Rice cytoplasmic male sterility restorer gene RFFA and application thereof
By cloning and applying the novel cytoplasmic male sterility restorer gene RFFA in rice, the problems of unstable fertility and limited restorer line resources in rice breeding have been solved. This has improved the stability of rice breeding and the purity of seeds, expanded the resources of restorer lines, and ensured food security.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-08-09
- Publication Date
- 2026-03-24
AI Technical Summary
In existing rice breeding, the fertility of wild-type cytoplasmic male sterile lines is not stable enough. They are prone to self-pollination and seed setting in hot weather, resulting in unqualified seed purity. Furthermore, the limited resources of restorer lines restrict the full utilization of heterosis.
The novel cytoplasmic male sterility restorer gene RFFA in rice was cloned and applied. It was then introduced into rice varieties using gene editing technology to produce transgenic restorer lines, which were then hybridized with sterile lines to form hybrid seeds with normal fertility.
This has broadened the sources of restorer lines, improved the stability and seed purity of rice breeding, expanded the resources of maintainer lines, made full use of hybrid vigor, and ensured food security.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This application relates to the field of plant genetic engineering technology, specifically to the cloning, isolation, functional verification of a rice cytoplasmic male sterility restoration gene RFFA and its application in rice improvement. Background Technology
[0002] Male sterility is a biological phenomenon in plants where, due to environmental conditions or genetic mutations, the male reproductive system degenerates, preventing pollen production or producing pollen with impaired function, while the female reproductive system develops normally. Crop varieties or lines exhibiting this genetic trait are called sterile lines. Hybrids produced by crossing some crop varieties (lines) with sterile lines can restore normal fertility; these are called restorer lines. Sterile lines and restorer lines have significant practical value in utilizing heterosis and hybridization breeding in crops.
[0003] Currently, research on male sterility and its fertility restoration has been reported in various crops such as wheat, maize, rapeseed, and rice (Oryza sativa), and it has been widely used in hybrid seed production. Male sterility includes nuclear sterility controlled by nuclear genes and cytoplasmic male sterility (CMS) controlled by cytoplasmic genes. In rice, the main nuclear male sterility genes are pms3 and tms5, whose fertility is affected by light and temperature. Based on this, the two-line breeding method for rice was proposed. The two-line breeding method flexibly utilizes the fertility conversion characteristics of nuclear male sterile lines and has many advantages such as simple sterility inheritance behavior and a wide range of restoration sources. However, the fertility of nuclear male sterile lines in two lines is easily affected by fluctuations in light and temperature conditions, causing many difficulties for the propagation of sterile lines and the production of hybrid seeds. The genetic basis of three-line hybrid breeding is the cytoplasmic male sterile line and its maintainer and restorer lines. Among them, the protein encoded by specific genes in the mitochondrial genome of the sterile line can lead to male sterility. The maintainer line has normal cytoplasm, its nuclear genome is identical to that of the sterile line, its pollen is normally fertile, and it can self-pollinate. Crossing the maintainer line with the sterile line produces sterile seeds, allowing the sterile line to reproduce. The restorer line carries genes for restoration in its nuclear genome, its pollen is normally fertile, and it can self-pollinate. Crossing the restorer line with the sterile line produces hybrid F1 seeds, which are normally fertile. Three-line hybridization breeding is an important manifestation and guarantee for fully utilizing heterosis and ensuring food production security.
[0004] Cytoplasmic male sterility in rice mainly includes types such as "Yebai," "Baotai," and "Honglian." Hybrid rice in my country primarily utilizes the "Yebai" type of sterility. The Yebai-type male-sterile line (CMS-WA) is an indica-type cytoplasmic male-sterile line and is the earliest type used in China's three-line hybrid rice, with the most hybrid combinations developed. It is currently the most important type of rice male-sterile line used in Chinese production. In recent years, the combinations developed and the planting area of other cytoplasmic male-sterile types such as Yinshui, Gang, D, and Aibai have shown an increasing trend, and they also have similar restoration relationships with the Yebai-type male-sterile line. The Yebai-type male-sterile line is sporophytic sterile. Studies suggest that the cytoplasmic male sterility and restoration in the Yebai type are influenced by two pairs of major genes, and may also be affected by minor genes. Most studies report that the inheritance of the restoration gene in the Yebai-type male sterility is controlled by two pairs of genes, which are independently inherited but also have certain interaction effects. Yao et al. (1997) conducted a genetic study on fertility restoration using the wild-type Zhenshan 97A and Minghui 63 lines, and concluded that the wild-type restorer line Minghui 63 possesses two pairs of dominant restorer genes. Subsequently, Rf4 was located and cloned using genetic populations constructed with IR24 and Minghui 63, and sequence analysis revealed that it encodes a protein with a PPR (pentatricopeptide repeat protein) structure (Tang et al. 2014; Kazama et al. 2014).
