Mini-rep gene for evaluating ush2a exon 13 knockout efficiency, expression vector thereof and application
By combining introns and break reporter genes of the MINI-REP gene, the problem of evaluating the efficiency of USH2A exon 13 knockout has been solved, achieving rapid, intuitive, efficient, and highly sensitive evaluation. It is applicable to the evaluation of various USH2A exon 13 knockout technologies and the development of new technologies.
Patent Information
- Application Number
- CN202110884031.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-08-03
- Publication Date
- 2026-01-23
- Estimated Expiration
- 2041-08-03
AI Technical Summary
Existing technologies are insufficient to efficiently, quickly, and accurately assess the knockout efficiency of USH2A exon 13, especially during genomic DNA editing. Conventional methods are time-consuming, complex, and lack sufficient sensitivity, making it difficult to detect subtle differences.
Using the MINI-REP gene, a method for evaluating the knockout efficiency of USH2A exon 13 was constructed by optimizing the combination of intron gene fragments and break reporter genes. This method includes reporter genes and small genes, and utilizes the gene sequences of intron 12, exon 13, and intron 13 to simplify the evaluation process and achieve rapid, intuitive, efficient, and highly sensitive qualitative and quantitative analysis.
It enables rapid, intuitive, efficient, and highly sensitive qualitative and quantitative analysis of USH2A exon 13 knockout efficiency, simplifies the evaluation process, and is applicable to the efficiency evaluation of various USH2A exon 13 knockout technologies and the research and development of new technologies.
Smart Images

Figure BDA0003193317330000131 
Figure BDA0003193317330000132 
Figure BDA0003193317330000141
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to the MINI-REP gene for evaluating the knockout efficiency of USH2A exon 13, its expression vector, and its applications. Background Technology
[0002] Usher syndrome is a genetic disorder, also known as deafness-retinitis pigmentosa syndrome, characterized by varying degrees of congenital sensorineural hearing loss and progressive vision loss caused by retinitis pigmentosa (RP). Clinically, Usher syndrome can be divided into three types: 1. Type I Usher syndrome: Patients exhibit congenital severe sensorineural hearing loss, absent vestibular response, and develop retinitis pigmentosa before puberty, gradually leading to blindness. Associated genes include MYO7A, CDH23, USH1C, and PCHD15. 2. Type II Usher syndrome: Patients exhibit congenital moderate to severe sensorineural hearing loss, normal vestibular response, and develop retinitis pigmentosa during puberty, gradually leading to blindness. Associated genes include USH2A, GPR98, and WHRN. 3. Type III Usher syndrome: Patients exhibit progressive sensorineural hearing loss, normal vestibular response, and develop retinitis pigmentosa at the end of puberty, gradually leading to blindness. Associated genes include CLRN1.
[0003] Type II Usher syndrome accounts for more than 50% of all cases. Mutations in the USH2A gene are the most common cause of Usher syndrome type II, affecting more than 50% of patients. Mutations in the USH2A gene are also a significant cause of nonsyndromic retinitis pigmentosa (NSRP).
[0004] USH2A, located at 1q41, spans over 800 kb in the genome and encodes a large transmembrane protein called Usherin. Usherin is anchored to the plasma membrane of retinal photoreceptor cells and inner ear hair cells, and is an essential component for ciliary development and maintenance. In the retina, Usherin is a crucial part of the USH2 complex and is believed to play a role in stabilizing the outer segment of the photoreceptor. USH2A has two isoforms; the dominant isoform in retinal cells contains 72 exons, with a coding region approximately 15.6 kb in length. The extracellular portion of the Usherin protein contains numerous repeating domains, including 10 laminin EGF-like (LE) domains and 35 fibronectin type 3 (FN3) domains. Human USH2A exon 13 is 642 bp in length, encoding amino acids 723–936, which contains four of the ten LE domains in the Usherin protein.
[0005] Mutations in exon 13, exon 50, and intron 40 of the USH2A gene cause Usher syndrome. To date, over 1000 pathogenic mutations have been identified throughout the USH2A gene, with exon 13 being the most frequently mutated exon, accounting for approximately 35%. Mutations in exon 13 of the USH2A gene include c.2802T>G (p.Cys934Trp, the most frequent mutation in Chinese patients), c.2299delG (p.E767SfsX21, the most frequent mutation in European and American patients), c.2276G>T (amino acid change: p.C759F), c.2522C>A (p.S841Y), c.2242C>T (p.Gln748X), c.2541C>A (C847X), c.2761... delC (Leu921fs) and c.2776C>T (p.R926C), c.2209C>T, c.2310delA, c.2391_2392deITG, c.2431A>T, c.2431_ 2432delAA, c.2440C>T, c.2525dup, c.2610C>A, c.2755C>T, c.2176T>C, c.2236C>G, c.2296T>C, c.2332G>T.
[0006] The USH2A coding region is approximately 15.6 kb in length. Conventional gene therapy delivery methods (such as recombinant lentiviruses and recombinant adeno-associated viruses) struggle to package such a large coding sequence, making direct delivery of USH2A for treatment difficult. Existing technologies utilize the CRISPR / Cas system to edit genomic DNA, directly deleting exon 13 or disrupting RNA splicing-related sites. Modifying key bases at these splicing-related sites using a single-base editor can also promote exon skipping. Furthermore, targeting and interfering with pre-mRNA splicing using antisense oligonucleotides (AONs) can significantly improve exon skipping efficiency.
[0007] Existing cytological methods for assessing USH2A exon splicing skipping, as reported in the art, involve evaluating splicing skipping efficiency using RT-PCR and Western blotting in cell lines containing wild-type USH2A (such as Weri-Rb1 cells) or primary cells and induced pluripotent stem cells derived from patients. However, this assessment system involves numerous complex and time-consuming experimental procedures, including RNA / protein extraction, transcription, and electrophoresis. Furthermore, it primarily relies on RT-PCR for qualitative / semi-quantitative assessment; quantitative assessment requires qRT-PCR, which is even more time-consuming and complex, involves many details, and is susceptible to significant errors due to these details, resulting in insufficient sensitivity, particularly in detecting subtle differences. Summary of the Invention
[0008] To address the aforementioned issues, this invention provides a MINI-REP gene for evaluating the efficiency of USH2A exon 13 knockout. This gene can be applied to the efficiency evaluation of all existing technologies used to induce USH2A exon 13 knockout. It can be used for the research and development of new technologies, efficacy testing and efficient screening, and for rapid, intuitive, efficient, and highly sensitive qualitative and quantitative analysis of USH2A exon 13 knockout efficiency.
[0009] This invention provides a MINI-REP gene for evaluating the knockout efficiency of USH2A exon 13, comprising a reporter gene and a small gene. The reporter gene is a gene that performs a reporter function, and the small gene comprises genes for USH2A intron 12, exon 13, and intron 13 connected in sequence. The small gene is inserted into the reporter gene, splitting the reporter gene into fragmented reporter genes. The fragmented reporter genes do not perform a reporter function when expressed alone, but they perform a reporter function when expressed in tandem.
[0010] The aforementioned MINI-REP gene introduces a break reporter gene, which simplifies the evaluation process and enables rapid, intuitive, efficient, and highly sensitive qualitative and quantitative analysis of USH2A exon 13 knockout efficiency.
[0011] The inventors investigated USH2A and found that exon 12 of mouse USH2A is homologous to exon 13 of human USH2A, both being 642 bp in length. Removing this exon did not cause subsequent frameshift mutations. Studies have shown that after knocking out exon 12 of mouse USH2A, Usherin can still correctly locate and perform normal functions. Therefore, for human USH2A exon 13 containing pathogenic mutations, a series of methods can be used to induce read skipping for treatment.
