DMEM) containing 10% fetal bovine serum (FBS), streptomycin, and penicillin. Cells were passaged when they reached 80-90% confluence. For transfection, [the following was used]. (Purchased from Promega) Follow the instructions.

[0245] (v) Fluorescence Imaging:

[0246] The main imaging experiment in this embodiment was performed using a Leica SP8 confocal laser microscope equipped with a white laser, with an HCXPLAPO 63x1.47 oil immersion microscope and a HyD detector.

[0247] Example 1. Secondary structure of Paprika nucleic acid aptamer molecule

[0248] The secondary structure of the Paprika aptamer was analyzed using the mFold online RNA structure analysis software. Paprika contains two stem structures, two loop structures, and one stem-loop structure. Figure 1 A). For one of the stem and stem-loop sequences, Paprika-1 (SEQ ID NO: 1) predicts the secondary structure ( Figure 1 B).

[0249] Example 2. Fluorescence activation effect of different Paprika-1 mutants on the I-5-57 fluorophore molecule.

[0250] To detect the fluorescence activation effect of different Paprika-1 mutants on the I-5-57 fluorophore, point mutations were performed on the Paprika-1 sequence as shown in Table 1. Paprika-1 mutant RNAs with different base mutations were prepared according to common experimental method (I). 0.5 μM I-5-57 was incubated with 2.5 μM of different Paprika-1 mutant RNAs, and the fluorescence activation factor for the I-5-57 fluorophore was measured according to common experimental method (II). The results showed that most Paprika-1 mutants with single-base mutations retained a strong fluorescence activation effect on I-5-57 (≥2-fold) (Table 2). Some Paprika-1 mutants with 2-5 base mutations also retained a strong fluorescence activation effect on I-5-57 (>20-fold) (Table 3). In summary, many single-base and multi-base mutants of Paprika-1 can still retain the aptamer function of activating the I-5-57 fluorophore.

[0251] Table 2. Activation effect of Paprika-1 mutants containing single-base mutations on I-5-57.

[0252]

[0253]

[0254] Note: Paprika-1 in Table 2 is the nucleic acid aptamer with the sequence SEQ ID NO: 1; the other aptamers are those that are identical to Paprika-1 in the sequence. Figure 1 A point mutation was performed at the corresponding nucleotide position of Paprika-1 in B.

[0255] Table 3. Activation effect of Paprika-1 mutants containing multiple base mutations on I-5-57.

[0256] mutant Activation multiplier mutant Activation multiplier Paprika-1 1779 U4A / G12A / G13U 362 A5U / U25A 252 U4A / G12A / G16A 278 A5C / U25G 168 U4A / G12A / G16A 298 A5G / U25C 152 U4A / G12A / A22C 314 G6A / C24U 175 G12A / G13U / G16A 318 G6U / C24A 121 G12A / G13U / U20C 308 G6C / C24G 152 G12A / G13U / A22C 298 U4A / G12A 254 G13U / G16A / U20C 215 U4A / G13U 396 G13U / G16A / A22C 198 U4A / G16A 287 G16A / U20C / A22C 187 U4A / U20C 102 U4A / G12A / G13U / G16A / U20C 102 U4A / A22C 396 U4A / G12A / G13U / G16A / A22C 149 G12A / G13U 176 U4A / G13U / G16A / U20C / A22C 156 G12A / G16A 258 U4A / G12A / G16A / U20C / A22C 97 G12A / U20C 326 U4A / G12A / G13U / U20C / A22C 145 G12A / A22C 317 A5U / U25A / U4A / G12A / G13U 34 G13U / G16A 289 A5U / U25A / U4A / G12A / G16A 67 G13U / U20C 265 A5U / U25A / / U4A / G12A / G16A 122 G13U / A22C 382 G6A / C24U / U4A / G12A / A22C 57 G16A / U20C 194 G6A / C24U / G12A / G13U / G16A 201 G16A / A22C 125 G6A / C24U / G12A / G13U / U20C 121 U20C / A22C 389 G6A / C24U / G12A / G13U / A22C 165

[0257] Example 3. Secondary structure of Paprika-1 nucleic acid aptamer molecule

[0258] The secondary structure of the Paprika-1 (SEQ ID NO: 1) aptamer was analyzed using the mFold online RNA structure analysis software. Figure 1 B). Secondary structure of the F30-Paprika-1 (SEQ ID NO: 2) aptamer obtained by RNA ligation using the F30 scaffold ( Figure 2 A). Secondary structure of the tRNA-Paprika-1 (SEQ ID NO: 3) aptamer obtained by RNA ligation using tRNA scaffolding ( Figure 2 B).

[0259] Example 4. Spectral property identification of the Paprika-1-I-5-57 complex

[0260] To test whether the Paprika-1-I-5-57 complex could be activated by ultraviolet light, Paprika-1 (SEQ ID NO: 2) RNA was prepared according to common experimental method (I). 2 μM I-5-57 was incubated with 10 μM Paprika-1. The results showed that solutions of I-5-57 fluorophores alone, solutions of I-5-57 fluorophores with added negative control RNA, and solutions of Paprika-1 and I-5-57 fluorophores containing RNase A all showed no obvious fluorescence under ultraviolet light. However, the mixture of Paprika-1 and I-5-57 fluorophores emitted bright red fluorescence under ultraviolet light. Figure 3 A).

[0261] To detect the spectral properties of the Paprika-1-I-5-57 complex, Paprika-1 (SEQ ID NO: 1) RNA was prepared according to common experimental method (I). 1 μM I-5-57 was incubated with 5 μM Paprika-1. The results showed that the maximum excitation light of the Paprika-1-I-5-57 complex was 594 nm, and the maximum emission light was 658 nm. Figure 3 B).

[0262] To detect the difference in light absorption between the Paprika-1-I-5-57 complex and the I-5-57 fluorophore itself, 2 μM I-5-57 was incubated with 10 μM Paprika-1, or 5 μM I-5-57 alone. The light absorption of I-5-57 and the Paprika-1-I-5-57 complex was then measured. The results showed that the maximum light absorption of I-5-57 was 539 nm, while the maximum light absorption of the Paprika-1-I-5-57 complex exhibited a significant redshift relative to I-5-57 itself, with a maximum absorption of 588 nm. Figure 3 C).

[0263] To determine the binding constant of Paprika-1 to I-5-57, 2 nM Paprika-1 was incubated with different concentrations of I-5-57, and their fluorescence values ​​were measured. The results showed that the binding constant of Paprika-1 to I-5-57 was 2.2 ± 0.2 nM. Figure 3 D).

[0264] Example 5. Stability identification of the Paprika-1-I-5-57 complex

[0265] To assess the stability of the Paprika-1-I-5-57 complex at different pH values, the complex was placed in different pH environments for 60 min, and fluorescence values ​​were measured. The results showed that the Paprika-1-I-5-57 complex maintained a high fluorescence signal within the pH range of 5-9. Figure 4 A) indicates that the Paprika-1-I-5-57 complex has good pH stability.

[0266] To investigate the effect of the Paprika-1-I-5-57 complex on Mg 2+ The ion dependence was investigated by incubating 1 μM Paprika-1 and 5 μM I-5-57 in buffer solutions containing different magnesium ion concentrations. The results showed that the magnesium ion concentration had almost no effect on the fluorescence of the Paprika-1-I-5-57 complex. Figure 4 B) indicates that the Paprika-1-I-5-57 complex has good magnesium ion stability.

[0267] To test the temperature stability of Paprika-1, a solution containing 5 mM Mg was used. 2+ In the detection buffer solution, 10 μM I-5-57 was incubated with 1 μM Paprika-1, and then placed at different temperatures for 5 min before detecting the fluorescence value. The results showed that the Tm value of Paprika-1-I-5-57 was 53.6℃ ( Figure 4 C) indicates that the Paprika-1-I-5-57 complex has good temperature stability.

[0268] To detect the effect of the Paprika-1-I-5-57 complex on K + The ion dependence was investigated by incubating 10 μM I-5-57 and 1 μM Paprika-1 in buffer solutions containing 100 mM KCl or 100 mM LiCl, respectively, at 70 °C for 5 min, followed by incubation at room temperature for at least 15 min, and then detecting the fluorescence values ​​under different conditions. Previous literature reports indicate that the stability of the G tetrad structure is highly dependent on KCl. + The presence of ions. Experimental results show that the fluorescence of the Paprika-1-I-5-57 complex is independent of K. + The presence of ions ( Figure 4 D) It is speculated that the Paprika-1 structure does not contain G quadriplex structures.

[0269] Example 6. Identification of the properties of I-5-57 analogues

[0270] The F30-Paprika-1 RNA aptamer molecule was prepared according to the commonly used experimental method (I). It was used to detect the basic properties of the binding of I-5-57 analogs to Paprika, including fluorescence spectra and fluorescence activation factor. The detection results are shown in Table 4. It can be seen from the data in the table that F30-Paprika-1 can activate the fluorescence of I-5-57 analogs to varying degrees.

[0271] Table 4: Physicochemical properties of F30-Paprika-1 RNA aptamer molecules bound to different fluorescent molecules

[0272]

[0273]

[0274]

[0275] Example 7. Activation effect of base-modified Paprika-1 on I-5-57

[0276] To investigate the activation effect of base-modified Paprika-1 on I-5-57, base-modified Paprika-2 (SEQ ID NO: 4, sequence: GGUGUAGUAU) was synthesized. GACGTTCGCGTC The underlined bases in AGGAAGAAUUGAUCUCGGCC are deoxyribonucleotide bases) and Paprika-3 (SEQ ID NO: 5, this sequence: GGUGUAGUAU GACGUUCG C In GUCAGGAAGAAUUGAUCUCGGCC, the underlined bases are 2'-F modified bases (synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd.). These bases contain stem-loop structures where the bases have been replaced with deoxyribonucleotides. Figure 5 The shaded bases in A and some bases are modified by 2'-F. Figure 5 (Bases in the shaded area of ​​B). The fluorescence activation effect of these base-modified Paprika-1 on the I-5-57 fluorophore molecule was detected using common experimental method (II). The results showed that the base-modified Paprika-2 and Paprika-3 could still significantly activate the fluorescence of the I-5-57 fluorophore molecule (…). Figure 5 C).

[0277] Example 8. Paprika-1 tandem

[0278] To detect the activation effect of Paprika-1 tandem on I-5-57 fluorescence, Paprika-1 was tandemly arranged in three different ways:

[0279] (1) "Series 1" method ( Figure 6 A) The "head" and "tail" of the Paprika-1 structure are connected in a "head-tail" manner to obtain nPaprika-1 (where n is Paprika-1 that can be copied arbitrarily). In this embodiment, the encoding cDNAs of F30-2Paprika-4 and F30-4Paprika-4 (the sequences encoding RNA aptamers are SEQ ID NO: 6 and SEQ ID NO: 7, respectively) were synthesized from the whole genome. After PCR amplification, the nucleic acid aptamer RNA was prepared according to the common experimental method (I). 0.1 μM RNA aptamer was incubated with 10 μM I-5-57, and the fluorescence intensity was detected according to the common experimental method (II). The detection results showed that as n increased, the fluorescence of nPaprika-4-I-5-57 also increased. Although the fluorescence of nPaprika-4-I-5-57 did not increase by an equal multiple, it was still much higher than that of Paprika-1-I-5-57. Figure 6 D) indicates that the fluorescence intensity of the Paprika-1-I-5-57 complex can be increased by the "tandem 1" method.

[0280] (2) "Series 2" method ( Figure 6B) Paprika-1 is tandemly linked as a structural unit to obtain nxPaprika-1 (where n is any number of copies of Paprika-1). In this embodiment, 2xPaprika-5 and 4xPaprika-5 encoding cDNAs (encoding RNA aptamer sequences SEQ ID NO: 8 and SEQ ID NO: 9, respectively) were synthesized from the whole genome. Nucleic acid aptamer RNA was prepared according to common experimental method (I). After incubating 0.1 μM RNA aptamer with 10 μM I-5-57, the fluorescence intensity was detected according to common experimental method (II). The detection results showed that the fluorescence of nxPaprika-1-I-5-57 increased with the increase of n. Figure 6 E) indicates that the fluorescence intensity of the Paprika-1-I-5-57 complex can be increased by the "tandem 2" method.