[0005] The cytoplasmic male sterility line CMS-HL (Chonglian type) of rice originated from wild rice (Cynodon dactylon) and is an indica-type cytoplasmic male sterility line. However, the Honglian type and the wild-aborted type differ significantly in their restoration-protection relationship, genetic characteristics, and cytological features of pollen abortion. The Honglian type is a typical gametophyte sterility type. Regarding the localization of the restoration gene in the Honglian type, Huang Qingyang et al. (1999) used SSR markers to locate the restoration gene Rf-5 of male sterility in the Honglian type on chromosome 10, with a genetic distance of 7.8 cM from RM258. Huang et al. (2012) constructed F2 and BC1F1 populations using the YueTai A and 9311 methods, mapping the two restorer genes for cytoplasmic male sterility in the *Rhizophora stylosa* type, Rf5 and Rf6, to the regions between markers RM6469 and RM25661 on rice chromosome 10 and between markers RM3710 and RM22242 on rice chromosome 8, respectively. Their research revealed that 50% of pollen grains in F1 plants carrying only one restorer gene, Rf5 or Rf6, were fertile, while 75% of pollen grains in hybrids carrying both Rf5 and Rf6 were normally fertile. Under adverse conditions, F1 plants carrying two non-allelic restorer genes had a higher seed setting rate than F1 plants carrying only one restorer gene (Huang et al., 2012). Hu et al. cloned the cytoplasmic male sterility restoration gene Rf5 in 2012 (Hu et al., 2012), while Huang et al. cloned another cytoplasmic male sterility restoration gene Rf6 in 2015 (Huang et al., 2015) and studied their regulatory mechanisms.
[0006] Currently, the most widely used male-sterile lines in japonica rice production are mainly cytoplasmic male-sterile lines (CMS-BT), which belong to the gametophyte sterility type. Japanese scholar Shinjyo (1975) conducted a relatively detailed study on the breeding and genetics of the cytoplasmic male-sterile line, suggesting that the restoration of male sterility in cytoplasmic male-sterile lines is controlled by a pair of dominant genes. In 1996, Akagi et al., using two near-isogenic lines, detected the linkage between the co-dominant marker OSRRf and the restoration gene Rf-1 using ISSR molecular markers. This marker is located on chromosome 10, with a genetic distance of 3.7 ± 1.1 cM from Rf-1. Komori et al. (2003) selected nine known RFLP markers linked to Rf-1 on chromosome 10 and used a segregating population of 1024 individuals to finely map the cytoplasmic male sterility restorer gene. The results showed that Rf-1 was finely mapped to the S12564Tsp509I and C1361MwoI regions. Subsequently, Komori et al. cloned the cytoplasmic male sterility restorer gene Rf-1 using map-based cloning (Komori et al., 2004). In 2006, Liu Yaoguang's research group at South China Agricultural University discovered that the Rf-1 site contains two restorer genes, Rfla and Rflb, and studied the mechanism of cytoplasmic male sterility and fertility restoration function in rice CMS-BT (Wang et al., 2006).
[0007] Although my country has made great progress in hybrid rice breeding, some problems still need to be solved. One of the main reasons is that the sterile cytoplasm currently used in production is mainly wild-type cytoplasm, and the restoration of fertility requires the simultaneous presence of Rf3 and Rf4 genes to meet production requirements. This makes the breeding of new restorer lines quite difficult. On the other hand, the fertility of wild-type cytoplasmic male sterile lines is not stable enough. They can self-pollinate in hot weather, resulting in false hybrids during seed production and substandard seed purity (Xi Jianmin et al., 2011; Ge Xiaoping et al., 2012). Many excellent rice germplasm resources cannot be used as wild-type maintainer lines, resulting in a narrow genetic base between parents and greatly limiting the potential for yield improvement. In their research on the genetic expression of male sterility in rice under a heterologous cytoplasmic background, Wang Naiyuan et al. discovered a novel type of male-sterile cytoplasm in common wild rice, named CMS-FA type cytoplasm, and bred a series of new cytoplasmic male-sterile lines, broadening the breeding pathways for high-quality hybrid rice (Wang Naiyuan, 2006a). Based on this research, they bred a new cytoplasmic male-sterile restorer line, realizing the matching and utilization of the new cytoplasmic source three-line system (Wang Naiyuan, 2006b). The male-sterile lines bred using the novel male-sterile cytoplasmic source have a wide range of maintainer line sources, not only expanding the maintainer line sources to various fields such as mid-season rice, late-season rice, and high-quality rice, but also breaking the genetic limitations of the early indica rice system in the Yangtze River basin, greatly improving the breeding potential of male-sterile lines (Wang Naiyuan et al., 2008a). Unlike maintainer lines, the resources of novel male-sterile restorer lines in conventional varieties are limited. Current research shows that this restorer gene is controlled by a pair of dominant genes (Wang Naiyuan et al., 2008b). Based on this consideration, by cloning the restorer gene that can restore new source male sterility lines (CMS-FA) and combining it with molecular breeding tools, the restorer gene can be quickly and effectively transferred to superior breeding resources, thereby greatly expanding the sources of restorer lines, making full use of hybrid vigor, and helping to ensure my country's food security. Summary of the Invention
[0008] The purpose of this application is to isolate and clone a fertility restoration gene RFFA for cytoplasmic male sterility from rice. The aim is to improve the fertility restoration ability of rice in hybridization with sterile lines through the research and application of the fertility restoration gene RFFA, and to provide new genetic resources for rice genetic breeding.