[0012] In researching existing methods for evaluating the efficiency of USH2A exon 13 knockout, the inventors discovered that while replacing exon 12 and related flanking fragments in mice with a MINIGENE (a small gene, located at the 3' end of USH2A intron 12-exon 13-5' end of intron 13) can construct a human-mouse chimeric mouse model, allowing for the evaluation of AON-induced USH2A exon 13 splicing skipping efficiency in mice, this model is time-consuming (0.5-2 years), technically demanding, and costly. Furthermore, the intron length in this model is approximately 100 bp flanking the exon, making it unsuitable for evaluating the efficiency of the new technique "Cas9 dual-target excision of exon 13." This is because Cas9 is limited by the PAM site of the nucleic acid cleavage mechanism, limiting the number of efficient intron sites within 100 bp flanking exon 13, thus rendering it unsuitable. Furthermore, the splicing-related sites of USH2A exon 13 have not been fully discovered. The existing MINIGENE system does not contain the 5' end of intron 12 and the 3' end of intron 13. Splicing-related sites of exon 13 also exist beyond 100 bp flanking exon 13, such as the intron 12 splicing silencing site reported in existing technologies, located at the 5' end of intron 12. Targeting this site with AON can promote efficient splicing skipping of USH2A exon 13. However, this existing technology cannot evaluate the targeting effect on sites beyond 100 bp flanking exon 13. Although existing technologies have extended the intron fragments flanking exon 13 to 1500 bp to broaden the target selection for Cas9, the gene length required to construct chimeric humanized mice exceeds 3642 bp, more than three times the original length, exponentially increasing the difficulty and time required for mouse strain construction.
[0013] Therefore, this invention constructs a MINI-REP gene, its expression vector, virus or cell, and applications, capable of accurately and qualitatively assessing the efficiency of knocking out USH2A exon 13 from the USH2A gene, RNA, or protein level. This invention achieves a simple, convenient, and accurate qualitative and quantitative assessment of the efficiency of knocking out USH2A exon 13 from the USH2A gene, RNA, or protein level through a combination of a sequence-optimized MINIGENE gene and a sequence-optimized break reporter gene.
[0014] This invention can be widely used to evaluate the knockout efficiency of different "USH2A exon 13 knockout" techniques, such as gene knockout and RNA interference. Gene knockout refers to the removal of exon 13 at the gene, RNA, or protein level by performing large-scale excisions of exon 13 in USH2A or disrupting splice-related sites such as splice donor / receptor sites. RNA interference refers to inducing splicing skipping of exon 13 by targeting and knocking out splice-related sites such as splice donor / receptor sites in USH2A, thereby promoting the removal of exon 13 at the RNA level. Furthermore, this invention can achieve precise quantification and comparison of the knockout efficiency of different "induced USH2A exon 13 knockout" techniques.
[0015] In one embodiment, the genes of intron 12 and intron 13 are shortened gene fragments.
[0016] In one embodiment, the genes of intron 12 and intron 13 are formed by tandemly connecting fragments from the 5' end of the intron and fragments from the 3' end of the intron.
[0017] In one embodiment, the gene of intron 12 is obtained by tandemly connecting a gene fragment of length 50-200 bp at the 5' end of intron 12 and a gene fragment of length 200-1700 bp at the 3' end in a 5'-3' sequence, and the gene of intron 13 is obtained by tandemly connecting a gene fragment of length 200-1700 bp at the 5' end of intron 13 and a gene fragment of length 50-200 bp at the 3' end in a 5'-3' sequence.
[0018] The aforementioned intron fragments include the 5' end of intron 12 and the 3' end of intron 13, thus encompassing the sites in these two regions that coordinate with exon 13 splicing skipping. Simultaneously, these intron fragments enable the constructed MINI-REP gene to assess the effects of splicing-related sites beyond 100 bp flanking the exons, facilitating the efficiency evaluation of Cas9 double-cut exon 13 and other technologies used to induce USH2A exon 13 knockout. Furthermore, it can be used for the research and development of novel technologies, effect monitoring, and efficient screening.
[0019] In one embodiment, the 5' segment of intron 12 has a length of 192-204 bp and the 3' segment has a length of 490-1611 bp, while the 5' segment of intron 13 has a length of 706-1599 bp and the 3' segment has a length of 216 bp.
[0020] Choosing sequence fragments of the above length ensures that the ligation of the 5' and 3' ends of introns will not create new splice donors or acceptors or other splice-related sites, and will not affect the splicing of exon 13. This allows for a more accurate simulation of the splicing skipping of USH2A exon 13.
[0021] In one embodiment, the gene of intron 12 includes the following regions and sequences with ≥90% similarity: the splice silencer ISS of intron 12, the splice branching site BP of exon 13, the splice acceptor SA of exon 13, the splice donor SD of exon 13, or the splice enhancer ESE of exon 13.
[0022] The gene of intron 13 includes the following regions and sequences with ≥90% similarity: the splice enhancer ISE of intron 13 or the polypyrimidine bundle of intron 13.
[0023] Using the above sequence as a target, it has the effect of knocking out or co-knocking out exon 13. Therefore, the selection of gene fragments for introns 12 and 13 was optimized. The MINI-REP gene constructed using the above sequence fragments has high sensitivity in assessing the USH2A exon 13 knockout efficiency.
[0024] In one embodiment, the reporter gene is selected from fluorescent protein genes or enzyme-labeled genes. These genes are conventional reporter genes, readily available and easily obtained.
[0025] In one embodiment, the reporter gene is the green fluorescent gene EGFP. Using this reporter gene simplifies the process and provides intuitive and efficient evaluation results.
[0026] In one embodiment, the small gene is inserted between two consecutive G bases within the reporter gene. The break site is selected between two consecutive G bases within the reporter gene based on the conservation of splice donor (SD) and splice acceptor (SA) site efficiency in human pre-mRNA.
[0027] In one embodiment, the small gene is inserted between two G bases of the green fluorescent gene EGFP sequence AGGT.
[0028] In one embodiment, the small gene is inserted between two G bases in the positive strand sequence “AGGT” of the green fluorescent gene EGFP.
[0029] In one embodiment, the small gene is inserted between the two G bases of the first "AGGT" in the positive strand sequence of the green fluorescent gene EGFP.
[0030] The first "AGGT" mentioned above divides the EGFP gene into two halves of relatively similar length. As verified by the embodiments of the present invention, neither of the two EGFP halves after this site is a protein with green fluorescent function.
[0031] In one embodiment, the gene of exon 13 includes a naturally wild-type sequence without mutations or a gene sequence containing mutations.
[0032] In one embodiment, the gene sequence containing the mutated exon 13 includes gene sequences with naturally occurring or pathogenic mutations.
[0033] In one embodiment, the gene in exon 13 includes at least one of the following pathogenic mutations: c.2802T>G (p.Cys934Trp), c.2299delG (p.E767SfsX21), c.2276G>T (p.C759F), c.2522C>A (p.S841Y), c.2242C>T (p.Gln748X), c.2541C>A (C847X), c.2761delC (Le u921fs) and c.2776C>T (p.R926C), c.2209C>T, c.2310delA, c.2391_2392deITG, c.2431A>T, c.2431_2432 delAA, c.2440C>T, c.2525dup, c.2610C>A, c.2755C>T, c.2176T>C, c.2236C>G, c.2296T>C and c.2332G>T.