[0281] (3) "Series 3" method ( Figure 6 C) combines the above-mentioned "tandem 1" and "tandem 2", using nPaprika-1 obtained from "tandem 1" as a structural unit and tandemly following the "tandem 2" method to obtain n1 x n2Paprika-1 (where n1 and n2 are Paprika-1 units that can be copied arbitrarily). In this embodiment, 2x2Paprika-4 and 4x2Paprika-4 encoding cDNAs (encoding RNA aptamer sequences SEQ ID NO: 10 and SEQ ID NO: 11, respectively) were synthesized from the whole genome. Nucleic acid aptamer RNA was prepared according to common experimental method (I). After incubating 0.1 μM RNA aptamer with 20 μM I-5-57, the fluorescence intensity was detected according to common experimental method (II). The detection results showed that the fluorescence intensity of the Paprika-1 tandem-I-5-57 complex obtained through "tandem 3" was significantly higher than that of Paprika-1-I-5-57 ( Figure 6 F) indicates that the fluorescence intensity of the Paprika-1-I-5-57 complex can be increased by the "tandem 3" method.

[0282] Example 9. F30-Paprika-1-I-5-57 complex for labeling RNA in bacteria

[0283] To test the effectiveness of F30-Paprika-1-I-5-57 in bacteria, a bacterial expression plasmid expressing F30-Paprika-1 (SEQ ID NO: 2) was first constructed. F30-Paprika-1 from Example 2 was amplified using primers, and pET28a was amplified using primers to remove the promoter and multiple cloning site region. The amplified F30-Paprika-1 DNA fragment was ligated to the linearized pET28a vector according to experimental method (III), and the resulting recombinant plasmid was named pET28a-T7-F30-Paprika-1.

[0284] The primers used to amplify the F30-Paprika-1 fragment are:

[0285] Upstream primer (P1):

[0286]

[0287] Upstream primer (P2): 5'- CCACATACTCTGATGATCCGGTGTAGTAGGTCCTTCGGGACCGGAAGAATTGATCT CG-3'

[0288] Downstream primer (P3): 5'-TTGCCATGAATGATCCGGCCGAGATCAATTCTTCCGGTCCC-3'

[0289] The primers used to amplify and linearize the pET28a vector are:

[0290] Upstream primer (P4): 5'- GGCCGGATCATTCATGGCAATAGCATAACCCCTTGGGGCC-3'

[0291] Downstream primer (P5): 5'-GAACCCACATACACATGGCAACCCTATAGTGAGTCGTATTAATTTC-3'

[0292] The recombinant plasmid pET28a-T7-F30-Paprika-1 was transformed into Escherichia coli strain BL21(DE3, Star), and single clones were selected and cultured at 37°C. 600 When the concentration of P0.2 was approximately 0.2, 1 mM IPTG was added to induce F30-Paprika-1 expression. After 4 hours, the bacteria were harvested and resuspended in PBS containing 2 μM I-5-57. BL21 (DE3, Star) E. coli transformed with the pET28a empty vector was used as a control. The results showed that only bacteria expressing F30-Paprika-1 and in the presence of I-5-57 exhibited bright red fluorescence. Figure 7 This indicates that the Paprika-1-I-5-57 complex can be used for fluorescent labeling of RNA in bacteria.

[0293] Example 10. Circular-Paprika-1 and I-5-57 and their analogues for RNA labeling in mammalian cells.

[0294] To detect the expression of circular-Paprika-1 and I-5-57 in mammalian cells, a mammalian cell expression plasmid for circular-Paprika-1 (SEQ ID No: 12) was constructed. The entire DNA fragment of circular-Paprika-1 was synthesized and amplified using primers P6 and P7 as templates. The primers used for amplifying the circular-Paprika-1 fragment were:

[0295] Upstream primer (P6): 5'-GGGCCGCACTCGCCGGTCCC-3'

[0296] Downstream primer (P7): 5'-GCGTGGACTGTACCCTCCAC-3'

[0297] The primers used to amplify and linearize the pLKO.1puro vector are:

[0298] Upstream primer (P8): 5'- GTGGAGGGTACAGTCCACGCTTTTTTTGAATTCTCGACCTCG-3'

[0299] Downstream primer (P9):

[0300]

[0301] Using experimental method (iii), these fragments were inserted into the pLKO.1puro vector, and the resulting expression vector was named pLKO.1-circular-Paprika-1. This plasmid expresses circular-Paprika-1.

[0302] pLKO.1-circular-Paprika-1 plasmid was transfected into 293T / 17 cells. After 36 hours, 1 μM I-5-57 was added to label circular-Paprika-1. Cells not expressing the corresponding aptamer were used as controls. The labeling effect was detected using experimental method (V). The results showed that the circular-Paprika-1-I-5-57 complex exhibited very bright red fluorescence. Figure 8 ).

[0303] Example 11. F30-Paprika-1 and I-5-57 and their analogues for RNA labeling in mammalian cells

[0304] To detect the use of F30-Paprika-1 and I-5-57 as markers for RNA in mammalian cells, a mammalian cell expression plasmid expressing F30-Paprika-1 (SEQ ID NO: 2) was constructed. F30-Paprika-1 from Example 9 was amplified using primers P1, P2, and P3, respectively.

[0305] The primers used to amplify and linearize the pLKO.1puro vector are:

[0306] Upstream primer (P10): 5'-CTCGGCCGGATCATTCATGGCAATTTTTTTGAATTCTCGACCTCGAG-3'

[0307] Downstream primer (P11): 5'-GCGAACCCACATACACATGGCAATCTAGAGTTTCGTCCTTTCCAC-3'

[0308] Using experimental method (III), these fragments were inserted into the pLKO.1puro vector, and the resulting expression vector was named pLKO.1-F30-Paprika-1. This plasmid expresses F30-Paprika-1.

[0309] pLKO.1-F30-Paprika-1 plasmid was transfected into 293T / 17 cells. After 36 hours, 1 μM I-5-57 was added to label F30-Paprika-1. Cells not expressing the corresponding aptamer were used as controls. The labeling effect was detected using experimental method (V). The results showed that the F30-Paprika-1-I-5-57 complex exhibited very bright red fluorescence. Figure 9 ).

[0310] Example 12. Paprika-1-I-5-57 as a tag for labeling U6 spliceosome RNA in living cells.

[0311] To verify the use of Paprika-1 and I-5-57 as tags to label U6 spliceosome RNA in living cells, a mammalian cell expression plasmid expressing U6-Paprika-1 (SEQ ID NO: 13) was constructed. The complete DNA sequence of U6-Paprika-1 was synthesized.

[0312] The primers used to amplify the U6-Paprika-1 fragment are:

[0313] Upstream primer (P12): 5'-GTGCTCGCTTCGGCAGCAC-3'

[0314] Downstream primer (P13): 5'-CAAAAATATGGAACGCTTCAC-3'

[0315] The primers used to amplify and linearize the pLKO.1puro vector are:

[0316] Upstream primer (P14): 5'-CGTGAAGCGTTCCATATTTTTGTTTTTTTGAATTCTCGACCTCG-3'

[0317] Downstream primer (P15): 5'-GTATATGTGCTGCCGAAGCGAGCACTCTAGAGTTTCGTCCTTTCC-3'

[0318] Using experimental method (III), these fragments were inserted into the pLKO.1puro vector, and the resulting expression vector was named pLKO.1-U6-Paprika-1, which expresses U6-Paprika-1. The pLKO.1-U6-Paprika-1 plasmid and the pCDN3.1 / hygro(+)-SART3-BFP plasmid (Chen et al. Nature biotechnology 2019.37: 1287-1293) plasmid were co-transfected into 293T / 17 cells. After 36 hours, 0.5 μM I-5-57 was added for labeling, and the labeling effect was detected using experimental method (V). The results showed that Paprika-1 and SART3-BFP co-localized on the Cajal body, with the bright spots in the figure representing the Cajal body. This demonstrates that the interaction between Paprika-1-I-5-57 and U6-SART3-BFP indicates the function of the Cajal body, consistent with previous reports. Figure 10 )(Chen et al. Nature biotechnology 2019.37: 1287-1293).

[0319] Example 13. Paprika-1-I-5-57 as a tag for mRNA labeling in living cells

[0320] To verify the use of Paprika-1 and I-5-57 as tags to label fibrous actin ACTB mRNA in living cells, mammalian cell expression plasmids were constructed. Based on previously reported literature (Chen et al. Nature biotechnology 2019.37:1287-1293), pCDNA3.1 / hygro(+)-ACTB and pCDNA3.1 / hygro(+)-ACTB-Paprika-1 were constructed, and these plasmids express ACTB and ACTB-Paprika-1, respectively (SEQ ID NO: 14).

[0321] First, we constructed an expression plasmid of chimeric RNA fused with different RNAs, consisting of Paprika-1. Because the Paprika-1 fragment is relatively short, we used primer homologous recombination to insert the Paprika-1 gene fragment obtained by primer bridging into the pCDNA3.1 / hygro(+) vector, resulting in the pCDNA3.1 / hygro(+)-Paprika-1 recombinant plasmid.

[0322] The primers used to amplify the pCDNA3.1 / hygro(+)-Paprika-1 fragment are:

[0323] Upstream primer (P16):

[0324]

[0325] Downstream primer (P17):

[0326]

[0327] The ACTB gene fragment (ACTB RNA sequence: ACCESSION NM_001101) was synthesized. The ACTB gene fragment was amplified using primers. The fragment was then inserted into the primer-linearized pCDNA3.1 / hygro(+)-Paprika-1 vector using experimental method (III) to obtain the pCDNA3.1 / hygro(+)-ACTB-Paprika-1 recombinant plasmid, which encodes the ACTB-Paprika-1 chimeric RNA.

[0328] The primers used to amplify the ACTB fragment are:

[0329] Upstream primer (P18): 5'-ATGGATGATGATATCGCCGC-3'

[0330] Downstream primer (P19): 5'-CTAGAAGCATTTGCGGTGGAC-3'

[0331] The primers used to linearize the pCDNA3.1 / hygro(+)-ACTB-Paprika-1 vector were:

[0332] Upstream primer (P20): 5'- CGTCCACCGCAAATGCTTCTAGCTCGAGGCCGCGGTGTAGTATG-3'

[0333] Downstream primer (P21): 5'- GCGGCGATATCATCATCCATGGATCCGAGCTCGGTACCAAG-3'

[0334] pCDNA3.1 / hygro(+)-ACTB and pCDNA3.1 / hygro(+)-ACTB-Paprika-1 plasmids were transfected into COS-7 cells, respectively. After 24 hours, 0.5 μM I-5-57 was added for labeling, and the labeling effect was detected using experimental method (V). The results showed that Paprika-1-I-5-57 can be used for ACTB mRNA labeling (…). Figure 11 ).

[0335] Example 14. Paprika-1 tag for RNA extraction and purification

[0336] To test the use of Paprika-1 for RNA extraction and purification, the pCDNA3.1 / hygro(+)-ACTB-Paprika-1 recombinant plasmid from Example 13 was transfected into COS-7 cells. Cells were collected 24 hours later, and total RNA was extracted using the Eastep Super Total RNA Extraction Kit (Promega). The extracted total RNA was dissolved in a buffer containing 40 mM HEPES, pH 7.4, 125 mM KCl, and 5 mM MgCl2, incubated at 70°C for 10 min, and then left to stand at room temperature for at least 30 min.

[0337] 500 μL of Activated Thiol Sepharose 4B (GE Healthcare) was washed twice with 500 μL of PBS, then incubated with PBS containing 10 mM TCEP (Sigma) at room temperature for 1 h. After washing twice with 500 μL of PBS, maleamide-containing I-5-57 fluorophore molecules (Mal-I-5-57) were added and reacted at room temperature for 30 min, followed by washing three times with 500 μL of PBS. The total RNA treated above was incubated with the treated microbeads at room temperature for 30 min, then centrifuged at 4000 rpm for 2 min, and the supernatant was discarded. The agarose microbeads were washed 6 times with a buffer of 40 mM HEPES, pH 7.4, 125 mM KCl, and 5 mM MgCl2, centrifuged and the supernatant was discarded each time. The microbeads were resuspended in DEPC water, treated at 70 °C for 10 min, centrifuged at 4000 rpm for 2 min, and the supernatant was collected. Add 1 / 10 volume of NaAc and 2.5 volumes of anhydrous ethanol to the collected supernatant. Incubate at -80°C for 20 min, then centrifuge at 14000 rpm for 10 min at 4°C. Collect the precipitate and discard the supernatant. Wash the precipitate with pre-cooled 70% ethanol solution, centrifuge at 14000 rpm for 10 min at 4°C, collect the precipitate, and discard the supernatant. Repeat this process once. Place the precipitate at room temperature for 5 min to allow the ethanol to evaporate completely, then resuspend the precipitate in a small volume of DEPC-containing water.