[0009] This application utilizes map-based cloning to isolate and clone a gene, RFFA, that controls the restoration of fertility in a novel progenitor cytoplasmic male sterility type in rice, providing a new genetic resource for three-line breeding of rice. Specifically, this application relates to the following technical solutions.
[0010] In a first aspect, this application provides a rice cytoplasmic male sterility restoration gene RFFA, which contains the nucleotide sequence shown in SEQ ID NO: 1.
[0011] In a second aspect, this application provides a protein encoded by the rice cytoplasmic male sterility restorer gene RFFA, said protein comprising or consisting of the amino acid sequence shown in SEQ ID NO: 4.
[0012] In a third aspect, this application provides a nucleic acid that encodes the protein described in the second aspect.
[0013] In a fourth aspect, this application provides an expression vector comprising the rice cytoplasmic male sterility restoration gene RFFA as described in the first aspect or the nucleic acid as described in the third aspect.
[0014] In a fifth aspect, this application provides a method for creating rice restorer lines, comprising introducing the rice cytoplasmic male sterility restorer gene RFFA as described in the first aspect, or the nucleic acid as described in the third aspect, or the expression vector as described in the fourth aspect into a rice variety.
[0015] In a sixth aspect, this application provides a method for restoring fertility to a cytoplasmic male-sterile rice line, comprising:
[0016] Introducing the rice cytoplasmic male sterility restorer gene RFFA as described in the first aspect, or the nucleic acid as described in the third aspect, or the expression vector as described in the fourth aspect into rice varieties to produce transgenic restorer lines; and
[0017] The transgenic restorer line is crossed with the rice cytoplasmic male sterile line to produce hybrid seeds with normal fertility.
[0018] In a seventh aspect, this application provides the use of the rice cytoplasmic male sterility restorer gene RFFA as described in the first aspect or the nucleic acid as described in the third aspect in rice breeding or the creation of rice restorer lines or the restoration of fertility in rice cytoplasmic male sterile lines. Attached Figure Description
[0019] Figure 1 This is a map-based clone of the RFFA gene in this application. Figure a shows the location of RFFA on the genetic linkage map of rice chromosome 10; Figures b and c use two mapping populations to finely locate RFFA. The numbers between the markers represent the number of recombinations that occurred between each marker and the RFFA site.
[0020] Figure 2 This is a diagram of the vector used for RFFA transgenic complementation verification in this application, specifically the functional vector pCAMBIA1300.
[0021] Figure 3These are pollen iodine staining microscopic examination and seed set phenotypes of the T1 generation transgenic single plants of this application. Figure a shows the identification of transgenic plants by molecular markers; Figure b shows the whole plant phenotype of transgenic negative (left) and transgenic positive (right); Figure c shows the spikelet seed set phenotype of transgenic negative (left) and transgenic positive (right); Figure d shows the pollen iodine staining microscopic examination of transgenic negative plants; Figure e shows the pollen microscopic examination of transgenic positive plants.
[0022] Figure 4 This is the representative phenotype of the RFFA transgenic positive plant and the new basal male sterile line Xinzi 1A. Figure a shows the pollen iodine staining phenotype of the F1 plant (right) of the cross between the male sterile line Xinzi 1A (left) and the transgenic positive plant and the new basal male sterile line; Figure b shows the spikelets of the F1 plant (right) of the cross between the male sterile line Xinzi 1A (left) and the transgenic positive plant and the new basal male sterile line.