[0034] In one embodiment, the pathogenic mutations in exon 13 include c.2802T>G or c.2299delG. Because c.2802T>G is the most frequent mutation in Chinese patients, and c.2299delG is the most frequent mutation in European and American patients, selecting exon 13 genes with the above two pathogenic mutations results in a more representative MINI-REP gene.
[0035] In one embodiment, the pathogenic mutation in exon 13 is c.2802T>G. Because this invention has found that c.2299delG exhibits significant spontaneous splicing skipping, much higher than c.2802T>G, c.2802T>G is chosen to avoid the possibility of false positives or inconsistencies between the c.2299delG mutation and actual results, and to prevent impacting the accuracy of subsequent detection of drugs inducing USH2A exon 13 knockout (containing the c.2802T>G mutation).
[0036] The present invention also provides an expression vector for expressing the MINI-REP gene.
[0037] In one embodiment, the expression vector integrates the MINI-REP gene via enzyme ligation.
[0038] The purpose of constructing the expression vector is to insert a pathogenic mutation, human USH2AEXON13, into the reporter gene. mut The sequence disrupts the structure of the reporter gene, splitting it into two parts and prematurely generating a stop codon, thus preventing the reporter gene from performing its reporter function. However, if exon 13 is skipped during PreRNA splicing or the gene of exon 13 is excised, a mature reporter gene mRNA can be formed, which can perform its reporter function normally.
[0039] In one embodiment, the expression vector includes a transient expression vector or a stable expression vector.
[0040] In one embodiment, the transient expression vector is pX601, pCDNA3.1, or pCMV-M1.
[0041] In one embodiment, the stable expression vector integrates the carried gene sequence into the host (cell) genome, or, in the case of an auxiliary vector or packaging virus, integrates the carried gene sequence into the host (cell) genome.
[0042] In one embodiment, the stable expression vector is a lentiviral expression vector pLenti or a Piggybac transposon vector.
[0043] The present invention also provides a reporter gene evaluation cell comprising the expression vector, wherein the evaluation cell is constructed by transiently transfecting and / or stably transfecting the expression vector into host cells.
[0044] In one embodiment, the transient transfection is to directly transfect the host cell with the expression vector; the stable transfection is to integrate the MINI-REP gene into the transposon vector or lentiviral vector and then stably integrate it into the host cell genome.
[0045] In one embodiment, the transient transfection involves directly transfecting the expression vector into the host cell while simultaneously co-transfecting the Cas9-related plasmid vector or adding AON.
[0046] In one embodiment, EGFP-negative host cells are sorted by flow cytometry to exclude cells that spontaneously skip reporter genes.
[0047] In one embodiment, the host cell is selected from at least one of cell lines, primary cells, and their differentiated or transdifferentiated cells.
[0048] In one embodiment, the cell line is a human cell line, and the primary cells are human primary cells.
[0049] In one embodiment, the host cell is 293T, N2A, WERI, human retinal cells, or human inner ear cells.
[0050] In one embodiment, the host cell is a 293T cell.
[0051] The present invention also provides an animal model including the reporter gene assessment cells.
[0052] The present invention also provides the application of the MINI-REP gene, the expression vector, the reporter gene evaluation cells, or the animal model in evaluating the efficiency of USH2A exon 13 knockout.
[0053] In one embodiment, the USH2A exon 13 knockout is achieved by splicing skipping or gene excision.
[0054] In one embodiment, the splicing skipping is: constructing a gRNA that targets the USH2A gene PreRNA, wherein the targeting domain of the gRNA is complementary to the USH2A gene PreRNA sequence, and the gRNA causes exon 13 to be spliced skipping by binding to the USH2A gene PreRNA.
[0055] Compared with the prior art, the present invention has the following beneficial effects:
[0056] This invention provides a MINI-REP gene for evaluating the efficiency of USH2A exon 13 knockout. By optimizing the selection of intron gene fragments and introducing a break reporter gene, the evaluation process for assessing USH2A exon 13 knockout efficiency is simplified. It can be applied to the efficiency evaluation of all existing technologies used to induce USH2A exon 13 knockout, and can be used for the research and development of new technologies, effect detection, and efficient screening, enabling rapid, intuitive, efficient, and highly sensitive qualitative and quantitative analysis of USH2A exon 13 knockout efficiency. Attached Figure Description
[0057] Figure 1 EGFP left -Exon13 c.2802T>G -EGFP right EGFP left -Exon13 c.2299delG -EGFP rightSchematic diagram of gene structure;
[0058] Figure 2 A transient MINI-REP gene reporter vector map (pCMV-EGFP) left -Exon13-EGFP right );
[0059] Figure 3 pLenti-CMVie-IRES-BlastR spectrum;
[0060] Figure 4 pLenti-CMV-EGFP left -Exon13 c.2802T G-EGFP right -BSD vector map;
[0061] Figure 5 pLenti-CMV-EGFP left -Exon13 c.2299delG -EGFP right -BSD vector map;
[0062] Figure 6 The figure shows the results of fluorescence microscopy detection of the effects of different mutations on spontaneous splicing skipping of exon 13.
[0063] Figure 7 The figure shows the results of flow cytometry analysis of the effects of different mutations on spontaneous splicing skipping of exon 13.
[0064] Figure 8 The MINIGENE-V1 map constructed in Example 5;
[0065] Figure 9 The MINIGENE-V2 map constructed in Example 5;
[0066] Figure 10 The MINIGENE-V3 map constructed in Example 5;
[0067] Figure 11 The MINIGENE-V4 map constructed in Example 5;
[0068] Figure 12 This figure shows the results of evaluating the effects of different mutations, different host cells, and different intron fragments on exon 13 spontaneous splicing skipping and transfection efficiency in the MINIGENE system.
[0069] Lane 1: USH2A Minigene V1 transfected with 293T; Lane 2: USH2A Minigene V2 transfected with 293T, no obvious exon skipping was detected (wild-type USH2A-13 exon); Lane 3: USH2A Minigene V3 transfected with 293T, a small number of exon skipping was detected (including c.2299delG mutation); Lane 4: USH2A Minigene V4 transfected with 293T, no obvious exon skipping was detected (including c.2802T>G mutation); Lane 5: pCMV-EGFP transfected with 293T; Lane 6: USH2A Minigene V1 transfected with N2A; Lane 7: USH2A Minigene V2 transfected with N2A, no obvious exon skipping was detected; Lane 8: USH2A Minigene V1 transfected with 293T. Lane 9: N2A transfected with USH2AMinigene V4, no obvious exon skipping was detected (including c.2299delG mutation); Lane 10: N2A transfected with pCMV-EGFP; Lane M: GL DNAMarker 10000;
[0070] Figure 13 This is a diagram showing the DNA sequencing results of the electrophoretic bands in lane 9 of Example 5;
[0071] Figure 14 Fluorescence microscopy image for evaluating the efficiency of AON-induced exon 13 splicing skipping at different doses in the MINI-REP gene cell system;
[0072] Figure 15 Figure showing the results of fluorescence microscopy observation of the effect of dual-target Cas9 technology and AON technology on the induced USH2A exon 13 knockout in the MINI-REP cell system;
[0073] Figure 16 The figure shows the results of USH2A exon 13 splicing efficiency (EGFP positivity rate) induced by dCasRx guided by different gRNAs. Detailed Implementation
[0074] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.