[0338] The fluorescence of the cell lysis supernatant and the eluent after final high-temperature elution were measured separately after incubation with the fluorophore I-5-57, with the lysis supernatant of blank cells serving as a control. The results showed that the fluorescence of the eluent after incubation with I-5-57 was significantly higher than that of the lysis supernatant before loading. Figure 12 The results indicate that ACTB-Paprika-1 RNA was well enriched, suggesting that Paprika-1 can be used as a tag for RNA isolation and purification.

[0339] Example 15. Synthesis of I-5-57 and its analogues

[0340] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative purposes only and are not intended to limit the scope of the invention.

[0341] Compound 1

[0342]

[0343] 5-Bromothiophene-2-carboxaldehyde (0.5 g, 2.6 mmol) and 2-methylaminoethanol (0.78 g, 10.4 mmol) were dissolved in 10 ml of water. The mixture was heated in an oil bath at 100 °C under Ar protection and reacted overnight. After the reaction was completed, the mixture was cooled to room temperature, extracted three times with dichloromethane, washed with saturated brine, dried over anhydrous sodium sulfate, and the organic phase was evaporated to dryness. The residue was subjected to column chromatography to give 0.4 g of compound 1, with a yield of 84.0%. 1H NMR (400MHz, DMSO-d6) δ9.40 (s, 1H), 7.65 (d, J=4.5 Hz, 1H), 6.12 (d, J=4.5Hz, 1H), 4.86 (t, J=5.4Hz, 1H), 3.62 (q, J=5.5Hz, 2H), 3.47 (t, J =5.6Hz, 2H), 3.09(s, 3H).

[0344] (I-5-1)

[0345]

[0346] Compound 1 (0.2 g, 1.08 mmol) and 2,4-oxazolidinedione (0.13 g, 1.30 mmol) were dissolved in 50 mL of anhydrous ethanol. A catalytic amount of piperidine was added, and the mixture was heated in an oil bath at 90 °C under Ar protection for 3 h. After the reaction was completed, the mixture was cooled to room temperature, and a large amount of solid precipitated out. The mixture was filtered, and the filter cake was washed twice with cold ethanol and dried under vacuum to give 0.2 g of the yellow compound (I-5-1), with a yield of 71.4%. 1H NMR (400MHz, DMSO-d6) δ12.09 (s, 1H), 7.81 (s, 1H), 7.43 (d, J=4.4Hz, 1H), 6.15 (d, J=4.4Hz, 1H), 4.87 (t, J=5.3Hz, 1H), 3.62 (q, J= 5.5Hz, 2H), 3.46 (t, J=5.6Hz, 2H), 3.09 (s, 3H).

[0347] (I-5-2)

[0348]

[0349] Following the synthesis method in (I-5-1), the yield was 75.2%. ¹H NMR (400 MHz, DMSO-d⁶) δ 13.09 (s, ¹H), 7.71 (s, ¹H), 7.43 (d, J = 4.4 Hz, ¹H), 6.15 (d, J = 4.4 Hz, ¹H), 4.87 (t, J = 5.3 Hz, ¹H), 3.62 (q, J = 5.5 Hz, 2H), 3.46 (t, J = 5.6 Hz, 2H), 3.34 (s, 3H).

[0350] Compound 2

[0351]

[0352] Following the synthesis method in (I-5-1), the yield was 71.6%. ¹H NMR (400 MHz, DMSO-d⁶) δ 14.09 (s, ¹H), 7.01 (s, ¹H), 7.43 (d, J = 4.4 Hz, ¹H), 6.15 (d, J = 4.4 Hz, ¹H), 4.87 (t, J = 5.3 Hz, ¹H), 3.62 (q, J = 5.5 Hz, 2H), 3.46 (t, J = 5.6 Hz, 2H), 3.09 (s, 3H).

[0353] Compound 3

[0354]

[0355] Compound 2 (0.5 g, 1.66 mmol) was dissolved in acetonitrile, followed by the addition of sodium azide (1.08 g, 16.6 mmol). The mixture was heated in an oil bath at 60 °C for 24 h. After the reaction of the starting material compound 2 was complete, the mixture was extracted with dichloromethane and water. The organic phases were combined and evaporated to dryness to obtain a yellow solid. The yellow solid was then dissolved in tetrahydrofuran and water (10:1), and triphenylphosphine (0.52 g, 1.98 mmol) was added for reduction. The reaction was carried out for 4 h. After the reaction was complete, the tetrahydrofuran was evaporated to dryness, and the mixture was extracted with dichloromethane and water. The organic phases were combined and the crude product was evaporated to dryness. The crude product was subjected to silica gel column chromatography to obtain 0.25 g of compound 3, with a yield of 50.3%. 1H NMR (400MHz, DMSO-d6) δ14.09 (s, 1H), 7.01 (s, 1H), 7.43 (d, J=4.4Hz, 1H), 6.15 (d, J=4.4Hz, 1H), 4.87 (t, J=5.3Hz, 1H), 3.62 (q, J=5.5Hz, 2H), 3.46 (t, J=5.6Hz, 2H), 3.09 (s, 3H).

[0356] (I-5-3)

[0357]

[0358] Compound 3 (0.25 g, 0.84 mmol) was dissolved in dichloromethane. Under nitrogen protection, methanesulfonyl chloride (0.114 g, 1.0 mmol) dissolved in dichloromethane was added. The mixture was reacted at room temperature for 30 min. When compound 3 had completely reacted, it was extracted with dichloromethane and water. The organic phases were combined and evaporated to dryness to obtain the crude product. The crude product was obtained by silica gel column chromatography as (I-5-3) as a yellow solid, 0.19 g, with a yield of 59.4%. 1H NMR (400MHz, DMSO-d6) δ14.09 (s, 1H), 7.01 (s, 1H), 7.43 (d, J =4.4Hz, 1H), 6.15 (d, J=4.4Hz, 1H), 4.87 (t, J=5.3Hz, 1H), 3.62 (q, J=5.5Hz, 2H), 3.46 (t, J=5.6Hz, 2H), 3.09 (s, 3H), 2.93 (s, 3H).

[0359] (I-5-4)

[0360]

[0361] Following the synthesis method in (I-5-1), the yield was 73.2%. ¹H NMR (400 MHz, DMSO-d6) δ 16.09 (s, ¹H), 7.91 (s, ¹H), 7.43 (d, J = 4.4 Hz, ¹H), 6.15 (d, J = 4.4 Hz, ¹H), 4.87 (t, J = 5.3 Hz, ¹H), 3.62 (q, J = 5.5 Hz, 2H), 3.46 (t, J = 5.6 Hz, 2H), 3.09 (s, 3H).

[0362] (I-5-5)

[0363]

[0364] Following the synthesis method in (I-5-1), the yield was 74.3%. ¹H NMR (400 MHz, DMSO-d⁶) δ 12.10 (s, ¹H), 7.71 (s, ¹H), 7.43 (d, J = 4.4 Hz, ¹H), 6.15 (d, J = 4.4 Hz, ¹H), 4.87 (t, J = 5.3 Hz, ¹H), 4.24 (q, 2H), 3.62 (q, J = 5.5 Hz, 2H), 3.46 (t, J = 5.6 Hz, 2H), 3.09 (s, 3H), 1.20 (t, 3H).

[0365] Compound 4

[0366]

[0367] 0.5 g (2.6 mmol) of 5-bromothiophene-2-carboxaldehyde was dissolved in 10 mL of diethanolamine. The mixture was heated in an oil bath at 100 °C under Ar protection and reacted overnight. After the reaction was completed, the mixture was cooled to room temperature, extracted three times with dichloromethane, washed with saturated brine, dried over anhydrous sodium sulfate, and the organic phase was evaporated to dryness. The residue was subjected to column chromatography to give 0.32 g of compound 4, with a yield of 57.1%. ¹H NMR (400 MHz, DMSO-d6) δ 9.40 (s, 1H), 7.65 (d, J = 4.5 Hz, 1H), 6.12 (d, J = 4.5 Hz, 1H), 4.86 (t, J = 5.4 Hz, 1H), 3.62 (q, J = 5.5 Hz, 4H), 3.47 (t, J = 5.6 Hz, 4H), 3.09 (s, 3H).

[0368] (I-5-6)

[0369]

[0370] Following the synthesis method in (I-5-1), the yield was 70.4%. ¹H NMR (400 MHz, DMSO-d6) δ 12.10 (s, ¹H), 11.20 (s, ¹H), 7.51 (s, ¹H), 7.43 (d, J = 4.4 Hz, ¹H), 6.15 (d, J = 4.4 Hz, ¹H), 4.87 (t, J = 5.3 Hz, ¹H), 3.62 (q, J = 5.5 Hz, 4H), 3.46 (t, J = 5.6 Hz, 4H), 3.09 (s, ³H).

[0371] Compound 5

[0372]

[0373] Following the synthesis method of compound 1, the yield was 92.5%. ¹H NMR (400 MHz, DMSO-d6) δ 10.40 (s, ¹H), 7.65 (d, J = 4.5 Hz, ¹H), 6.12 (d, J = 4.5 Hz, ¹H), 3.09 (s, 6H).

[0374] (I-5-7)

[0375]

[0376] Following the synthesis method in (I-5-1), the yield was 89.4%. ¹H NMR (400 MHz, DMSO-d6) δ 12.09 (s, ¹H), 7.81 (s, ¹H), 7.43 (d, J = 4.4 Hz, ¹H), 6.15 (d, J = 4.4 Hz, ¹H), 3.34 (s, ³H), 3.09 (s, ⁶H).

[0377] (I-5-8)

[0378]

[0379] Following the synthesis method in (I-5-1), the yield was 90.2%. ¹H NMR (400 MHz, DMSO-d6) δ 14.08 (s, ¹H), 7.51 (s, ¹H), 7.43 (d, J = 4.4 Hz, ¹H), 6.15 (d, J = 4.4 Hz, ¹H), 3.09 (s, 6H).

[0380] (I-5-9)

[0381]

[0382] Following the synthesis method in (I-5-1), the yield was 79.5%. ¹H NMR (400 MHz, DMSO-d6) δ 13.01 (s, ¹H), 7.71 (s, ¹H), 7.43 (d, J = 4.4 Hz, ¹H), 6.15 (d, J = 4.4 Hz, ¹H), 3.09 (s, 6H).

[0383] (I-5-10)

[0384]

[0385] Following the synthesis method in (I-5-1), the yield was 80.5%. ¹H NMR (400 MHz, DMSO-d⁶) δ 15.01 (s, ¹H), 7.91 (s, ¹H), 7.44 (d, J = 4.4 Hz, ¹H), 6.17 (d, J = 4.4 Hz, ¹H), 3.09 (s, 6H).

[0386] (I-5-11)

[0387]

[0388] Following the synthesis method in (I-5-1), the yield was 82.7%. ¹H NMR (400 MHz, DMSO-d6) δ 12.05 (s, ¹H), 7.56 (s, ¹H), 7.44 (d, J = 4.4 Hz, ¹H), 6.17 (d, J = 4.4 Hz, ¹H), 3.09 (s, 6H).

[0389] (I-5-12)

[0390]

[0391] Following the synthesis method in (I-5-1), the yield was 85.2%. ¹H NMR (400 MHz, DMSO-d6) δ 13.65 (s, ¹H), 7.66 (s, ¹H), 7.44 (d, J = 4.4 Hz, ¹H), 6.17 (d, J = 4.4 Hz, ¹H), 3.09 (s, 6H).

[0392] (I-5-13)

[0393]

[0394]

[0395] Following the synthesis method in (I-5-1), the yield was 89.1%. ¹H NMR (400 MHz, DMSO-d⁶) δ 12.14 (s, ¹H), 7.59 (d, J = 8.6 Hz, 2H), 6.77 (d, J = 8.7 Hz, 2H), 6.61 (s, ¹H), 4.74 (d, J = 13.1 Hz, 1H), 4.24 (q, 2H), 3.56 (d, J = 5.9 Hz, 2H), 3.47 (t, J = 6.0 Hz, 2H), 3.01 (s, 3H), 1.20 (t, 3H).

[0396] (I-5-14)

[0397]

[0398] Following the synthesis method in (I-5-1), the yield was 73.6%. ¹H NMR (400 MHz, DMSO-d6) 13.14 (s, ¹H), δ 7.67 (d, J = 8.6 Hz, 2H), 6.90 (s, ¹H), 6.80 (d, J = 8.7 Hz, 2H), 4.75 (s, ¹H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.04 (s, 3H).