[0023] Figure 5 This is an RT-PCR detection image of the RFFA gene expression characteristics in this application. The top image shows the expression of the target gene RFFA in various tissues; the bottom image shows the expression of the internal reference gene Actin1 in various tissues. Invention Details
[0025] definition
[0026] As used herein, “rice” means any rice plant and includes all plant varieties that can be bred with rice. As used herein, “plant” or “plant” includes the whole plant, plant cell, plant organ, plant protoplast, plant cell tissue culture from which the plant can regenerate, plant callus, plant clump, and complete plant cells in a plant or plant part, such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, etc. As used herein, rice includes paddy rice, upland rice, indica rice, japonica rice, early rice, late rice, glutinous rice, sticky rice, hairy rice, and hairless (smooth) rice.
[0027] As used in this article, the term "sterile line," also known as "male sterile line" or "cytoplasmic male sterile line," refers to a rice variety that is pollen sterile and can pass on this trait to its offspring.
[0028] As used herein, the term "new cytoplasmic male sterile line (CMS-FA)" refers to a male sterile line developed from wild rice (O. rufipogon) in Fujian that possesses male sterile cytoplasm from wild rice in Fujian. In other words, it is a male sterile line with a specific CMS-FA cytoplasmic background, abbreviated as CMS-FA or new cytoplasmic male sterile line. Because the resource utilization of this cytoplasm as a maintainer line reaches 55.5%, which is more extensive than the 20% resource utilization of the wild-abort type (CMS-WA) maintainer line, it is also called a broad-based cytoplasmic male sterile line, a broad-based male sterile line, or a broad-based sterile line. For example, please refer to Chinese invention patent document CN1954666B.
[0029] As used herein, the terms "single nucleotide polymorphism" or "SNP" or "SNP marker" or "SNP site" refer to nucleotide sequence variations present in the genomic sequence of a chromosome. These variations, based on differences in nucleotide sequences (changes in a single nucleotide—A, T, C, or G), result in chromosomal genome diversity, allowing different alleles (e.g., alleles from two different individuals) or different individuals to be distinguished from each other. These variations can occur within coding or non-coding regions of a gene (e.g., promoter regions or their vicinity, or introns) or between genes.
[0030] As used in this article, the term "InDel" refers to an insertion or deletion, specifically a difference in the whole genome, where an individual's genome has a certain number of nucleotide insertions or deletions relative to a standard control (Jander et al., 2002).
[0031] As used in this article, the term "SSR (Simple Sequence Repeats)," also known as microsatellite DNA, is a type of tandem repeat sequence of several nucleotides (usually 1 to 6) that can be several tens of nucleotides long. The sequences flanking each SSR are generally relatively conserved single-copy sequences.
[0032] As used in this article, the term "gene homologous to RFFA" refers to a gene that originates from the same or different species as rice RFFA and has a similar function.
[0033] The term "gene editing" or "genome edting" used in this article refers to an emerging and relatively precise genetic engineering technique that can modify specific target genes in an organism's genome. Gene editing refers to the ability to precisely "edit" target genes, achieving modifications to specific DNA fragments. Gene editing relies on genetically engineered nucleases, also known as "molecular scissors," to create site-specific double-strand breaks (DSBs) at specific locations in the genome. This induces the organism to repair the DSBs through non-homologous end joining (NHEJ) or homologous recombination (HR). Because this repair process is prone to errors, it can lead to targeted mutations.
[0034] As used in this article, the term "CRISPR / Cas9" refers to an endonuclease that uses an RNA guide strand to target the endonuclease cleavage site. See also Jinek et al., Science. 337 :816-821 (2013); Cong et al., Science (January 3, 2013); and Mali et al., Science (January 3, 2013). Currently, three different types of CRISPR / Cas9 systems have been discovered: type I, type II, and type III, which are found in approximately 40% of sequenced eubacteria and 90% of sequenced archaea. Type II is relatively simple in composition, with the Cas9 protein and guide RNA (gRNA) as its core components, and is the most thoroughly studied type. When bacteria defend against the invasion of exogenous DNA such as bacteriophages, under the regulation of the leader region, CRISPR is transcribed into a long RNA precursor (pre-crRNA), which is then processed into a series of short mature crRNAs containing conserved repetitive sequences and spacer regions. These crRNAs ultimately recognize and bind to complementary exogenous DNA sequences to perform cleavage. The CRISPR / Cas9 splicing site is located at the NGG site in the 5'-GG-N18-NGG-3' characteristic region of the PAM region (Protospacer Adjacent Motif) downstream of the crRNA complementary sequence, and this characteristic sequence is repeated once in every 128 bp of random DNA sequence.