[0075] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0076] definition:
[0077] The reporter gene described in this invention refers to a class of genes that are expressed in cells, tissues / organs or individuals under specific conditions, causing them to produce traits that are easy to detect and would not normally be produced by the experimental material.
[0078] Source of materials:
[0079] pX601 (Addgene, catalog number: #61591), pLenti CMVie-IRES-BlastR (Addgene #119863), Piggybac transposon vector (Addgene, catalog number 92078), psPAX2 (Addgene, catalog number 12260), pMD2.G (Addgene, catalog number 12259), Lipofectamine2000 (Thermo Fisher Scientific), NEB#E2621 High-fidelity DNA assembly premix, GL DNAMarker 10000 (Accurate Biology, catalog number: #AG11909), SteadyPure Agarose Gel DNA Purification Kit (Accurate Biology, catalog number: #AG21005), BpiI (THERMO FISHER).
[0080] Unless otherwise specified, all reagents, materials, and equipment used in this embodiment are commercially available; unless otherwise specified, all experimental methods are conventional experimental methods in this field.
[0081] Example 1
[0082] Design and synthesize the MINIGENE gene of exon 13 and the MINI-REP gene in combination with the break reporter gene.
[0083] 1. Design and synthesize a minigen for exon 13.
[0084] EXON13 mutThis refers to a MINIGENE containing the pathogenic mutation of USH2A exon 13 and its upstream and downstream intron sequences. "Mut" indicates mutation, and a MINIGENE is a gene containing USH2A intron 12-exon 13-intron 13. In this embodiment, the pathogenic mutation of USH2A exon 13 is c.2802T>G or c.2299delG, resulting in MINI-REP genes of EGFP. left -Exon13 c.2802T>G -EGFP right EGFP left -Exon13 c.2299delG -EGFP right .
[0085] EXON13 mut The downstream intron sequences were selected as follows: the intron 12 gene fragment was formed by tandemly connecting a 5' end fragment of 50-200 bp and a 3' end fragment of 200-1700 bp in length in 5'-3' order; and the intron 13 gene fragment was formed by tandemly connecting a 5' end fragment of 200-1700 bp and a 3' end fragment of 50-200 bp in length in 5'-3' order. In this embodiment, the intron 12 gene fragment is selected with a 5' end length of 204 bp tandem with a 3' end length of 490 bp, and the intron 13 gene fragment is selected with a 5' end length of 703 bp tandem with a 3' end length of 216 bp. Additionally, this embodiment also selects the intron 12 gene fragment with a 5' end length of 192 bp tandem with a 3' end length of 1611 bp, and the intron 13 gene fragment with a 5' end length of 1599 bp tandem with a 3' end length of 216 bp. Figure 1 As shown.
[0086] Choosing sequence fragments of the above length, ligating the 5' and 3' ends of introns not only avoids creating new splice donors or acceptors or other splice-related sites, but also elongates the sequence, providing more target sites for different "USH2A exon 13 knockout" techniques, and the transfection efficiency is not reduced compared to shorter MINIGENE vectors.
[0087] 2. The MINI-REP gene, a combination of synthetic and fragmented reporter genes.
[0088] After designing and synthesizing the minigene of exon 13, it was inserted into the reporter gene (RG), causing the reporter gene to split into fragmented reporter genes RG. left and RG rightRG left This refers to the first half of the 5' end of a reporter gene that does not have a reporting function, RG. right This refers to the latter half of the 3' end of a reporter gene that lacks reporter function; RG left and RG right Tandem expression allows the reporter gene to function normally and fully. In this embodiment, the reporter gene is the green fluorescent gene EGFP, therefore the MINI-REP gene structure is EGFP. left -Exon13 mut -EGFP right .
[0089] Example 2
[0090] Construct the MINI-REP gene reporter vector.
[0091] The MINI-REP gene sequence designed in Example 1 was obtained by whole-gene synthesis. At the same time, corresponding restriction sites were set at both ends of the synthesized gene sequence, and it was integrated into the expression vector by restriction ligation to construct the MINI-REP gene reporter vector. The vector can be a transient expression vector or a stable expression vector.
[0092] 1. Design and construction of transient MINI-REP gene reporter vector.
[0093] The synthesized gene and pX601 were digested using restriction endonucleases AgeI and EcoRI. Following digestion, the linearized fragment was recovered by electrophoresis and gel extraction. The digested plasmid and the synthesized gene containing sticky ends were then added sequentially according to the T4 ligation system, along with the DNALigation Kit Ver.2.1. The mixture was incubated in a PCR instrument at 16°C for 1 hour to allow the synthesized gene sequence to ligate with the linearized vector backbone. The resulting T4 ligation product was pCMV-EGFP. left -Exon13-EGFP right The vector (where EXON13 is exon 13 of the mutated USH2A) has the following structure: Figure 2 As shown. In this embodiment, it is pCMV-EGFP. left -Exon13 c.2802T>G -EGFP right Vector and pCMV-EGFP left -Exon13 c.2299delG -EGFP right Carrier.
[0094] 2. Design and construction of a stable MINI-REP gene reporter vector.
[0095] The gene synthesis and lentiviral expression vector pLentiCMVie-IRES-BlastR were cleaved using restriction endonucleases XhoI and NheI, with the structure shown below. Figure 3 As shown. After enzyme digestion, electrophoresis and gel extraction were performed. Therefore, the digested plasmid and the synthesized gene containing sticky ends were added sequentially according to the T4 ligation system, along with the DNA Ligation Kit Ver. 2.1. The mixture was incubated in a PCR instrument at 16°C for 1 hour to allow the synthesized gene sequence to ligate with the linearized vector backbone. The resulting T4 ligation product was Plenti-CMV-EGFP. left -Exon13-EGFP right -BSD vector (where EXON13 is exon 13 of the mutated USH2A). In this example, it is Plenti-CMV-EGFP. left -Exon13 c.2802T>G -EGFP right -BSD vector and Plenti-CMV-EGFP left -Exon13 c.2299delG -EGFP right -BSD carrier, structure as follows Figure 4 and Figure 5 As shown.
[0096] 3. Plasmid vector transformation.
[0097] Inside a clean bench, all the T4-ligated reaction products obtained above were rapidly added to one tube (50 μL) of *E. coli* Stbl3 competent cells, and then incubated on ice for 30 minutes. The incubated competent cells were then heat-shocked in a 42°C water bath for 90 seconds, and then returned to ice for 2 minutes. Next, inside the clean bench, 400 μL of antibiotic-free LB medium was added to the bacterial culture, and the culture was placed in a bacterial shaker at 37°C and 200 rpm for 45 minutes for recovery. During recovery, an LB agar plate containing an appropriate amount of ampicillin was placed in a biochemical incubator to dry. The bacterial culture was centrifuged at 12,000 rpm for 1 minute at room temperature, and most of the supernatant was removed, resuspending the pellet in approximately 50 μL. A drop of the bacterial culture was placed on the edge of an LB agar plate containing ampicillin, and streaked using a pipette tip. The plate was then inverted and placed in a biochemical incubator for further incubation for 16-18 hours.
[0098] 4. Identification of positive clones.