[0399] (I-5-15)

[0400]

[0401] Following the synthesis method in (I-5-1), the yield was 85.6%. ¹H NMR (400 MHz, DMSO-d⁶): 13.84 (s, ¹H), δ 7.67 (d, J = 8.6 Hz, 2H), 6.82 (s, ¹H), 6.80 (d, J = 8.7 Hz, 2H), 4.75 (s, ¹H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.04 (s, 3H).

[0402] (I-5-16)

[0403]

[0404]

[0405] Following the synthesis method in (I-5-1), the yield was 86.7%. ¹H NMR (400 MHz, DMSO-d6) 19.94 (s, ¹H), δ 7.67 (d, J = 8.6 Hz, 2H), 6.96 (s, ¹H), 6.80 (d, J = 8.7 Hz, 2H), 4.75 (s, ¹H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.04 (s, 3H).

[0406] (I-5-17)

[0407]

[0408] Following the synthesis method in (I-5-1), the yield was 83.8%. ¹H NMR (400 MHz, DMSO-d6) 12.11 (s, ¹H), δ 7.67 (d, J = 8.6 Hz, 2H), 7.23 (s, ¹H), 6.80 (d, J = 8.7 Hz, 2H), 4.75 (s, ¹H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.04 (s, 3H).

[0409] (I-5-18)

[0410]

[0411] Following the synthesis method in (I-5-1), the yield was 84.8%. ¹H NMR (400 MHz, DMSO-d6): 12.12 (s, ¹H), δ 7.67 (d, J = 8.6 Hz, 2H), 6.93 (s, ¹H), 6.80 (d, J = 8.7 Hz, 2H), 4.75 (s, ¹H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.04 (s, 3H).

[0412] (I-5-19)

[0413]

[0414]

[0415] Following the synthesis method in (I-5-1), the yield was 81.2%. ¹H NMR (400 MHz, DMSO-d6) δ 12.57 (s, ¹H), 7.63 (s, ¹H), 7.48–7.35 (m, 2H), 6.91–6.79 (m, 2H), 3.04 (s, 6H).

[0416] (I-5-20)

[0417]

[0418] Following the synthesis method in (I-5-1), the yield was 83.4%. ¹H NMR (400 MHz, DMSO-d6) δ 13.87 (s, ¹H), 7.49 (s, ¹H), 7.45–7.35 (m, 2H), 6.91–6.59 (m, 2H), 4.24 (t, J = 5.28, 2H), 3.04 (s, 6H), 2.63 (t, J = 5.28, 2H).

[0419] (I-5-21)

[0420]

[0421] Following the synthesis method in (I-5-1), the yield was 74.2%. ¹H NMR (400 MHz, DMSO-d6) δ 14.07 (s, ¹H), 7.89 (s, ¹H), 7.55–7.25 (m, 2H), 6.71–6.39 (m, 2H), 3.06 (s, 6H).

[0422] (I-5-22)

[0423]

[0424] Following the synthesis method in (I-5-1), the yield was 90.8%. ¹H NMR (400 MHz, DMSO-d6) δ 16.27 (s, ¹H), 7.90 (s, ¹H), 7.65–7.45 (m, 2H), 6.81–6.41 (m, 2H), 3.05 (s, 6H).

[0425] (I-5-23)

[0426]

[0427] Following the synthesis method in (I-5-1), the yield was 88.4%. ¹H NMR (400 MHz, DMSO-d6) δ 11.57 (s, ¹H), 7.74 (s, ¹H), 7.65–7.45 (m, 2H), 6.81–6.41 (m, 2H), 3.05 (s, 6H).

[0428] (I-5-24)

[0429]

[0430] Following the synthesis method in (I-5-1), the yield was 83.1%. ¹H NMR (400 MHz, DMSO-d6) δ 12.87 (s, ¹H), 7.94 (s, ¹H), 7.65–7.32 (m, 2H), 6.78–6.41 (m, 2H), 3.04 (s, 6H).

[0431] Compound 6

[0432]

[0433] 4-Bromo-2-fluorobenzaldehyde (0.5 g, 2.5 mmol) was dissolved in 15 mL of N-methyl-N-hydroxyethylamine, and copper powder (6.4 mg, 0.01 mmol), cuprous iodide (19 mg, 0.01 mmol), and potassium phosphate (0.63 g, 2.96 mmol) were added. The mixture was heated overnight in an oil bath at 80 °C under Ar protection. After the reaction was completed, the mixture was cooled to room temperature, and the system was poured into 50 mL of water. The mixture was extracted three times with dichloromethane, and the organic phases were combined. The solvent was evaporated by rotary evaporation, and the product was separated by column chromatography to obtain 0.35 g of the yellow product compound 6, with a yield of 77.8%. 1H NMR (400MHz, DMSO-d6) 10.21 (s, 1H), δ7.67 (d, J=8.6Hz, 2H), 6.93 (s, 1H), 4.55 (s, 1H), 3.57 (d, J=5.9Hz, 2H), 3.51 (d, J=5.7Hz, 2H), 3.02 (s, 3H).

[0434] (I-5-25)

[0435]

[0436] Following the synthesis method in (I-5-1), the yield was 85.2%. ¹H NMR (400 MHz, DMSO-d6) δ 11.07 (s, ¹H), 7.72 (s, ¹H), 7.67 (d, J = 8.6 Hz, 2H), 6.93 (s, ¹H), 4.55 (s, ¹H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.02 (s, 3H).

[0437] Compound 7

[0438]

[0439] Following the synthetic method for compound 6, the yield was 79.2%. ¹H NMR (400 MHz, DMSO-d₆): δ 10.21 (s, ¹H), δ 7.67 (d, J = 8.6 Hz, 2H), 6.93 (s, ¹H), 4.55 (s, ¹H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.02 (s, 3H).

[0440] Compound 8

[0441]

[0442] Following the synthesis method in (I-5-1), the yield was 88.8%. ¹H NMR (400 MHz, DMSO-d6) δ 12.27 (s, ¹H), 7.62 (s, ¹H), 7.57 (d, J = 8.6 Hz, 2H), 6.93 (s, ¹H), 4.55 (s, ¹H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.02 (s, 3H).

[0443] (I-5-26)

[0444]

[0445] Compound 8 (0.5 g, 1.34 mmol) was dissolved in 20 mL of DMF, and 3-(2-hydroxyethoxy)propionic acid (0.22 g, 1.64 mmol) and pybap (1.39 g, 2.67 mmol) were added. The reaction was stirred overnight at room temperature. After the starting compound 8 had completely reacted, the mixture was extracted three times with dichloromethane. The organic phases were combined and evaporated to dryness to give the crude product. The crude product was then subjected to silica gel column chromatography to give (I-5-26) as a yellow solid, 0.52 g, with a yield of 78.8%. 1H NMR (400MHz, DMSO-d6) δ12.27 (s, 1H), 7.62 (s, 1H), δ7.57 (d, J=8.6Hz, 2H), 6.93 (s, 1H), 4.55 (s, 1H), 3.73 (m, 6H), 3.57 (d, J=5.9Hz, 2H), 3.51 (d, J=5.7Hz, 2H), 3.02 (s, 3H), 2.42 (m, 2H).

[0446] Compound 9

[0447]

[0448] Compound 9 was synthesized using the same method as compound 6, with a yield of 43.2%. ¹H NMR (400 MHz, DMSO-d6) δ 13.16 (s, 1H), 7.73 (s, 1H), 7.67 (d, J = 8.6 Hz, 2H), 6.93 (s, 1H), 4.55 (s, 1H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.02 (s, 3H), 2.43 (s, 3H).

[0449] Compound 10

[0450]

[0451] Following the synthesis method in (I-5-1), the yield was 80.1%. ¹H NMR (400 MHz, DMSO-d6) δ 13.16 (s, ¹H), 7.73 (s, ¹H), 7.67 (d, J = 8.6 Hz, 2H), 6.93 (s, ¹H), 4.55 (s, ¹H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.02 (s, 3H), 2.43 (s, 3H).

[0452] Compound 11

[0453]

[0454] Compound 11 was synthesized using the same method as compound 3, with a yield of 56.3%. ¹H NMR (400 MHz, DMSO-d6) δ 13.16 (s, 1H), 7.73 (s, 1H), 7.67 (d, J = 8.6 Hz, 2H), 6.93 (s, 1H), 4.55 (s, 1H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.02 (s, 3H), 2.43 (s, 3H).

[0455] (I-5-27)

[0456]

[0457] Synthesized according to the method used for compound (I-5-26), yield 38.2%. ¹H NMR (400 MHz, DMSO-d6): δ 13.16 (s, 1H), 7.73 (s, 1H), δ 7.67 (d, J = 8.6 Hz, 2H), 6.93 (s, 1H), 4.55 (s, 1H), 3.70 (m, 2H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.48 (m, 6H), 3.02 (s, 3H), 2.43 (s, 3H), 2.35 (m, 2H).

[0458] (I-5-28)

[0459]

[0460] Following the synthesis method in (I-5-1), the yield was 98.1%. ¹H NMR (400 MHz, DMSO-d6) δ 15.86 (s, ¹H), 7.83 (s, ¹H), 7.79 (d, J = 8.6 Hz, 2H), 7.03 (s, ¹H), 4.55 (s, ¹H), 3.57 (d, J = 5.9 Hz, 2H), 3.51 (d, J = 5.7 Hz, 2H), 3.02 (s, 3H), 2.43 (s, 3H).

[0461] (I-5-29)

[0462]

[0463] Following the synthesis method in (I-5-1), the yield was 89.3%. ¹H NMR (400 MHz, DMSO-d6) δ 11.26 (s, ¹H), 7.63 (s, ¹H), δ 7.59 (d, J = 8.6 Hz, ¹H), 7.03 (d, J = 8.6 Hz, ¹H), 6.68 (s, ¹H), 3.61 (t, J = 5.3 Hz, 2H), 2.98 (t, J = 5.3 Hz, 2H), 2.75 (s, 3H).

[0464] (I-5-30)

[0465]

[0466] Following the synthesis method in (I-5-1), the yield was 78.5%. ¹H NMR (400 MHz, DMSO-d6) δ 11.26 (s, ¹H), 7.63 (s, ¹H), 7.59 (s, ¹H), 6.68 (s, ¹H), 3.61 (t, J = 5.3 Hz, 2H), 2.98 (t, J = 5.3 Hz, 2H), 2.75 (s, 3H).

[0467] Compound 12

[0468]

[0469] 3,4-Dihydro-2H-benzo[b][1,4]thiazide (0.30 g, 2 mmol) was dissolved in 20 mL of DMF, and cesium carbonate (0.78 g, 2.4 mmol) and iodomethane (0.31 g, 2.2 mmol) were added. The mixture was heated in an oil bath at 65 °C under Ar protection for 4 h. After the reaction was completed, the mixture was cooled to room temperature, and the system was poured into 50 mL of water. The mixture was extracted three times with dichloromethane, and the organic phases were combined. The solvent was evaporated by rotary evaporation, and the product was separated by column chromatography to obtain 0.29 g of product, with a yield of 90.6%. 1H NMR (400MHz, DMSO-d6) δ6.98 -6.94 (m, 1H), 6.94-6.88 (m, 1H), 6.67 (dd, J=8.1, 1.2Hz, 1H), 6.57 (td, J=7.5, 1.2Hz, 1H), 3.57-3.42(m, 2H), 3.13-3.00(m, 2H), 2.87(s, 3H).

[0470] Compound 13

[0471]

[0472] 10 ml of DMF was added to a three-necked flask and cooled in an ice bath for 5 min. 0.2 ml of phosphorus oxychloride was added dropwise, and the mixture was stirred in an ice bath for 1 h. Compound 4 dissolved in DMF was added dropwise to the system. The mixture was stirred for 0.5 h under Ar protection and an ice bath. The system was slowly brought to room temperature, and stirring was continued for 5 h. After the reaction was complete, saturated sodium carbonate solution was added to adjust the pH to 10.0. The mixture was stirred overnight at room temperature. The next day, the organic phase was separated. The aqueous phase was extracted three times with 50 ml of dichloromethane. The organic phases were combined and washed twice with saturated brine. The organic phase was dried over anhydrous sodium sulfate, and the solvent was evaporated by rotary evaporation. The residue was separated by column chromatography to give 0.25 g of a yellow solid, with a yield of 75.3%. 1H NMR (400MHz, DMSO-d6) δ 10.11 (s, 1H), 6.98-6.94 (m, 1H), 6.94-6.88 (m, 1H), 6.57 (td, J=7.5, 1.2Hz, 1H), 3.57-3.42 (m, 2H), 3.13-3.00 (m, 2H), 2.87(s, 3H).