[0035] The term "CRISPR / Cas12a" used in this article refers to a novel CRISPR-Cas system. Compared to Cas9, Cas12a is more accurate and safer. When CRISPR / Cas9 works, the Cas9 protein recognizes the PAM sequence (RNA-written genetic code) and unwinds part of the double helix using gRNA. During this process, once the Cas9 protein finds a suitable sequence, it binds tightly to that DNA segment. While some mismatches may occur, this binding is irreversible. Cas12a, on the other hand, is much more intelligent. When searching for its "target," it performs single-base recognition on the DNA sequence along the way. If a mismatch is found, it moves on and searches again. When it finds a PAM sequence, the Cas12a protein forms a semi-closed R-loop with the PAM sequence. Only when the correct sequence is recognized does it fully bind to form a closed R-loop. Therefore, this binding is reversible, demonstrating its greater safety.
[0036] The terms “transcription activator-like effector nucleosidease”, “TAL effector nucleosidease”, or “TALEN” used in this article refer to a class of artificial restriction endonucleases produced by fusing the DNA-binding domain of the TAL effector with the DNA-cutting domain.
[0037] The term "zinc finger nuclease (ZFN)" used in this article consists of a DNA recognition domain and a DNA cleavage domain. The DNA recognition domain is a tandem structure of 3-4 ZFs, each containing approximately 30 amino acids, fixed by a zinc ion, and recognizes and binds to a specific triplet base. The DNA cleavage domain consists of 96 amino acid residues at the carboxyl terminus of the nonspecific endonuclease Fok I. Each Fok I monomer is linked to one ZF to form a ZFN, recognizing a specific site. When two recognition sites are at an appropriate distance (6-8 bp), the two monomeric ZFNs interact to produce enzymatic cleavage, forming a double-strand break, thereby mediating site-specific DNA cleavage.
[0038] The term "meganuclease" as used in this article refers to homing endonucleases capable of recognizing nucleic acid sequences of 14–40 bases in length. Some meganucleases can tolerate small homing site sequence differences, and the large recognition region still ensures the high specificity of these enzymes, which in turn maintains low levels of intragenomic nonspecific cleavage and low toxicity. Meganucleases are encoded by open reading frames within moving sequences of self-splicing RNA introns or self-splicing protein intron sequences. Detailed Implementation
[0039] This application provides the nucleotide sequence of the RFFA gene and the protein it encodes. The nucleotide sequences are shown in SEQ ID NO:1, 2, and 3 of the sequence listing, where SEQ ID NO:1 is a 2376-base open reading frame (ORF) without introns, SEQ ID NO:2 is a sequence containing a promoter regulatory element and a 5' untranslated region, and SEQ ID NO:3 is a 3' untranslated region sequence. The sequence of the protein encoded by the RFFA gene is shown in SEQ ID NO:4. This sequence consists of 791 amino acids and has a functional domain composed of 19 pentatricopeptide repeats (PPRs). Its biological function is to restore fertility in plant cytoplasmic male sterility. A typical PPR is a repeating unit consisting of 35 amino acid residues. In different PPR-containing proteins, functional domains are formed by two or more unidirectional PPR units, and the amino acid sequences of different PPR units vary to varying degrees.
[0040] Specifically, this application relates to the following technical solutions.
[0041] In a first aspect, this application provides a rice cytoplasmic male sterility restorer gene RFFA or a functional variant thereof, the restorer gene RFFA comprising the nucleotide sequence shown in SEQ ID NO: 1.
[0042] SEQ ID NO: 1 is an open reading frame of 2376 bases without introns. Those skilled in the art can identify and / or obtain functional variants of the rice cytoplasmic male sterility restorer gene RFFA using conventional methods. These functional variants may have one or more nucleotide deletions, additions, and / or substitutions compared to the original gene, but still retain the function of the original gene, for example, still encoding a protein with the same function. The functional variants may have at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the sequence shown in SEQ ID NO: 1 and encode a protein with the same function. Therefore, SEQ ID NO: 1 includes both the nucleotide sequence shown in SEQ ID NO: 1 itself and functional variants of the nucleotide sequence shown in SEQ ID NO: 1.
[0043] As used herein, the term "functional variant" refers to substantially similar sequences. For nucleotide sequences, functional variants include those sequences that encode proteins with the same function due to genetic codon degeneracy. Naturally occurring allelic variants, such as polymerase chain reaction (PCR) and hybridization techniques, can be identified using known molecular biology techniques. For example, in this application, genes from other rice varieties that have at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with the gene RFFA and also encode a functional RFFA protein are included in the "functional variant" definition of this application. Identity is determined by the sequence alignment procedure described herein, using default parameters. The sequence difference between the functional variant of the nucleotide and the nucleotide sequence can be as little as 1-15 nucleotides, as little as 1-10 (e.g., 6-10), as little as 5, as little as 4, 3, 2 or even 1 nucleotide.