[0099] In a clean bench, using 1-10 μl pipette tips, pick up 7 single colonies and add them to 50 μl of LB medium containing ampicillin. Mix the bacterial cells with the LB medium by pipetting several times. Add 2 μl of the bacterial culture to the colony PCR reaction solution (as shown in the table below), mix thoroughly, and then briefly centrifuge to collect the liquid at the bottom of the tube. Perform the PCR reaction. Continue culturing the remaining bacterial culture in a biochemical incubator. pCMV-EGFP left -Exon13-EGFP right Forward primer sequence (EGFP-F): ACCACTACCTGAGCACCCAG (SEQ ID NO:1), reverse primer sequence (f1ori-R): GCTGGCAAGTGTAGCGGTCA (SEQ ID NO:2). Lentiviral vector, forward primer sequence: (EGFP-F): ACCACTACCTGAGCACCCAG (SEQ ID NO:3), reverse primer sequence: (BSD-R): GCCAGCACCACGAGTTCTG (SEQ ID NO:4).
[0100] Table 1 PCR amplification reaction system
[0101] Total reaction volume 30μl 2X Accurate Taq Master Mix 15μl forward primer 0.6μl reverse primer 0.6μl bacterial solution 1μl Deionized water 12.8μl
[0102] PCR amplification products were subjected to agarose gel electrophoresis. Clones with correctly sized, single, and normally bright bands were selected as positive clones. 10 μl of bacterial culture was sent for Sanger sequencing. The remaining bacterial culture was used for plasmid extraction, following the instructions of the Accurate plasmid extraction kit. Elution was performed with 50 μl of Elution Buffer. The concentration was determined using the Qubit dsDNA BR Assay Kit according to the Qubit4 Fluorometer procedure. One positive clone from each plasmid was selected, and 5-10 μl was used for Sanger sequencing. Plasmids that correctly aligned during sequencing were selected.
[0103] The purpose of this vector is to insert a human USH2A EXON13mut sequence containing a pathogenic mutation such as c.2802T>G into the middle of a reporter gene such as EGFP. This disrupts the structure of the reporter gene, such as EGFP, splitting it into two parts and prematurely generating a stop codon, so that the reporter gene no longer produces reporter functions such as emitting fluorescence. However, if exon 13 is skipped during PreRNA splicing or the gene of exon 13 is excised, a mature reporter gene mRNA can be formed, which can perform the reporter function normally, such as emitting fluorescence.
[0104] Based on the conservation of splice donor (SD) and splice acceptor (SA) site efficiency in human pre-mRNA, two consecutive G bases within the reporter gene are selected as candidate break sites, such as the region in the middle of the reporter gene. In this example, the reporter gene used is EGFP, so the break site in the middle of the EGFP gene is AG-GT.
[0105] The EGFP-LEFT sequence is shown in SEQ ID NO:5, and the EGFP-RIGHT sequence is shown in SEQ ID NO:6.
[0106] Example 3
[0107] Construction of a reporter gene cell evaluation system based on MINI-REP gene reporter vector transfection into host cells.
[0108] The reporter gene cells are divided into stable transfected cells and transient transfected cells.
[0109] 1. Construction of transiently transfected cells.
[0110] Transient transfection was achieved by directly transfecting host cells using the MINI-REP gene vector. 293T cells were transfected according to the Life Tech Lipofectamine 2000 reagent protocol. One day prior to transfection, healthy 293T cells were... 5 Seeds were placed into 24-well plates. On the day of transfection, 100 ng of the corresponding volume of MINI-REP gene plasmid was added to 50 μl of OPTI-MEM, and 1 μl of Lipofactamine 2000 was added to 50 μl of OPTI-MEM medium. After mixing, the mixture was incubated at room temperature for 5 mins. Then, the diluted plasmid DNA was mixed with Lipofactamine 2000 and incubated at room temperature for 15 mins. Next, 100 μl of the plasmid DNA complex was added to each well of the 24-well plate, and the plate was gently shaken to mix. The plates were incubated at 37°C for 24 hours. 24 hours after transfection, the cells were observed under a fluorescence microscope (green fluorescence) or the proportion of EGFP-positive cells was analyzed by flow cytometry.
[0111] 2. Construction of stable transfected cells.
[0112] To construct stable transfected cells, the MINI-REP gene is integrated into a Piggybac transposon vector or a lentiviral vector such as pLentiCMVie-IRES-BlastR. Transfection is then performed in host cells using standard transposon or lentiviral transfection techniques. For transfection via a transposon system, the target gene transposon vector and the Piggybac transposase expression vector are co-transfected into host cells. For infection via a lentiviral vector, the lentiviral vector integrating the target gene, along with the helper vectors psPAX2 and pMD2.G, are first added to 293T cells to package the virus. The supernatant is then recovered and concentrated to obtain the virus expressing the MINI-REP gene; in this example, it is Plenti-CMV-EGFP. left -Exon13 c.2802T>G -EGFP right -BSD virus and Plenti-CMV-EGFP left- Exon13 c.2299delG -EGFP right -BSD virus. The virus is added to host cells for infection. Afterwards, the host cells are cultured in a different medium for 48 hours. Then, an antibiotic corresponding to the resistance gene carried in the stable MINI-REP gene reporter vector is added; in this example, it is blastidin (ice blast fungicide) at a final concentration of 20 μg / ml. Cell selection is performed, and the surviving cells are considered stably transfected cells with the MINI-REP gene, such as EGFP. left -Exon13 c.2802T>G -EGFP right Stable expression cells and pWPXLd-EGFP left -Exon13 c.2299delG -EGFP right Stable expression cells.
[0113] Stable transfected cells of the MINI-REP gene can be expanded and preserved. The optimal time for in vitro use of stable transfected cells is within two months after sorting to prevent the cells' own degradation mechanisms of abnormal genes / proteins from masking reporter gene expression. After two months, it is recommended to use cryopreserved cells for preservation, or re-transfect and sort to obtain new stable transfected cells of the MINI-REP gene. Select MINI-REP stable transfected cells in good condition and in the growth exponential phase, and treat them with the relevant drugs or reagents to be evaluated. Subsequently, the proportion of reporter gene expression such as EGFP can be observed by fluorescence microscopy or detected by flow cytometry. In this example, flow cytometry is used to detect and evaluate the effects of relevant drugs / formulations that induce USH2A exon 13 knockout (splicing skipping / excision).
[0114] The selection of host cells should be based on a comprehensive consideration of factors such as high transfection efficiency and splicing patterns that mimic cells derived from the human eye or ear. In this embodiment, the host cells are 293T cells (human embryonic kidney cell line) and N2A cells (mouse-derived neuroblastoma cells).
[0115] Example 4
[0116] The effects of different mutations on exon 13 splicing were assessed using MINI-REP cells.
[0117] To evaluate the effects of different mutations on the splicing of USH2A exon 13, MINI-REP genes containing different mutations were synthesized, and corresponding MINI-REP gene reporter vectors were constructed. Flow cytometry was used to analyze the splicing skipping of exon 13 containing different mutations in the MINI-REP gene system of this invention.
[0118] In this embodiment, the mutations in exon 13 of the MINI-REP gene are c.2802T>G and c.2299delG, respectively. The 5' end of intron 12 is selected as 192 bp tandemly with the 3' end as 1611 bp, and the 5' end of intron 13 is selected as 1599 bp tandemly with the 3' end as 216 bp. The corresponding MINI-REP gene vector pCMV-EGFP is then constructed. left -Exon13 c.2802T>G -EGFP right pCMV-EGFP left -Exon13 c.2299delG -EGFP right Following the transient transfection method in Example 3, two MINI-REP gene vectors were transfected into host cells using the transfection reagent Lipofectamine 2000. In this example, 293T cells were used as the host cells. A MINI-REP gene vector without the mutation was used as a negative control, and a MINI-REP gene vector without exon 13 was used as a positive control. Twenty-four hours after transfection, the number of cells emitting EGFP green fluorescence in each group was observed using a fluorescence microscope. The results are as follows: Figure 6 As shown in the table below, the proportion of EGFP-positive cells in different mutant experimental groups was detected by flow cytometry. Specifically, the proportions of spontaneous splicing skipping (EGFP-positive) cells in the c.2802T>G and c.2299delG mutant experimental groups, detected by flow cytometry, were 9.4% and 41.7%, respectively. Figure 7 As shown.