[0473] (I-5-31)

[0474]

[0475] Following the synthesis method in (I-5-1), the yield was 89.8%. ¹H NMR (400 MHz, DMSO-d6) δ 13.61 (s, ¹H), 7.46 (s, ¹H), 7.28–7.15 (m, 2H), 6.82 (d, J = 8.7 Hz, ¹H), 3.76–3.57 (m, 5H), 3.13–3.05 (m, 2H), 3.03 (s, 3H).

[0476] (I-5-32)

[0477]

[0478] Following the synthesis method in (I-5-1), the yield was 69.5%. ¹H NMR (400 MHz, DMSO-d6) δ 14.21 (s, ¹H), 7.58 (s, ¹H), 7.38–7.15 (m, 2H), 6.82 (d, J = 8.7 Hz, ¹H), 3.76–3.57 (m, 2H), 3.13–3.05 (m, 2H), 3.53 (s, 3H), 3.03 (s, 3H).

[0479] (I-5-33)

[0480]

[0481] Following the synthesis method in (I-5-1), the yield was 85.8%. ¹H NMR (400 MHz, DMSO-d6) δ 11.75 (s, ¹H), 7.42 (s, ¹H), 7.38–7.15 (m, 2H), 6.82 (d, J = 8.7 Hz, ¹H), 3.76–3.57 (m, 2H), 3.13–3.05 (m, 2H), 3.03 (s, 3H).

[0482] (I-5-34)

[0483]

[0484] Following the synthesis method in (I-5-1), the yield was 99.2%. ¹H NMR (400 MHz, DMSO-d6) δ 16.05 (s, ¹H), 7.51 (s, ¹H), 7.38–7.15 (m, 2H), 6.82 (d, J = 8.7 Hz, ¹H), 3.76–3.57 (m, 2H), 3.13–3.05 (m, 2H), 3.03 (s, 3H).

[0485] (I-5-35)

[0486]

[0487] Following the synthesis method in (I-5-1), the yield was 75.3%. ¹H NMR (400 MHz, DMSO-d6) δ 12.17 (s, ¹H), 7.46 (s, ¹H), 7.38–7.15 (m, 2H), 6.82 (d, J = 8.7 Hz, ¹H), 4.07 (q, J = 5.5 Hz, 3H), 3.76–3.57 (m, 2H), 3.13–3.05 (m, 2H), 3.03 (s, 3H), 1.20 (t, J = 5.5 Hz, 3H).

[0488] Compound 14

[0489]

[0490] Compound 14 was synthesized using the same method as compound 13, with a yield of 58.5%. ¹H NMR (400 MHz, DMSO-d6) δ 10.26 (s, ¹H), 6.98–6.94 (m, ¹H), 6.94–6.88 (m, ¹H), 6.57 (td, J = 7.5, 1.2 Hz, ¹H), 3.38–3.32 (m, 2H), 3.05–2.80 (m, 2H), 2.69 (s, 3H).

[0491] (I-5-36)

[0492]

[0493] Following the synthesis method in (I-5-1), the yield was 69.3%. ¹H NMR (400 MHz, DMSO-d6) δ 14.52 (s, ¹H), 7.44 (s, ¹H), 7.38–7.15 (m, 2H), 6.82 (d, J = 8.7 Hz, ¹H), 3.56–3.47 (m, 2H), 3.23–3.05 (m, 2H), 3.03 (s, 3H).

[0494] (I-5-37)

[0495]

[0496] Following the synthesis method in (I-5-1), the yield was 89.9%. ¹H NMR (400 MHz, DMSO-d6) δ 13.42 (s, ¹H), 7.46 (s, ¹H), 7.38–7.15 (m, 2H), 6.82 (d, J = 8.7 Hz, ¹H), 3.56–3.47 (m, 2H), 3.23–3.05 (m, 2H), 3.03 (s, 3H).

[0497] (I-5-38)

[0498]

[0499] Following the synthesis method in (I-5-1), the yield was 80.1%. ¹H NMR (400 MHz, DMSO-d6) δ 16.72 (s, ¹H), 7.56 (s, ¹H), 7.48–7.15 (m, 2H), 6.82 (d, J = 8.7 Hz, ¹H), 4.40 (t, J = 5.1 Hz, 2H), 3.56–3.47 (m, 2H), 3.23–3.05 (m, 2H), 3.03 (s, 3H), 2.61 (t, J = 5.1 Hz, 2H).

[0500] (I-5-39)

[0501]

[0502] Following the synthesis method in (I-5-1), the yield was 85.8%. ¹H NMR (400 MHz, DMSO-d6) δ 11.54 (s, ¹H), 7.26 (s, ¹H), 7.24–7.15 (m, 2H), 6.82 (d, J = 8.7 Hz, ¹H), 3.56–3.47 (m, 2H), 3.23–3.05 (m, 2H), 3.03 (s, 3H), 2.79 (m, 2H).

[0503] (I-5-40)

[0504]

[0505] Following the synthesis method in (I-5-1), the yield was 76.1%. ¹H NMR (400 MHz, DMSO-d6) δ 12.78 (s, ¹H), 7.26 (s, ¹H), 7.24–7.15 (m, 2H), 6.82 (d, J = 8.7 Hz, ¹H), 3.59 (s, 3H), 3.56–3.47 (m, 2H), 3.23–3.05 (m, 2H), 3.03 (s, 3H), 2.79 (m, 2H).

[0506] Compound 15

[0507]

[0508] Compound 15 was synthesized using the same method as compound 13, with a yield of 69.7%. ¹H NMR (400 MHz, DMSO-d⁶) δ 10.21 (s, ¹H), 7.33 (dd, J = 8.8, 2.2 Hz, ¹H), 7.15 (d, J = 2.2 Hz, ¹H), 6.63 (d, J = 8.8 Hz, ¹H), 5.47 (d, J = 1.5 Hz, ¹H), 2.87 (s, 3H), 1.96 (d, J = 1.4 Hz, 3H), 1.34 (s, 6H).

[0509] (I-5-41)

[0510]

[0511] Following the synthesis method in (I-5-1), the yield was 95.1%. ¹H NMR (400 MHz, DMSO-d⁶) δ 13.57 (s, ¹H), 7.51 (s, ¹H), 7.33 (dd, J = 8.8, 2.2 Hz, ¹H), 7.15 (d, J = 2.2 Hz, ¹H), 6.63 (d, J = 8.8 Hz, ¹H), 5.47 (d, J = 1.5 Hz, ¹H), 2.87 (s, 3H), 1.96 (d, J = 1.4 Hz, 3H), 1.34 (s, 6H).

[0512] (I-5-42)

[0513]

[0514] Following the synthesis method in (I-5-1), the yield was 74.6%. ¹H NMR (400 MHz, DMSO-d⁶) δ 13.86 (s, ¹H), 7.41 (s, ¹H), 7.33 (dd, J = 8.8, 2.2 Hz, ¹H), 7.15 (d, J = 2.2 Hz, ¹H), 6.63 (d, J = 8.8 Hz, ¹H), 5.47 (d, J = 1.5 Hz, ¹H), 2.87 (s, 3H), 1.96 (d, J = 1.4 Hz, 3H), 1.34 (s, 6H).

[0515] (I-5-43)

[0516]

[0517] Following the synthesis method in (I-5-1), the yield was 93.2%. ¹H NMR (400 MHz, DMSO-d6) δ 15.72 (s, ¹H), 7.65 (s, ¹H), 7.33 (dd, J = 8.8, 2.2 Hz, ¹H), 7.15 (d, J = 2.2 Hz, ¹H), 6.63 (d, J = 8.8 Hz, ¹H), 5.47 (d, J = 1.5 Hz, ¹H), 2.87 (s, 3H), 1.96 (d, J = 1.4 Hz, 3H), 1.34 (s, 6H).

[0518] (I-5-44)

[0519]

[0520] Following the synthesis method in (I-5-1), the yield was 75.9%. ¹H NMR (400 MHz, DMSO-d6) δ 11.02 (s, ¹H), 7.35 (s, ¹H), 7.33 (dd, J = 8.8, 2.2 Hz, ¹H), 7.15 (d, J = 2.2 Hz, ¹H), 6.63 (d, J = 8.8 Hz, ¹H), 5.47 (d, J = 1.5 Hz, ¹H), 4.07 (q, J = 5.4 Hz, 2H), 2.87 (s, 3H), 1.96 (d, J = 1.4 Hz, 3H), 1.34 (s, 6H), 1.20 (t, J = 5.4 Hz, 2H).

[0521] (I-5-45)

[0522]

[0523] Following the synthesis method in (I-5-1), the yield was 78.9%. ¹H NMR (400 MHz, DMSO-d⁶) δ 15.72 (s, ¹H), 7.48 (s, ¹H), 7.33 (dd, J = 8.8, 2.2 Hz, ¹H), 7.15 (d, J = 2.2 Hz, ¹H), 6.63 (d, J = 8.8 Hz, ¹H), 5.47 (d, J = 1.5 Hz, ¹H), 2.87 (s, 3H), 1.96 (d, J = 1.4 Hz, 3H), 1.34 (s, 6H).

[0524] Compound 16

[0525]

[0526] Following the synthetic method for compound 13, the yield was 89.4%. ¹H NMR (400 MHz, DMSO-d⁶) δ 10.25 (s, ¹H), 6.95 (s, 2H), 3.25 (dd, J = 6.6, 4.9 Hz, 4H), 2.68 (t, J = 6.3 Hz, 4H), 2.05–1.57 (m, 4H). (I-5-46)

[0527]

[0528] Following the synthesis method in (I-5-1), the yield was 72.7%. ¹H NMR (400 MHz, DMSO-d6) δ 12.74 (s, ¹H), 7.61 (s, ¹H), 6.95 (s, 2H), 3.59 (s, 3H), 3.25 (dd, J = 6.6, 4.9 Hz, 4H), 2.68 (t, J = 6.3 Hz, 4H), 2.05–1.57 (m, 4H).

[0529] (I-5-47)

[0530]

[0531] Following the synthesis method in (I-5-1), the yield was 86.7%. ¹H NMR (400 MHz, DMSO-d6) δ 12.58 (s, ¹H), 7.46 (s, ¹H), 6.95 (s, 2H), 3.25 (dd, J = 6.6, 4.9 Hz, 4H), 2.68 (t, J = 6.3 Hz, 4H), 2.05–1.57 (m, 4H).

[0532] (I-5-48)

[0533]

[0534] Following the synthesis method in (I-5-1), the yield was 92.3%. ¹H NMR (400 MHz, DMSO-d6) δ 15.79 (s, ¹H), 7.38 (s, ¹H), 6.95 (s, 2H), 3.25 (dd, J = 6.6, 4.9 Hz, 4H), 2.68 (t, J = 6.3 Hz, 4H), 2.05–1.57 (m, 4H).

[0535] (I-5-49)

[0536]

[0537] Following the synthesis method in (I-5-1), the yield was 78.3%. ¹H NMR (400 MHz, DMSO-d6) δ 11.23 (s, ¹H), 7.35 (s, ¹H), 6.95 (s, 2H), 3.25 (dd, J = 6.6, 4.9 Hz, 4H), 2.68 (t, J = 6.3 Hz, 4H), 2.05–1.57 (m, 4H).

[0538] (I-5-50)

[0539]

[0540] Following the synthesis method in (I-5-1), the yield was 71.2%. ¹H NMR (400 MHz, DMSO-d6) δ 12.21 (s, ¹H), 7.31 (s, ¹H), 6.95 (s, 2H), 3.25 (dd, J = 6.6, 4.9 Hz, 4H), 2.68 (t, J = 6.3 Hz, 4H), 2.05–1.57 (m, 4H).

[0541]

[0542] Thiophene[3,2-b]thiophene (10 g, 71.31 mmol) was added to a 250 mL three-necked flask, dissolved in 120 mL of anhydrous tetrahydrofuran, and cooled at -78 °C. 49 mL of 1.6 M n-butyllithium was added dropwise to the system, and the mixture was kept at -78 °C for 2 h. The cooling was then turned off, and the mixture was slowly brought to room temperature with stirring overnight. After the reaction was complete, 40 mL of water was added under ice bath to quench the reaction. The system was then poured into 200 mL of dichloromethane for extraction. The aqueous phase was extracted three times with dichloromethane, and the organic phase was dried over anhydrous sodium sulfate. The solvent was evaporated, and the residue was separated by column chromatography to give 10.7 g of the compound. Yield: 90%. ¹H NMR (400 MHz, Chloroform-d): δ 9.97 (s, 1H), 7.94 (s, 1H), 7.70 (d, J = 5.3 Hz, 1H), 7.33 (d, J = 5.3 Hz, 1H).