[0044] Based on the RFFA gene sequence information provided in this application, genes homologous to RFFA or functional variants of RFFA can be easily obtained by the following methods: (a) obtaining homologous genes of RFFA that have been published but whose functions are unknown by comparing with a database; (b) using RFFA gene fragments as probes to screen rice genome libraries to obtain positive clones and sequencing; (c) designing oligonucleotide primers based on the sequence information of SEQ ID NO:1, and using PCR to amplify RFFA gene fragments from the genome of rice or wild rice and sequencing; (d) obtaining RFFA by modifying the sequence of SEQ ID NO:1 using molecular biology methods; or (e) obtaining RFFA by chemical synthesis with reference to the sequence of SEQ ID NO:1.
[0045] In some embodiments, the rice cytoplasmic male sterility restoration gene RFFA consists of SEQ ID NO: 1, 2 and 3, wherein SEQ ID NO: 1 is an open reading frame (ORF) of 2376 bases without introns, SEQ ID NO: 2 is a sequence containing promoter regulatory elements and a 5' untranslated region, and SEQ ID NO: 3 is a 3' untranslated region sequence.
[0046] In a preferred embodiment, the rice cytoplasmic male sterility restorer gene RFFA consists of SEQ ID NO: 1.
[0047] In a second aspect, this application provides a protein or a functional variant thereof, the protein being encoded by the rice cytoplasmic male sterility restorer gene RFFA, and the protein comprising or consisting of the amino acid sequence shown in SEQ ID NO: 4.
[0048] Those skilled in the art can identify and / or obtain the functional variants using conventional methods. Compared to the original protein, the functional variants may have one or more amino acid deletions, additions, and / or substitutions (e.g., conserved substitutions), but still retain the function of the original protein, such as the function of restoring fertility in rice cytoplasmic male sterile lines. The functional variants may have at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the sequence shown in SEQ ID NO: 4 and still retain the function of the original protein. Therefore, SEQ ID NO: 4 includes both the amino acid sequence shown in SEQ ID NO: 4 itself and the functional variants of the amino acid sequence shown in SEQ ID NO: 4.
[0049] For protein sequences, the term "functional variant" includes polypeptides derived from a native protein, said derivation being achieved by deleting (so-called truncating) one or more amino acids from the N-terminus and / or C-terminus of the native protein, or by adding one or more amino acids to the N-terminus and / or C-terminus of said native protein; deleting or adding one or more amino acids at one or more sites in the native protein; or substituting one or more amino acids at one or more sites in the native protein. Thus, with respect to proteins, the term "functional variant" includes a biologically active fragment of a native protein containing a sufficient number of consecutive amino acid residues that retain the biological activity of the native protein, such as having RFFA protein function. Such function relative to the native protein can be different or modified, or can be unchanged, as long as RFFA protein function is retained. Identification is determined by the sequence alignment procedure described herein, using default parameters. The difference between the active variant sequence and the protein can be as little as 1-15 amino acid residues, as little as 1-10 (e.g., 6-10), as little as 5, as little as 4, 3, 2, or even 1 amino acid residue.
[0050] In a specific implementation, the protein consists of the amino acid sequence shown in SEQ ID NO: 4.
[0051] In a third aspect, this application provides a nucleic acid that encodes the protein described in the second aspect.
[0052] In a preferred embodiment, the nucleic acid may be a codon-optimized nucleic acid suitable for expression in a host cell. For example, it may still encode the same protein based on codon degeneracy. Methods for codon optimization based on the host cell used are well known to those skilled in the art.
[0053] In a fourth aspect, this application provides an expression vector comprising the rice cytoplasmic male sterility restoration gene RFFA as described in the first aspect or the nucleic acid as described in the third aspect.
[0054] Any suitable expression vector can be used. For example, prokaryotic cloning vectors include plasmids from *E. coli*, such as colE1, pCR1, pBR322, pMB9, pUC, pKSM, and RP4. Prokaryotic vectors also include phage DNA derivatives such as M13 and other filamentous single-stranded DNA phages. An example of a vector that can be used for yeast is the 2μ plasmid. Suitable vectors for expression in mammalian cells include well-known derivatives such as SV-40, adenovirus, retrovirus-derived DNA sequences, and shuttle vectors derived from functional mammalian vectors (such as those mentioned above) and combinations of functional plasmids and phage DNA.