[0119] The results showed that both c.2802T>G and c.2299delG induced spontaneous splicing skipping in exon 13, with c.2299delG exhibiting significantly higher spontaneous splicing skipping than c.2802T>G. Therefore, when evaluating treatments that induce splicing skipping, the presence of the c.2299delG mutation may result in false positives or a mismatch between the actual efficacy and the observed efficacy, potentially affecting the accuracy of subsequent testing of the effects of drugs that induce USH2A exon 13 knockout.
[0120] Table 1. Proportion of EGFP-positive cells in different mutant experimental groups as determined by flow cytometry.
[0121] experimental group EGFP positivity rate (%) <![CDATA[pCMV-EGFP left -Exon13 WT -EGFP right ]]> 7.6 <![CDATA[pCMV-EGFP left -Exon13 c.2802T>G -EGFP right ]]> 9.4 <![CDATA[pCMV-EGFP left -Exon13 c.2299delG -EGFP right ]]> 41.7 <![CDATA[pCMV-EGFP left -EGFP right ]]> 89.6
[0122] Example 5
[0123] The effects of different mutations on exon 13 splicing were verified based on different cells expressing the MINIGENE gene.
[0124] This embodiment sets up a MINIGENE cell experiment to examine the impact of different mutations on exon 13 splicing in MINI-REP gene-based cell assessments. This embodiment constructs four MINIGENEs, as follows:
[0125] MINIGENE-V1: mExon11-mExon12-mExon13 (m represents mouse, h represents human), the gene structure is mouse USH2A exon 11, mouse intron 11 5' end 204bp, mouse intron 11 3' end 490bp, mouse exon 12, mouse intron 12 5' end 703bp, mouse intron 12 3' end 216bp, mouse exon 13, tandemly arranged in 5' to 3' order, as shown below. Figure 8 As shown.
[0126] MINIGENE-V2: mExon11-hExon13-mExon13, the vector structure is as follows: mouse exon 11, 192 bp from the 5' end of mouse intron 11, 1611 bp from the 3' end of human intron 12, human exon 13, 1599 bp from the 5' end of human intron 13, 216 bp from the 3' end of mouse intron 12, and mouse exon 13, tandemly arranged in the order from 5' to 3'. Figure 9 As shown.
[0127] MINIGENE-V3: mExon11-hExon13(c.2299delG)-mExon13, with the same vector structure as MINIGENE-V2, except that the c.2299delG mutation is introduced in human exon 13. Figure 10As shown.
[0128] MINIGENE-V4: mExon11-hExon13(c.2802T>G)-mExon13, with the same vector structure as MINIGENE-V2, except that the human exon 13 introduces the c.2802T>G mutation, as shown below. Figure 11 As shown.
[0129] The MINIGENE-V(1-4) gene sequence was obtained through whole-gene synthesis. A linearized vector was obtained by digesting pX601 with AgeI and EcoRI. The synthesized fragment was amplified by PCR, with a 20bp homologous sequence added to the 5' end of the linearized pX601 primer. Both fragments were recovered, and the products were recombined using a DNA assembly premix. The resulting product was then transferred to ice, transformed into competent cells, plated, and single-clone selected for verification. The synthesized MINIGENE-V1-4 gene sequence was seamlessly inserted into the pCMV-EGFP vector, resulting in the pCMV-EGFP-MINIGENE-V(1-4) vector. This vector enables simultaneous transcriptional expression of EGFP and MINIGENE under the drive of the CMV promoter.
[0130] MINIGENE-V1 / V2 / V3 / V4 vectors were transfected into 293T cells and N2A cells, respectively, using Lipofectamine 2000 reagent, with CMV-EGFP vector transfection as a control. Cells were harvested 24-72 hours post-transfection, and total RNA was extracted. RT-PCR was used to analyze the pre-RNA splicing of exon 13 in MINIGENE cells. The results are as follows: Figure 12 As shown.
[0131] The results showed that USH2AMINIGENE-V3 (humanized exon 13, c.2299delG) transfected into 293T cells showed obvious signs of splicing, and the exon splicing was even more obvious after transfection into N2A cells. The c.2299delG mutation did indeed lead to significant spontaneous splicing skipping of USH2A exon 13 (consistent with the results shown in Example 4), indicating that the MINI-REP gene system can indeed accurately reflect the effect of mutations on spontaneous splicing skipping of exon 13.
[0132] The spontaneous splicing skipping probability of N2A transfected cells was significantly higher than that of 293T cells. This is mainly because there may be differences in splicing-related sites or recognition sensitivity among host cells from different species. However, the spontaneous splicing skipping trend of exon 13 containing different mutations is consistent across different species of host cells (i.e., the c.2299delG mutation leads to spontaneous skipping, while the c.2802T>G mutation does not).
[0133] Considering that this invention uses the MINIGENE gene system to evaluate the knockout efficiency of human USH2A exon 13, the results of this embodiment show that the splicing system in human cells is more conducive to simulating the splicing of human USH2A exon 13. Therefore, the knockout efficiency evaluation in human cells expressing the MINIGENE gene is more accurate than that in mouse cells.
[0134] Furthermore, by comparing the transfection efficiencies of MINIGENE-V1 and V2, it was found that increasing the length of the intron fragment did not significantly affect the transfection efficiency. Therefore, without affecting the transfection efficiency, a longer intron fragment was selected, namely the intron fragments flanking human exon 13 in V2.
[0135] To confirm the RNA splicing status of USH2AMINIGENE-V4 (humanized exon 13, c.2802T>G) in host cells, a band from lane 9 was excised from an agarose gel and recovered using the SteadyPure Agarose Gel DNA Purification Kit. The recovered product was then subjected to Sanger sequencing using EGFP-F. Partial sequencing results are shown below. Figure 13 As shown, mouse USH2A exon 11 is coupled to human USH2A exon 13. RT-PCR and sequencing results after transfecting N2A cells with USH2A MINIGENE-V4 (humanized exon 13, c.2802T>G) indicate that the pre-RNA splicing of USH2A MINIGENE-V4 conforms to theoretical predictions; that is, selecting longer intron fragments not only does not affect efficiency but also does not generate new splicing-related sites (affecting normal splicing of exon 13).
[0136] Combining the results of Examples 4 and 5, both evaluated the impact of different USH2A exon 13 mutations on spontaneous splicing skipping in exons. Although both results indicated a significant spontaneous splicing skipping in c.2299delG, significantly higher than in c.2802T>G, the MINIGENE system could not accurately quantify the strength difference between the two, and even failed to detect it due to the weaker spontaneous splicing skipping in c.2802T>G. In contrast, the MINI-REP system of this invention could detect it, demonstrating that the MINI-REP system has higher sensitivity and accuracy.
[0137] Example 6
[0138] The effects of MINI-REP gene cell assessment on the efficacy of exon 13 knockout (splicing skip / removal) induced by the same technique and different doses.