[0543] Compound 18

[0544] Compound 9 (10 g, 59.5 mmol) was dissolved in 120 mL of a dry mixture of DMF and acetic acid (1:1), and NBS (11.66 g, 65.5 mmol) was added. The mixture was heated in an oil bath under Ar protection and refluxed overnight at 120 °C. After the reaction was complete, the mixture was extracted three times with ethyl acetate and water. The organic phases were combined, dried, and the solvent was evaporated. The residue was subjected to column chromatography to give 11.2 g of product, with a yield of 78%. ¹H NMR (400 MHz, Chloroform-d) δ 10.01 (s, 1H), 7.70 (d, J = 5.3 Hz, 1H), 7.33 (d, J = 5.3 Hz, 1H).

[0545] Compound 19

[0546] Following the synthesis method of compound 1, the yield was 85%. ¹H NMR (400 MHz, DMSO-d6) δ 10.15 (s, ¹H), 7.87 (s, ¹H), 6.39 (s, ¹H), 3.09 (s, 6H).

[0547] (I-5-51)

[0548]

[0549] Following the synthesis method in (I-5-1), the yield was 90.2%. ¹H NMR (400 MHz, DMSO-d6) δ 12.25 (s, ¹H), 8.017 (s, ¹H), 87 (s, ¹H), 6.39 (s, ¹H), 3.09 (s, 6H).

[0550] (I-5-52)

[0551]

[0552] Following the synthesis method in (I-5-1), the yield was 96.1%. ¹H NMR (400 MHz, DMSO-d6) δ 15.35 (s, ¹H), 7.91 (s, ¹H), 7.87 (s, ¹H), 6.59 (s, ¹H), 3.09 (s, 6H).

[0553] (I-5-53)

[0554]

[0555] Following the synthesis method in (I-5-1), the yield was 71.3%. ¹H NMR (400 MHz, DMSO-d6) δ 11.35 (s, ¹H), 7.96 (s, ¹H), 7.57 (s, ¹H), 6.59 (s, ¹H), 3.09 (s, 6H).

[0556] (I-5-54)

[0557]

[0558] Following the synthesis method in (I-5-1), the yield was 78.5%. ¹H NMR (400 MHz, DMSO-d6) δ 11.35 (s, ¹H), 7.64 (s, ¹H), 7.57 (s, ¹H), 6.59 (s, ¹H), 3.09 (s, 6H).

[0559]

[0560] 2-Bromodithiophene (0.438 g, 2 mmol) was dissolved in 15 mL of N-methyl-N-hydroxyethylamine, and copper powder (6.4 mg, 0.01 mmol), cuprous iodide (19 mg, 0.01 mmol), and tripotassium phosphate (0.850 g, 4 mmol) were added. The mixture was heated overnight in an oil bath at 80 °C under Ar protection. After the reaction was completed, the mixture was cooled to room temperature, and the system was poured into 50 mL of water. The mixture was extracted three times with dichloromethane (50 mL each time). The organic phases were combined, the solvent was evaporated by rotary evaporation, and the product was separated by column chromatography to obtain 0.362 g of yellow product, with a yield of 85%. 1H-NMR (400MHz, CDCl3): δ=7.92 (s, 1H), 7.63 (d, 1H, J=5.2Hz), 7.31 (d, 1H, J=5.2Hz), 3.85 (t, 2H, J=5.6Hz), 3.60 (t, 2H, J=5.6Hz), 3.10 (s, 3H).

[0561] Compound 21

[0562] Compound 20 (0.426 g, 2 mmol) was dissolved in 50 mL of anhydrous dichloromethane. 1 mL of triethylamine was added, and acetic anhydride (0.3 mL, 3 mmol) was slowly added dropwise under ice bath conditions. After the addition was complete, the system was slowly brought to room temperature and stirred for 3 h. After the reaction was complete, 100 mL of water was added, and the organic phase was separated. The aqueous phase was extracted twice with 50 mL of dichloromethane. The organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was evaporated by rotary evaporation. The residue did not require further purification and was used directly in the next step.

[0563] The above residue was dissolved in 50 ml of dichloromethane, 5 ml of dimethylformamide was added, and 2 ml of phosphorus oxychloride was added under ice bath conditions. The mixture was stirred for 0.5 h under Ar protection, and the system was slowly raised to room temperature. Stirring was continued for another 5 h. After the reaction was complete, saturated sodium carbonate solution was added to adjust the pH to 10.0, and the mixture was stirred overnight at room temperature. The organic phase was separated the next day, and the aqueous phase was extracted three times with 50 ml of dichloromethane. The organic phases were combined, washed twice with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated by rotary evaporation. The residue was separated by column chromatography to give 0.285 g of a yellow solid, with a yield of 59%. ¹H-NMR (400 MHz, CDCl₃): δ = 10.01 (s, 1H), 7.92 (s, 1H), 7.63 (s, 1H), 3.85 (t, 2H, J = 5.6 Hz), 3.60 (t, 2H, J = 5.6 Hz), 3.10 (s, 3H).

[0564] (I-5-55)

[0565]

[0566] Following the synthesis method in (I-5-1), the yield was 58.1%. ¹H-NMR (400 MHz, CDCl₃): δ = 12.31 (s, ¹H), 7.92 (s, ¹H), 7.63 (s, ¹H), 6.96 (s, ¹H), 3.85 (t, 2H, J = 5.6 Hz), 3.60 (t, 2H, J = 5.6 Hz), 3.10 (s, 3H).

[0567] (I-5-56)

[0568]

[0569] Following the synthesis method in (I-5-1), the yield was 70.1%. ¹H-NMR (400 MHz, CDCl₃): δ = 13.56 (s, ¹H), 7.92 (s, ¹H), 7.63 (s, ¹H), 6.96 (s, ¹H), 3.85 (t, 2H, J = 5.6 Hz), 3.60 (t, 2H, J = 5.6 Hz), 3.10 (s, 3H).

[0570] (I-5-57)

[0571]

[0572] Following the synthesis method in (I-5-1), the yield was 86.1%. ¹H-NMR (400 MHz, CDCl₃): δ = 13.45 (s, ¹H), 7.92 (s, ¹H), 7.63 (s, ¹H), 6.91 (s, ¹H), 3.85 (t, 2H, J = 5.6 Hz), 3.60 (t, 2H, J = 5.6 Hz), 3.10 (s, 3H).

[0573] (I-5-58)

[0574]

[0575] Following the synthesis method in (I-5-1), the yield was 96.8%. ¹H-NMR (400 MHz, CDCl₃): δ = 17.23 (s, ¹H), 7.92 (s, ¹H), 7.63 (s, ¹H), 6.91 (s, ¹H), 3.85 (t, 2H, J = 5.6 Hz), 3.60 (t, 2H, J = 5.6 Hz), 3.10 (s, 3H).

[0576]

[0577] Compound 22 was synthesized using the same method as compound 21, with a yield of 52.1%. ¹H-NMR (400 MHz, CDCl₃): δ = 10.01 (s, ¹H), 7.92 (s, ¹H), 7.63 (s, ¹H), 3.85 (t, J = 5.6 Hz, 4H), 3.60 (t, J = 5.6 Hz, 4H).

[0578] (I-5-59)

[0579]

[0580]

[0581] Following the synthesis method in (I-5-1), the yield was 86.1%. ¹H-NMR (400 MHz, CDCl₃): δ = 7.92 (s, ¹H), 7.63 (s, ¹H), 6.91 (s, ¹H), 3.85 (t, J = 5.6 Hz, 4H), 3.60 (t, J = 5.6 Hz, 4H), 3.59 (s, ³H).

[0582] (I-5-60)

[0583]

[0584] Following the synthesis method in (I-5-1), the yield was 88.6%. ¹H-NMR (400 MHz, CDCl₃): δ = 7.92 (s, ¹H), 7.63 (s, ¹H), 6.65 (s, ¹H), 3.85 (t, J = 5.6 Hz, 4H), 3.60 (t, J = 5.6 Hz, 4H), 3.45 (s, 3H).

[0585] Compound 23

[0586]

[0587] Compound 23 was synthesized using the same method as compound 19, with a yield of 82.3%. ¹H-NMR (400 MHz, CDCl₃): δ = 9.81 (s, ¹H), 7.68 (d, ¹H, J = 7.88 Hz), 7.55 (d, ¹H, J = 7.88 Hz), 7.25 (d, 2H, J = 8.00 Hz), 6.78 (d, 2H, J = 8.00 Hz), 3.86 (t, 2H, J = 4.80 Hz), 3.56 (t, 2H, J = 4.80 Hz), 3.06 (s, 3H).

[0588] (I-5-61)

[0589]

[0590] Following the synthesis method in (I-5-1), the yield was 84.1%. ¹H-NMR (400 MHz, CDCl₃): δ = 13.21 (s, ¹H), 7.68 (d, ¹H, J = 7.88 Hz), 7.55 (d, ¹H, J = 7.88 Hz), 7.25 (d, 2H, J = 8.00 Hz), 6.80 (s, ¹H), 6.78 (d, 2H, J = 8.00 Hz), 3.86 (t, 2H, J = 4.80 Hz), 3.56 (t, 2H, J = 4.80 Hz), 3.06 (s, 3H).

[0591]

[0592] Compound 24 was synthesized using the same method as compound 19, with a yield of 59.3%. ¹H-NMR (400 MHz, CDCl₃): δ = 10.01 (s, ¹H), 7.68 (d, ¹H, J = 7.88 Hz), 7.55 (d, ¹H, J = 7.88 Hz), 7.25 (d, ¹H, J = 7.65 Hz), 6.78 (d, ¹H, J = 7.65 Hz), 3.86 (t, 2H, J = 4.80 Hz), 3.56 (t, 2H, J = 4.80 Hz), 3.06 (s, 3H).

[0593] (I-5-62)

[0594]

[0595] Following the synthesis method in (I-5-1), the yield was 78.3%. ¹H-NMR (400 MHz, CDCl₃): δ = 11.21 (s, ¹H), 7.68 (d, ¹H, J = 7.88 Hz), 7.55 (d, ¹H, J = 7.88 Hz), 7.25 (d, ¹H, J = 7.65 Hz), 6.82 (s, ¹H), 6.78 (d, ¹H, J = 7.65 Hz), 3.86 (t, 2H, J = 4.80 Hz), 3.56 (t, 2H, J = 4.80 Hz), 3.06 (s, 3H).

[0596] Compound 25

[0597]

[0598] Compound 25 was synthesized using the same method as compound 19, with a yield of 58.9%. ¹H-NMR (400 MHz, CDCl₃): δ = 10.35 (s, ¹H), 7.68 (d, ¹H, J = 7.88 Hz), 7.55 (d, ¹H, J = 7.88 Hz), 7.25 (d, 2H, J = 8.23 ​​Hz), 6.78 (d, 2H, J = 8.23 ​​Hz), 3.86 (t, 2H, J = 5.02 Hz), 3.56 (t, 2H, J = 5.02 Hz), 3.06 (s, 3H).

[0599] (I-5-63)

[0600]

[0601] Following the synthesis method in (I-5-1), the yield was 74.7%. ¹H-NMR (400 MHz, CDCl₃): δ = 7.68 (d, ¹H, J = 7.88 Hz), 7.55 (d, ¹H, J = 7.88 Hz), 7.25 (d, 2H, J = 8.23 ​​Hz), 6.82 (s, ¹H), 6.78 (d, 2H, J = 8.23 ​​Hz), 3.86 (t, 2H, J = 5.02 Hz), 3.56 (t, 2H, J = 5.02 Hz), 3.52 (s, 3H), 3.06 (s, 3H).

[0602] Compound 26

[0603]

[0604] The compound was synthesized using the same method as compound 21, with a yield of 49.6%. ¹H-NMR (400 MHz, CDCl₃): δ = 9.92 (s, ¹H), 7.81 (s, ¹H), 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (s, ¹H), 6.82 (d, J = 9.1, 2.3 Hz, ¹H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.10 (s, 3H).

[0605] (I-5-64)

[0606]

[0607] Following the synthesis method in (I-5-1), the yield was 90.1%. ¹H-NMR (400 MHz, CDCl₃): δ = 12.56 (s, ¹H), 7.81 (s, ¹H), 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (s, ¹H), 6.85 (s, ¹H), 6.82 (d, J = 9.1 Hz, ¹H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.10 (s, 3H).