[0055] Other eukaryotic expression vectors are known in the field (e.g., P J. Southern & P. Berg, J. Mol. Appl. Genet, 1:327-341 (1982); Subramani et al., Mol. Cell. Biol, 1:854-864 (1981); Kaufhiann & Sharp, "Amplification And Expression of Sequences Cotransfected with a Modular Dihydrofolate Reductase Complementary DNA Gene," J. Mol. Biol, 159:601-621 (1982); Kaufhiann & Sharp, Mol. Cell. Biol, 159:601-664 (1982); Scahill et al., "Expression And Characterization Of The Product Of A Human Immune Interferon DNA Gene In Chinese Hamster Ovary Cells," Proc. Nat'l Acad. Sci. USA, 80:4654-4659 (1983); Urlaub & Chasin, Proc. Nat'l Acad. Sci USA, 77:4216-4220, (1980), which are incorporated herein by reference in their entirety.
[0056] The expression vectors used in this invention contain at least one expression control sequence operatively linked to the DNA sequence or fragment to be expressed. The control sequence is inserted into the vector to control and regulate the expression of the cloned DNA sequence. Examples of useful expression control sequences are the lac system, trp system, tac system, trc system, major operon and promoter regions of bacteriophage λ, control regions of fd coat proteins, yeast glycolysis promoters, such as promoters of 3-phosphoglycerate kinase, promoters of yeast acid phosphatases, such as Pho5, promoters of yeast α-mating factors, and promoters derived from polyomaviruses, adenoviruses, retroviruses, and simian viruses, such as early and late promoters of SV40, and other sequences known to control gene expression in prokaryotic or eukaryotic cells and their viruses or combinations thereof.
[0057] In a fifth aspect, this application provides a method for creating rice restorer lines, comprising introducing the rice cytoplasmic male sterility restorer gene RFFA as described in the first aspect, or the nucleic acid as described in the third aspect, or the expression vector as described in the fourth aspect into a rice variety.
[0058] In some implementations, the introduction is carried out through gene editing.
[0059] In some implementations, the rice variety is selected from paddy rice, upland rice, indica rice, japonica rice, early rice, late rice, glutinous rice, rice with hairy leaves, and rice without hairy leaves.
[0060] In some embodiments, the gene editing is performed using one or more sequence-specific nucleases selected from the following: CRISPR / Cas9, CRISPR / Cpf1, CRISPR / Cas12a, TALEN, a wide range of nucleases, and ZFN. Preferably, the gene editing is performed using CRISPR / Cas9.
[0061] In a sixth aspect, this application provides a method for restoring fertility to a cytoplasmic male-sterile rice line, comprising:
[0062] Introducing the rice cytoplasmic male sterility restorer gene RFFA as described in the first aspect, or the nucleic acid as described in the third aspect, or the expression vector as described in the fourth aspect into rice varieties to produce transgenic restorer lines; and
[0063] The transgenic restorer line is crossed with the rice cytoplasmic male sterile line to produce hybrid seeds with normal fertility.
[0064] In some implementations, the introduction is carried out through gene editing.
[0065] In some embodiments, the rice variety or the rice cytoplasmic male sterile line is selected from rice, upland rice, indica rice, japonica rice, early rice, late rice, glutinous rice, rice with hairy leaves, and rice without hairy leaves.
[0066] In some embodiments, the gene editing is performed using one or more sequence-specific nucleases selected from the following: CRISPR / Cas9, CRISPR / Cpf1, CRISPR / Cas12a, TALEN, a wide range of nucleases, and ZFN. Preferably, the gene editing is performed using CRISPR / Cas9.
[0067] In a seventh aspect, this application provides the use of the rice cytoplasmic male sterility restorer gene RFFA as described in the first aspect or the nucleic acid as described in the third aspect in rice breeding or the creation of rice restorer lines or the restoration of fertility in rice cytoplasmic male sterile lines.
[0068] The RFFA-like gene described in this application is defined as a gene that differs from the nucleotide sequence of SEQ ID NO:1 by one or more nucleotides, including changes, deletions, or insertions of several bases, and whose expression product has a function equivalent to that of the RFFA expression product.
[0069] In this specification and claims, the words “comprising,” “including,” and “containing” mean “including but not limited to” and are not intended to exclude other parts, additives, components, or steps.
[0070] It should be understood that the features, characteristics, components or steps described in a particular aspect, embodiment or example of this application may be applied to any other aspect, embodiment or example described herein, unless there is any contradiction.
[0071] Example
[0072] The following examples are for illustrative purposes only and are not intended to limit the scope of this application.