[0139] In the MINI-REP gene cell system, different doses of AON were applied, and the splicing editing efficiency induced by different doses of AON was evaluated to test the sensitivity of the MINI-REP system of this invention. Human host cells were used at a ratio of 1×102 5 Seeds were placed into 24-well plates, using 293T cells in this example. pCMV-EGFP were seeded according to the instructions in Example 3 or using a strict kit, and then seeded using Lipofectamine 2000 reagent. left -Exon13 c.2802T>G -EGFP right Simultaneously with transfection of 293T cells, 10 pmol and 50 pmol of antisense oligonucleotides (AON) were added, respectively. Twenty-four hours after transfection, the number of cells emitting EGFP green fluorescence in each group was observed using a fluorescence microscope. The results are as follows: Figure 14 As shown in the table below, the proportion of spontaneous splicing skipping (EGFP-positive) cells in different mutant experimental groups was detected by flow cytometry. The results are shown in the table below. The antisense oligonucleotide AON used in this example was synthesized by GenScript, and its 5' to 3' sequence and modification are as follows: 5'-MA*MG*MC*MU*MU*MC*MG*MG*MA*MG*MA*MA*MA*MU*MU*MU*MA*MA*MA*MC-3', where "M" (uppercase) indicates 2'-O-methoxyethyl modification.
[0140] Table 1. Proportion of EGFP-positive cells in different AON groups detected by flow cytometry.
[0141] experimental group EGFP positivity rate (%) <![CDATA[10pmol AON+pCMV-EGFP left -Exon13 c.2802T>G -EGFP right ]]> 50.4 <![CDATA[50pmol AON+pCMV-EGFP left -Exon13 c.2802T>G -EGFP right ]]> 32.5
[0142] The results showed that different doses of AON induced different splicing skipping effects in 293T cells transfected with the MINI-REP gene. It was also found that higher doses (50 pmol) of AON did not induce more efficient splicing skipping. Due to the toxicity of high doses of AON, some cell death occurred.
[0143] The results of this embodiment show that in the MINI-REP gene cell system of the present invention, the splicing skipping of USH2A exon 13 can be rapidly obtained by observing with fluorescence microscopy and flow cytometry. Furthermore, flow cytometry can clearly identify the specific efficiency differences between different dosage groups, providing intuitive results with high sensitivity.
[0144] Example 7
[0145] To evaluate the efficiency of CRISPR / Cas9 technology in exon 13 excision.
[0146] This embodiment uses EGFP. left -Exon13 c.2802T>G -EGFP right In stable expression cells, the efficiency of CRISPR / Cas9 technology in cleaving exon 13 by targeting the introns flanking exon 13 (introns 12 and 13) with dual gRNAs was examined. In this embodiment, the gRNA targeting sequences for introns 12 and 13 were GAAATTAAATGATATGCCTTAG (SEQ ID NO:7) and GCATGGCCCAATTATCCTAGG (SEQ ID NO:8), respectively. The synthesized gRNAs were ligated into the PX601 vector to obtain two AAV-SaCas9-sagRNA plasmids.
[0147] First, EGFP cultured in T25 left -Exon13 c.2802T>G -EGFP right Stable expression cells (EGFP-negative cell subsets sorted by flow cytometry) were trypsinized and terminated using standard methods. After centrifugation at 300g for 5 minutes at room temperature, the supernatant was removed, and the cell pellet was resuspended in 5 ml of culture medium. 20 μl of the resuspended cell pellet was used for cell counting. Transfection experiments were performed using 1.5 μl of Lipofectamine 2000 reagent per well, with a cell count of 3 × 10⁶ cells / well. 5 / well, experimental group 1 was treated with 500 ng of two AAV-SaCas9-sagRNA plasmids (the ratio of plasmids corresponding to different gRNAs was 1:1); experimental group 2 was treated with 10 pMOL of the antisense oligonucleotide AON described in Example 6; 500 ng of pAAV-EGFP plasmid was added as a positive control; and EGFP without any treatment was used. left -Exon13 c.2802T>G -EGFP right Stable expression cells served as a blank control. The transfection mixture was thoroughly mixed with the cells and incubated at 37°C. 72 hours post-transfection, EGFP expression was observed using a fluorescence microscope (GFP exposure for 800ms). The results are as follows: Figure 15 As shown.
[0148] The results showed that in the MINI-REP stable cell system, the dual-target SaCas9 could successfully cleave USH2A exon 13, but its effect was lower than that of AON. This invention's system can not only simultaneously test the effects of different techniques on inducing USH2A exon 13 knockout, but also allows for a simple, convenient, rapid, and accurate comparison of the differences in effects between different techniques.
[0149] Example 8
[0150] Based on the MINI-REP cell system, we are developing, evaluating, and screening new technologies that can eliminate exon 13.
[0151] Using the MINI-REP gene system of this invention, it was discovered that dCas13 can also induce splicing skipping of exon 13 in USH2A. Furthermore, the MINI-REP gene system of this invention allows for rapid screening of highly efficient target sites for dCas13-induced splicing skipping. Cas13 possesses unique nuclease activity, specifically targeting and cleaving RNA. Mutations at the active site can produce dCas13 (dead Cas13) without nuclease activity but capable of specifically binding to target RNA. Existing techniques utilize dCas13 in combination with the catalytic domains of base-editing proteins such as adenosine deaminase and cytidine deaminase to correct pathogenic mutations in pre-mRNA; or, through binding to RNA, it may spatially inhibit the interaction between the spliceosome and transcript. However, it has not yet been reported whether dCas13 targeting USH2A exon 13 can induce exon 13 splicing skipping.
[0152] The dCas13 used in this embodiment is CRISPR / dCasRx, which is a modified version of PX601. The main components of the CRISPR / dCasRx vector are: AAV-2ITR sequence, U6 promoter, PregRNA, promoter (PolII), dCasRx, PolyA signal, and AAV-2ITR sequence. The PregRNA structure is RfxCas13dDR36-gRNA-RfxCas13dDR36, and dCasRx includes upstream and downstream NLS signals, as well as a downstream HA tag. For cell-level experiments, this embodiment used a combination of CMV promoter and enhancer as the promoter (Pol II), and the gRNA sequence is shown in the table below.
[0153] Table 3. List of dCas13-gRNAs and their target regions
[0154]
[0155] Based on the pretranscribed DNA sequences corresponding to the gRNA sequences in the table, corresponding Oligo DNA sense and antisense strands were synthesized. The sense strand was the reverse complementary sequence of the target sequence, with AAAC added at the 5' end, and the antisense strand was the target sequence with CTTG added at the 5' end. The Oligo DNA sense and antisense strands were mixed and annealed to form double-stranded DNA with sticky ends. This was then ligated with linearized dCasRx, digested with BpiI and recovered. Further verification was performed by transforming E. coli competent cells, selecting single clones, PCR, and sequencing to obtain the CRISPR / dCasRx plasmid vectors corresponding to different gRNAs, namely pAAV-dCasRx-gRNA.
[0156] Human host cells were seeded into 24-well plates at a specific amount, allowing the cell confluence to reach approximately 80% after 24 hours. In this example, 293T cells (human kidney epithelial cell line) were used as the human host cells. Lipofectamine 2000 was used to convert pCMV-EGFP... left -Exon13 c.2802T>G -EGFP right 293T cells were co-transfected with pAAV-dCasRx-gRNA plasmid (vector mass ratio 100 ng: 400 ng). 293T cells transfected with the reporter plasmid alone served as a negative control, and 293T cells not transfected with any plasmid served as a blank control. Transfected cells were cultured for 48 hours, then digested into single cells using trypsin. GFP positivity rates for different gRNA groups were then detected using flow cytometry. The GFP positivity rates for each experimental group are shown in the table below. Figure 16 As shown.