[0608] (I-5-65)

[0609]

[0610] Following the synthesis method in (I-5-1), the yield was 72.3%. ¹H-NMR (400 MHz, CDCl₃): δ = 11.01 (s, ¹H), 7.81 (s, ¹H), 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (s, ¹H), 6.85 (s, ¹H), 6.82 (d, J = 9.1 Hz, ¹H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.01 (s, 3H).

[0611] (I-5-66)

[0612]

[0613] Following the synthesis method in (I-5-1), the yield was 95.3%. ¹H-NMR (400 MHz, CDCl₃): δ = 16.01 (s, ¹H), 7.81 (s, ¹H), 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (s, ¹H), 6.82 (d, J = 9.1 Hz, ¹H), 6.65 (s, ¹H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.01 (s, 3H).

[0614] Compound 27

[0615]

[0616] The compound was synthesized using the same method as compound 21, with a yield of 60.3%. ¹H-NMR (400 MHz, CDCl₃): δ = 9.92 (s, ¹H), 7.81 (s, ¹H), 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (d, J = 2.0 Hz, ¹H), 6.82 (d, J = 9.1, 2.3 Hz, ¹H), 3.05 (s, 6H).

[0617] (I-5-67)

[0618]

[0619] Following the synthesis method in (I-5-1), the yield was 75.5%. ¹H-NMR (400 MHz, CDCl₃): δ = 12.06 (s, ¹H), 7.81 (s, ¹H), 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (d, J = 2.0 Hz, ¹H), 6.85 (s, ¹H), 6.82 (d, J = 9.1, 2.3 Hz, ¹H), 3.05 (s, 6H).

[0620] Compound 28

[0621]

[0622] Compound 28 was synthesized using the same method as compound 21, with a yield of 50.6%. ¹H-NMR (400 MHz, CDCl₃): δ = 10.02 (s, ¹H), 7.81 (s, ¹H), 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (d, J = 2.0 Hz, ¹H), 6.82 (d, J = 9.1, 2.3 Hz, ¹H), 3.61 (t, J = 8.0 Hz, 4H), 3.34 (t, J = 8.0 Hz, 4H).

[0623] (I-5-68)

[0624]

[0625] Following the synthesis method in (I-5-1), the yield was 88.3%. ¹H-NMR (400 MHz, CDCl₃): δ = 7.81 (s, ¹H), 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (d, J = 2.0 Hz, ¹H), 6.85 (s, ¹H), 6.82 (d, J = 9.1, 2.3 Hz, ¹H), 3.61 (t, J = 8.0 Hz, 4H), 3.52 (s, 3H), 3.34 (t, J = 8.0 Hz, 4H).

[0626] Compound 29

[0627]

[0628] Compound 29 was synthesized using the same method as compound 21, with a yield of 49.9%. ¹H-NMR (400 MHz, CDCl₃): δ = 9.92 (s, ¹H), 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (s, ¹H), 6.82 (d, J = 9.1, 2.3 Hz, ¹H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.10 (s, 3H).

[0629] (I-5-69)

[0630]

[0631] Following the synthesis method in (I-5-1), the yield was 75.3%. ¹H-NMR (400 MHz, CDCl₃): δ = 12.31 (s, ¹H), 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (s, ¹H), 6.85 (s, ¹H), 6.82 (d, J = 9.1, 2.3 Hz, ¹H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.10 (s, 3H).

[0632] (I-5-70)

[0633]

[0634] Following the synthesis method in (I-5-1), the yield was 48.8%. ¹H-NMR (400 MHz, CDCl₃): δ = 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (s, ¹H), 6.85 (s, ¹H), 6.82 (d, J = 9.1, 2.3 Hz, ¹H), 4.24 (t, J = 5.2 Hz, 2H), 3.61 (t, J = 8.0 Hz, 2H), 3.34 (t, J = 8.0 Hz, 2H), 3.10 (s, 3H), 2.63 (t, J = 5.2 Hz, 2H).

[0635] (I-5-71)

[0636]

[0637] Following the synthesis method in (I-5-1), the yield was 78.9%. ¹H-NMR (400 MHz, CDCl₃): δ = 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (s, ¹H), 6.85 (s, ¹H), 6.82 (d, J = 9.1, 2.3 Hz, ¹H), 3.61 (t, J = 8.0 Hz, 2H), 3.52 (s, 3H), 3.34 (t, J = 8.0 Hz, 2H), 3.10 (s, 3H).

[0638] (I-5-72)

[0639]

[0640] Following the synthesis method in (I-5-1), the yield was 98.4%. ¹H-NMR (400 MHz, CDCl₃): δ = 7.68 (d, J = 9.0 Hz, ¹H), 6.92 (s, ¹H), 6.85 (s, ¹H), 6.82 (d, J = 9.1, 2.3 Hz, ¹H).

[0641] Compound 30

[0642]

[0643] Compound 30 was synthesized using the same method as compound 19, with a yield of 42.5%. ¹H-NMR (400 MHz, CDCl₃): δ = 9.92 (s, ¹H), 7.82 (s, ¹H), 7.71 (m, ¹H), 7.60 (m, 2H), 6.78 (m, 2H), 3.82 (t, 4H, J = 5.6 Hz), 3.54 (t, 4H, J = 5.6 Hz), 1.42 (s, 6H).

[0644] (I-5-73)

[0645]

[0646] Following the synthesis method in (I-5-1), the yield was 88.9%. ¹H-NMR (400 MHz, CDCl₃): δ = 12.31 (s, ¹H), 7.82 (s, ¹H), 7.71 (m, ¹H), 7.60 (m, 2H), 6.85 (s, ¹H), 6.78 (m, 2H), 3.82 (t, 4H, J = 5.6 Hz), 3.54 (t, 4H, J = 5.6 Hz), 1.42 (s, 6H).

[0647] Compound 31

[0648]

[0649] Compound 31 was synthesized using the same method as compound 19, with a yield of 82.7%. ¹H-NMR (400 MHz, CDCl₃): δ = 9.92 (s, 1H), 7.82 (s, 1H), 7.71 (m, 1H), 7.60 (m, 2H), 6.78 (m, 2H), 3.62 (s, 6H), 1.42 (s, 6H).

[0650] (I-5-74)

[0651]

[0652] Following the synthesis method in (I-5-1), the yield was 78.3%. ¹H-NMR (400 MHz, CDCl₃): δ = 11.23 (s, ¹H), 7.82 (s, ¹H), 7.71 (m, ¹H), 7.60 (m, 2H), 6.85 (s, ¹H), 6.78 (m, 2H), 3.62 (s, 6H), 1.42 (s, 6H).

[0653] Compound 32

[0654]

[0655] Compound 32 was synthesized using the same method as compound 19, with a yield of 63.0%. ¹H-NMR (400 MHz, CDCl₃): δ = 9.92 (s, 1H), 7.82 (s, 1H), 7.71 (m, 1H), 7.60 (m, 2H), 6.78 (m, 2H), 3.82 (t, J = 5.6 Hz, 2H), 3.54 (t, J = 5.6 Hz, 2H), 3.05 (s, 3H), 1.42 (s, 6H).

[0656] (I-5-75)

[0657]

[0658] Following the synthesis method in (I-5-1), the yield was 98.3%. ¹H-NMR (400 MHz, CDCl₃): δ = 14.89 (s, ¹H), 7.82 (s, ¹H), 7.71 (m, ¹H), 7.60 (m, 2H), 6.85 (s, ¹H), 6.78 (m, 2H), 3.82 (t, J = 5.6 Hz, 2H), 3.54 (t, J = 5.6 Hz, 2H), 3.05 (s, 3H), 1.42 (s, 6H). (I-5-76)

[0659]

[0660] Following the synthetic method described in (I-5-1), the yield was 72.8%. ¹H-NMR (400 MHz, CDCl₃): δ = 12.03 (s, 1H), 7.82 (s, 1H), 7.71 (m, 1H), 7.60 (m, 2H), 6.82 (s, 1H), 6.78 (m, 2H), 3.82 (t, J = 5.6 Hz, 2H), 3.54 (t, J = 5.6 Hz, 2H), 3.05 (s, 3H), 1.42 (s, 6H). Compound 33

[0661]

[0662] Compound 33 was synthesized using the same method as compound 19, with a yield of 68.1%. ¹H-NMR (400 MHz, CDCl₃): δ = 9.92 (s, 1H), 7.82 (s, 1H), 7.71 (m, 1H), 7.60 (m, 2H), 3.82 (t, J = 5.6 Hz, 2H), 3.54 (t, J = 5.6 Hz, 2H), 3.05 (s, 3H), 1.42 (s, 6H).

[0663] (I-5-77)

[0664]

[0665] Following the synthesis method in (I-5-1), the yield was 70.1%. ¹H-NMR (400 MHz, CDCl₃): δ = 12.05 (s, ¹H), 7.82 (s, ¹H), 7.71 (m, ¹H), 7.60 (m, 2H), 6.82 (s, ¹H), 3.82 (t, J = 5.6 Hz, 2H), 3.54 (t, J = 5.6 Hz, 2H), 3.05 (s, 3H), 1.42 (s, 6H).

[0666] (I-5-78)

[0667]

[0668] Following the synthesis method in (I-5-1), the yield was 70.2%. ¹H-NMR (400 MHz, CDCl₃): δ = 11.25 (s, ¹H), 7.82 (s, ¹H), 7.71 (m, ¹H), 7.60 (m, 2H), 6.82 (s, ¹H), 3.82 (t, J = 5.6 Hz, 2H), 3.54 (t, J = 5.6 Hz, 2H), 3.05 (s, 3H), 1.42 (s, 6H).

[0669] (I-5-79)

[0670]

[0671] Following the synthesis method in (I-5-1), the yield was 80.6%. ¹H-NMR (400 MHz, CDCl₃): δ = 13.01 (s, ¹H), 7.82 (s, ¹H), 7.71 (m, ¹H), 7.60 (m, 2H), 6.82 (s, ¹H), 3.82 (t, J = 5.6 Hz, 2H), 3.54 (t, J = 5.6 Hz, 2H), 3.05 (s, 3H), 1.42 (s, 6H).

[0672] Compound 34

[0673]

[0674] Compound 34 was synthesized using the same method as compound 19, with a yield of 58.9%. ¹H-NMR (400 MHz, CDCl₃): δ = 9.92 (s, 1H), 7.82 (s, 1H), 7.71 (m, 1H), 7.60 (m, 2H), 3.82 (t, J = 5.6 Hz, 4H), 3.54 (t, J = 5.6 Hz, 4H), 3.05 (s, 3H), 1.42 (s, 6H).

[0675] (I-5-80)

[0676]

[0677] Following the synthesis method in (I-5-1), the yield was 90.6%. ¹H-NMR (400 MHz, CDCl₃): δ = 7.82 (s, ¹H), 7.71 (m, ¹H), 7.60 (m, 2H), 3.82 (t, J = 5.6 Hz, 4H), 3.54 (t, J = 5.6 Hz, 4H), 3.55 (s, 3H), 1.42 (s, 6H).

[0678] Compound 35

[0679]

[0680] Compound 35 was synthesized using the same method as compound 19, with a yield of 59.7%. ¹H-NMR (400 MHz, CDCl₃): δ = 10.02 (s, ¹H), 7.82 (s, ¹H), 7.71 (s, ¹H), 3.82 (t, J = 5.6 Hz, 2H), 3.54 (t, J = 5.6 Hz, 2H), 3.05 (s, 3H), 1.42 (s, 6H).

[0681] (I-5-81)

[0682]

[0683] Following the synthesis method in (I-5-1), the yield was 70.2%. ¹H-NMR (400 MHz, CDCl₃): δ = 7.82 (s, ¹H), 7.71 (s, ¹H), 3.82 (t, J = 5.6 Hz, 2H), 3.54 (t, J = 5.6 Hz, 2H), 3.05 (s, 3H), 1.42 (s, 6H).

[0684] (I-5-82)

[0685]

[0686] Following the synthesis method in (I-5-1), the yield was 95.4%. ¹H-NMR (400 MHz, CDCl₃): δ = 14.21 (s, ¹H), 7.82 (s, ¹H), 7.71 (s, ¹H), 3.82 (t, J = 5.6 Hz, 2H), 3.54 (t, J = 5.6 Hz, 2H), 3.05 (s, 3H), 1.42 (s, 6H).

[0687] (I-5-83)

[0688]

[0689] Following the synthesis method in (I-5-1), the yield was 95.1%. ¹H-NMR (400 MHz, CDCl₃): δ = 12.21 (s, ¹H), 7.82 (s, ¹H), 7.71 (s, ¹H), 3.82 (t, J = 5.6 Hz, 2H), 3.54 (t, J = 5.6 Hz, 2H), 3.05 (s, 3H), 1.42 (s, 6H).

[0690] Compound 36

[0691]

[0692] Compound 36 was synthesized using the same method as compound 19, with a yield of 63.5%. ¹H-NMR (400 MHz, CDCl₃): δ = 10.02 (s, ¹H), 7.82 (s, ¹H), 7.71 (s, ¹H), 3.82 (t, J = 5.6 Hz, 4H), 3.54 (t, J = 5.6 Hz, 4H), 1.42 (s, 6H).

[0693] (I-5-84)

[0694]

[0695] Following the synthesis method in (I-5-1), the yield was 88.3%. ¹H-NMR (400 MHz, CDCl₃): δ = 7.82 (s, ¹H), 7.71 (s, ¹H), 3.82 (t, J = 5.6 Hz, 4H), 3.54 (t, J = 5.6 Hz, 4H), 3.55 (s, 3H), 1.42 (s, 6H).

[0696] It should be understood that the dosages, reaction conditions, etc., in the various embodiments of this specification are approximate unless otherwise specified, and can be slightly modified according to actual circumstances to obtain similar results. Unless specifically defined, all technical and scientific terms used herein have the same meaning as understood by those skilled in the art. All documents mentioned herein are incorporated herein by reference. The preferred embodiments described in this specification are exemplary. Those skilled in the art can implement the invention using similar methods and materials to obtain the same or similar results. Various modifications or alterations to the invention still fall within the scope defined by the appended claims. sequence list <110> Naying (Shanghai) Biotechnology Co., Ltd. <120> A method for RNA detection and quantification <130> 072-2108062IP <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 42 <212> RNA <213> Synthetic Sequence <400> 1 gguguaguau gacguucgcg ucaggaagaa uugaucucgg cc 42 <210> 2 <211> 100 <212> RNA <213> Synthetic Sequence (Synthetic Sequence) <400> 2 uugccaugug uauguggguu cgcccacaua cucugaugau ccgguguagu agguccuucg ggaccggaag aauugaucuc ggccggauca uucauggcaa <210> 3 <211> 141 <212> RNA <213> Synthetic Sequence (Synthetic Sequence) <400> 3 gcccggauag cucagucggu agagcagcgc ugguguagu agguguagua gguccuucgg gaccggaaga auugaucucg gccggaaga uugaucucgg cccagcgcgg guccaggguu caagucccug uucggggcgcc a <210> 4 <211> 42 <212> RNA <213> Synthetic Sequence (Synthetic Sequence) <400> 4 gguguaguau gacguucgcg ucaggaaga uugaucucgg cc <210> 5 <211> 42 <212> RNA <213> Synthetic Sequence (Synthetic Sequence) <400> 5 gguguaguau gacguucgcg ucaggaaga uugaucucgg cc <210> 6 <211> 138 <212> RNA <213> Synthetic Sequence <400> 6 uugccaugug uauguggguu cgcccacaua cucugaugau ccgguguagu agguccggug 60 uaguaggucc uucgggaccg gaagaauuga ucucggccgg accggaagaa uugaucucgg 120 ccggaucauu cauggcaa 138 <210> 7 <211> 214 <212> RNA <213> Synthetic Sequence <400> 7 uugccaugug uauguggguu cgcccacaua cucugaugau ccgguguagu agguccggug 60 uaguaggucc gguguaguag guccggugua guagguccuu cgggaccgga agaauugauc 120 ucggccggac cggaagaauu gaucucggcc ggaccggaag aauugaucuc ggccggaccg 180 gaagaauuga ucucggccgg aucauucaug gcaa 214 <210> 8 <211> 99 <212> RNA <213> Synthetic Sequence <400> 8 gguguaguag guccuucggg accggaagaa uugaucucgg cccaaaacaa aacaaaaggu 60 guaguagguc cuucgggacc ggaagaauug aucucggcc 99 <210> 9 <211> 213 <212> RNA <213> Synthetic Sequence <400> 9 gguguaguag guccuucggg accggaagaa uugaucucgg cccaaaacaa aacaaaaggu 60 guaguagguc cuucgggacc ggaagaauug aucucggccc aaaacaaaac aaaaggugua 120 guagguccuu cgggaccgga agaauugauc ucggcccaaa acaaaacaaa agguguagua 180 gguccuucgg gaccggaaga auugaucucg gcc 213 <210> 10 <211> 185 <212> RNA <213> Synthetic Sequence <400> 10 gguguaguag guccggugua guagguccuu cgggaccgga agaauugauc ucggccggac 60 cggaagaauu gaucucggcc caaaacaaaa caaaacaaaa caaaaggugu aguagguccg 120 guguaguagg uccuucggga ccggaagaau ugaucucggc cggaccggaa gaauugaucu 180 cggcc 185 <210> 11 <211> 395 <212> RNA <213> Synthetic Sequence <400> 11 gguguaguag guccggugua guagguccuu cgggaccgga agaauugauc ucggccggac 60 cggaagaauu gaucucggcc caaaacaaaa caaaacaaaa caaaaggugu aguagguccg 120 guguaguagg uccuucggga ccggaagaau ugaucucggc cggaccggaa gaauugaucu 180 cggcccaaaa caaaacaaaa caaaacaaaa gguguaguag guccggugua guagguccuu 240 cgggaccgga agaauugauc ucggccggac cggaagaauu gaucucggcc caaaacaaaa 300 caaaacaaaa caaaaggugu aguagguccg guguaguagg uccuucggga ccggaagaau 360 ugaucucggc cggaccggaa gaauugaucu cggcc 395 <210> 12 <211> 201 <212> RNA <213> Synthetic Sequence <400> 12 gggccgcacu cgccgguccc aagcccggau aaaaugggag ggggcgggaa accgccuaac 60 caugccgagu gcggccgcgg uguaguaggu ccuucgggac cggaagaauu gaucucggcc 120 guggccgcgg ucggcgugga cuguagaaca cugccaaugc cggucccaag cccggauaaa 180 aguggagggu acaguccacg c 201 <210> 13 <211> 159 <212> RNA <213> Synthetic Sequence <400> 13 gugcucgcuu cggcagcaca uauacuaaaa uuggaacgau acagagaaga uuagcauggc 60 cccucgaaga ggguguagua gguccuucgg gaccggaaga auugaucucg gcccucuucg 120 aggaugacac gcaaauucgu gaagcguucc auauuuuug 159 <210> 14 <211> 1186 <212> RNA <213> Synthetic Sequence <400> 14 auggaugaug auaucgccgc gcucgucguc gacaacggcu ccggcaugug caaggccggc 60 uucgcgggcg acgaugcccc ccgggccguc uuccccucca ucguggggcg ccccaggcac 120 cagggcguga uggugggcau gggucagaag gauuccuaug ugggcgacga ggcccagagc 180 aagagaggca uccucacccu gaaguacccc aucgagcacg gcaucgucac caacugggac 240 gacauggaga aaaucuggca ccacaccuuc uacaaugagc ugcguguggc ucccgaggag 300 caccccgugc ugcugaccga ggccccccug aaccccaagg ccaaccgcga gaagaugacc 360 cagaucaugu uugagaccuu caacacccca gccauguacg uugcuaucca ggcugugcua 420 ucccuguacg ccucuggccg uaccacuggc aucgugaugg acuccgguga cggggucacc 480 cacacugugc ccaucuacga gggguaugcc cucccccaug ccauccugcg ucuggaccug 540 gcuggccggg accugacuga cuaccucaug aagauccuca ccgagcgcgg cuacagcuuc 600 accaccacgg ccgagcggga aaucgugcgu gacauuaagg agaagcugug cuacgucgcc 660 cuggacuucg agcaagagau ggccacggcu gcuuccagcu ccucccugga gaagagcuac 720 gagcugccug acggccaggu caucaccauu ggcaaugagc gguuccgcug cccugaggca 780 cucuuccagc cuuccuuccu gggcauggag uccuguggca uccacgaaac uaccuucaac 840 uccaucauga agugugacgu ggacauccgc aaagaccugu acgccaacac agugcugucu 900 ggcggcacca ccauguaccc uggcauugcc gacaggaugc agaaggagau cacugcccug 960 gcacccagca caaugaagau caagaucauu gcuccuccug agcgcaagua cuccgugugg 1020 aucggcggcu ccauccuggc cucgcugucc accuuccagc agauguggau cagcaagcag 1080 gaguaugacg aguccggccc cuccaucguc caccgcaaau gcuucuagcu cgaggccgcg 1140 guguaguaug acguucgcgu caggaaau ugaucucggc cgcggc 1186

Claims

1. A nucleic acid aptamer molecule, said aptamer molecule being selected from one of the following nucleotide sequences: Substitutional mutants of SEQ ID Nos: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 and SEQ ID No: 1,The substitution mutants of SEQ ID No: 1 are selected from one of the following groups: U2A, U2C, U2G, G3A, G3U, G3C, U4A, U4C, U4G, A5U, A5C, A5G, G6A, G6U, G6C, U7A, U7C, U7G, A8U, A8C, A8G, G12A, G12U, G12C, G13A, G13U, G13C, A14U, A14C, A14G, A15U, A15C, A15G, G16A, G16U, G16C, A17U, A17C, A17G, A18U, A18C, A18G, U19A, U19C, U19G, U20A, U20C, U20G, G21A, G21U, G21C, A22U, A22C, A22G, U23A, U23C, U23G, C24A, C24U, C24G, U25A, U25C, U25G, C26A, C26U, C26G, G27A, G27U, G27C, G28A, G28U, G28C, A5U / U25A, A5C / U25G, A5G / U25C, G6A / C24U, G6U / C24A, G6C / C24G, U4A / G12A, U4A / G13U, U4A / G16A, U4A / U20C, U4A / A22C, G12A / G13U, G12A / G16A, G12A / U20C, G12A / A22C, G13U / G16A, G13U / U20C, G13U / A22C, G16A / U20C, G16A / A22C, U20C / A22C, U4A / G 2. The nucleic acid aptamer molecule according to claim 1, wherein the aptamer function refers to the ability of the nucleic acid aptamer to increase the fluorescence intensity of the fluorophore molecule by at least 2 times under excitation light of a suitable wavelength.

3. The nucleic acid aptamer molecule according to claim 1, wherein the aptamer function refers to the ability of the nucleic acid aptamer to increase the fluorescence intensity of the fluorophore molecule by 5-10 times under excitation light of a suitable wavelength.

4. The nucleic acid aptamer molecule according to claim 1, wherein the aptamer function refers to the ability of the nucleic acid aptamer to increase the fluorescence intensity of the fluorophore molecule by 20-50 times under excitation light of a suitable wavelength.

5. The nucleic acid aptamer molecule according to claim 1, wherein the aptamer function refers to the ability of the nucleic acid aptamer to increase the fluorescence intensity of the fluorophore molecule by 100-200 times under excitation light of a suitable wavelength.

6. The nucleic acid aptamer molecule according to claim 1, wherein the aptamer function refers to the ability of the nucleic acid aptamer to increase the fluorescence intensity of the fluorophore molecule by 200-1000 times under excitation light of a suitable wavelength.

7. The nucleic acid aptamer molecule according to claim 1, wherein the aptamer function refers to the ability of the nucleic acid aptamer to increase the fluorescence intensity of the fluorophore molecule by 1000-5000 times under excitation light of a suitable wavelength.

8. A complex of a nucleic acid aptamer molecule and a fluorophore molecule, wherein the nucleic acid aptamer molecule is the nucleic acid aptamer molecule of claim 1, and the fluorophore molecule is selected from compounds of the following formula: 。 9. The complex according to claim 8, wherein the aptamer molecule is a nucleotide sequence SEQ ID No: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14.

10. The use of the complex according to any one of claims 8-9 for non-disease diagnostic and disease treatment purposes in detecting or labeling target nucleic acid molecules in vitro or in vivo.

11. A DNA molecule that transcribes the nucleic acid aptamer molecule according to any one of claims 1-7.

12. An expression vector comprising the DNA molecule of claim 11.

13. A host cell comprising the expression vector of claim 12.

14. A kit comprising the nucleic acid aptamer molecule of any one of claims 1-7 and / or the expression vector of claim 12 and / or the host cell of claim 13 and / or the complex of any one of claims 8-9.

15. A method for detecting target molecules, comprising the steps of: Add the complex according to any one of claims 8-9 to a solution containing the target molecule; Excite the complex with light of a suitable wavelength; Detect the fluorescence of the complex.

16. A method for extracting and purifying RNA, comprising extracting and purifying RNA using the complex according to any one of claims 8-9.

Images