[0157] Table 4. List of dCas13-gRNAs, target regions, and EGFR positivity rates.
[0158]
[0159]
[0160] The results show that the MINI-REP gene system used in this embodiment can not only be widely used to test the effectiveness of existing technologies that can induce USH2A exon 13 knockout (splicing skipping / excision), such as AON or Cas9, but also to evaluate new technologies that have not yet been reported. Furthermore, even when the USH2A exon 13 splicing skipping effects induced by different gRNA-guided dCasRx are similar, the optimal site can be screened simply, quickly, and sensitively. This further illustrates the characteristics of the system of this invention: simple operation, high efficiency and speed, high sensitivity, and wide applicability.
[0161] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0162] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims. sequence list <110> Guangzhou Ruifeng Biotechnology Co., Ltd. <120> MINI-REP gene and its expression vector for evaluating the efficiency of USH2A exon 13 knockout and its applications <160> 15 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 1 accactacct gagcacccag 20 <210> 2 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 2 gctggcaagt gtagcggtca 20 <210> 3 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 3 accactacct gagcacccag 20 <210> 4 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 4 gcccagcacc acgagttctg 20 <210> 5 <211> 336 <212> DNA / RNA <213> Artificial Sequence <400> 5 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgag 336 <210> 6 <211> 384 <212> DNA / RNA <213> Artificial Sequence <400> 6 gtgaagttcg agggcgacac cctggtgaac cgcatcgagc tgaagggcat cgacttcaag 60 gaggacggca acatcctggg gcacaagctg gagtacaact acaacagcca caacgtctat 120 atcatggccg acaagcagaa gaacggcatc aaggtgaact tcaagatccg ccacaacatc 240. gaggacggca gcgtgcagct cgccgaccac taccagcaga acaccccat cggcgacggc cccgtgctgc tgcccgacaa ccctacctg agcaccctgt ccgccctgag caaagacccc aacgagaagc gcgatcacat ggtcctgctg gagttcgtga ccgccgccgg gatcactctc 360 ggcatggacg agctgtacaa gtaa <210> 7 <211> 22 <212> DNA / RNA <213> Artificial Sequence <400> 7 gathering gatatgcctt ag <210> 8 <211> 21 <212> DNA / RNA <213> Artificial Sequence <400> 8 gcatggccca attack g <210> 9 <211> 22 <212> DNA / RNA <213> Artificial Sequence <400> 9 gauagacgag acacaaacaa isn't following anyone. Autodesk_new <210> 10 <211> 22 <212> DNA / RNA <213> Artificial Sequence <400> 10 uaagcccuaa agauaaaaua ua 22 <210> 11 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 11 gcacacacag gcacuggcca cu 22 <210> 12 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 12 cagaugcacu gcccugucuu ag 22 <210> 13 <211> 25 <212> DNA / RNA <213> Artificial Sequence <400> 13 guaauacauu ucuuucuuac cuggu 25 <210> 14 <211> 25 <212> DNA / RNA <213> Artificial Sequence <400> 14 uuacacuggc agggcucaca uccaa 25 <210> 15 <211> twenty four <212> DNA / RNA <213> Artificial Sequence <400> 15 cugauuacac cuucuuccuu gacg 24
Claims
1. A MINI-REP gene for evaluating the efficiency of USH2A exon 13 knockout, characterized in that, The system includes a reporter gene and a small gene. The reporter gene is a gene that performs a reporter function, and the small gene comprises a USH2A intron 12, exon 13, and intron 13 connected in sequence. The small gene is inserted into the reporter gene, splitting the reporter gene into fragmented reporter genes. The fragmented reporter genes do not perform a reporter function when expressed alone, but they do perform a reporter function when expressed in tandem. Exon 13 is a human exon 13. The small gene is inserted between two consecutive G bases within the reporter gene. The gene of intron 12 is obtained by tandemly connecting a gene fragment of 192-204 bp at the 5' end and a gene fragment of 490-1611 bp at the 3' end in a 5'-3' sequence; the gene of intron 13 is obtained by tandemly connecting a gene fragment of 703-1599 bp at the 5' end and a gene fragment of 216 bp at the 3' end in a 5'-3' sequence.
2. The MINI-REP gene according to claim 1, characterized in that, The gene of intron 12 includes the following regions and sequences with ≥90% similarity: the splice silencer ISS of intron 12, the splice branching site BP of exon 13, the splice acceptor SA of exon 13, the splice donor SD of exon 13, or the splice enhancer ESE of exon 13. The gene of intron 13 includes the following regions and sequences with ≥90% similarity: the splice enhancer ISE of intron 13 or the polypyrimidine bundle of intron 13.
3. The MINI-REP gene according to claim 1, characterized in that, The reporter gene is selected from either a fluorescent protein gene or an enzyme-labeled gene.
4. The MINI-REP gene according to claim 3, characterized in that, The reporter gene is the green fluorescent gene EGFP.
5. The MINI-REP gene according to claim 4, characterized in that, The small gene was inserted between the two G bases of the green fluorescent gene EGFP sequence AGGT.
6. The MINI-REP gene according to claim 1, characterized in that, The gene in exon 13 includes at least one of the following pathogenic mutations: c.2802T>G (p.Cys934Trp), c.2299delG (p.E767SfsX21), c.2276G>T (p.C759F), c.2522C>A (p.S841Y), c.2242C>T (p.Gln748X), c.2541C>A (C847X), c.2761delC (Leu921f s) and c.2776C>T (p.R926C), c.2209C>T, c.2310delA, c.2391_2392deITG, c.2431A>T, c.2431_2432de lAA, c.2440C>T, c.2525dup, c.2610C>A, c.2755C>T, c.2176T>C, c.2236C>G, c.2296T>C and c.2332G>T.
7. The MINI-REP gene according to claim 6, characterized in that, The pathogenic mutations in exon 13 include c.2802T>G or c.2299delG.
8. The MINI-REP gene according to claim 7, characterized in that, The pathogenic mutation in exon 13 is c.2802T>G.
9. An expression vector for expressing the MINI-REP gene according to any one of claims 1-8.
10. A reporter gene evaluation cell comprising the expression vector of claim 9, characterized in that, The evaluation cells were constructed by transiently transfecting and / or stably transfecting host cells with the expression vector.
11. The reporter gene assessment cell according to claim 10, characterized in that, The transient transfection is the direct transfection of the expression vector into the host cell; the stable transfection is the stable integration of the MINI-REP gene into the host cell genome after integration into a transposon vector or lentiviral vector.
12. The reporter gene assessment cell according to claim 10, characterized in that, The host cell is selected from at least one of the following: cell lines, primary cells, and their differentiated or transdifferentiated cells.
13. The reporter gene assessment cell according to claim 12, characterized in that, The cell line is a human cell line, and the primary cells are human primary cells.
14. The reporter gene assessment cell according to claim 13, characterized in that, The host cells are 293T, N2A, WERI, human retinal cells, or human inner ear cells.
15. The use of the MINI-REP gene of any one of claims 1-8, the expression vector of claim 9, the reporter gene evaluation cell of any one of claims 10-14, and an animal model including the reporter gene evaluation cell of any one of claims 10-14 in evaluating the efficiency of USH2A exon 13 knockout.
Citation Information
Patent Citations
Method for treating Usher syndrome and composition thereof
CN113122577A
CRISPR / Cas9-Mediated Exon-Skipping Approach for USH2A-Associated Usher Syndrome
US20210115419A1