[0073] Information on the rice plant materials used in this application can be found in the Chinese Rice Variety and Pedigree Database (http: / / www.ricedata.cn / variety / index.htm).
[0074] Example 1: Preliminary localization of the novel rice male sterility restorer gene RFFA
[0075] Studies have shown that the F1 generation of the new source male-sterile line (CMS-FA) crossed with the restorer line is normally fertile, and the fertility restoration (fertility) gene is dominantly inherited. The F2 generation shows a fertile:sterile ratio of 3:1, with the fertility restoration (fertility) gene controlled by a single dominant gene pair (Wang Naiyuan et al., 2008b). The maternal parent of the three-line hybrid rice Jinnong 2you 3 (see the Chinese Rice Variety and Pedigree Database: https: / / www.ricedata.cn / variety / varis / 605314.htm) is the male-sterile line Jinnong 2A (see the Chinese Rice Variety and Pedigree Database: https: / / www.ricedata.cn / variety / varis / 607151.htm), and the paternal parent is the restorer line Jinhui 3 (see the Chinese Rice Variety and Pedigree Database: https: / / www.ricedata.cn / variety / varis / 609760.htm). Jinong 2A is a new source male-sterile line (CMS-FA), and Jinhui 3 is a CMS-FA restorer line containing the rice CMS-FA restorer gene, named RFFA. To clone this gene, the inventors planted approximately 2000 plants of the self-pollinated offspring (F2 generation) of Jinong 2you 3 at their Sanya, Hainan base. Fertility was examined on 94 of these plants, revealing 74 fertile plants and 20 sterile plants, conforming to a 3:1 ratio. 2 =0.695, P=0.405), indicating that it is indeed a single-gene dominant inheritance. From a population of 2000 plants, 10 fertile plants (fertile pool) and 20 sterile plants (sterile pool) were randomly selected, and genomic DNA was extracted from leaves of equal amounts. Bulk Segregant Analysis (BSA) was performed using the RICE6K rice whole-genome breeding microarray (CN102747138A). The results showed that the main genotypic difference between the fertile and sterile pools was in a region of approximately 1800 kb (18.1-19.9 Mb) on rice chromosome 10 (Chr10), containing the cloned CMS restorer genes Rf1a and Rf1b (Wang et al., 2006). In this region, the genotype at the polymorphic SNP locus in the fertile pool was heterozygous, while the genotype in the sterile pool was homozygous, indicating that fertility is dominant.
[0076] Example 2: Fine mapping of the RFFA gene for male sterility restoration in rice from a new source
[0077] To develop and utilize more molecular markers for fine mapping of RFFA genes, SSR markers were used from public databases (http: / / www.gramene.org / ), and whole-genome sequencing of the two parents, Jinnong 2A and Jinhui 3, was performed using Illumina next-generation sequencing technology (http: / / www.illumina.com / ). SSR, InDel, and SNP markers were obtained through sequence alignment. The material used for mapping consisted of 2096 F2 plants of Jinnong 2You 3 initially mapped, along with their self-pollinated F3 and F4 populations. Map-based cloning was used to map the gene to a region of approximately 66 kb between two molecular markers, Rf1D6 (Chr10: 18.828 Mb) and Rf1D7 (Chr10: 18.894 Mb) (Rice TIGR / MSU Annotation Version 6.1, http: / / rice.plantbiology.msu.edu / ), containing Rf1a but not Rf1b. Figure 1 Subsequently, using 4059 individual plants from the BC1F2 and BC2F2 generations obtained by crossing Jinhui 3 and Huazhan (see the Chinese Rice Variety and Pedigree Database website: https: / / www.ricedata.cn / variety / varis / 607962.htm) with Huazhan as the recurrent parent, the gene was further mapped. The gene was located in a region of approximately 16 kb between the molecular markers Rf1D3 (18.874 Mb) and TMRf1M10 (18.890 Mb) (Rice TIGR / MSU Note 6.1, http: / / rice.plantbiology.msu.edu / ).
[0078] Example 3: Construction of the whole genome BAC library of rice Jinhui 3 and sequencing of the target BAC
[0079] To obtain more precise information on the localization regions, we constructed a whole-genome BAC library of the rice restorer line Jinhui 3. The BAC library contained a total of 41,472 clones, with an average insert size of approximately 114 kb, covering about 10.5 times the rice genome. Using linkage markers for the localization regions, two BACs, 71-N-20 and 90-J-22, containing the target region fragments were screened from the BAC library. Subsequently, the two selected BACs were sequenced and analyzed, and four candidate genes, ORF1, ORF2, ORF3, and ORF4, were predicted between the localization markers Rf1D3 and TMRf1M10. Figure 1 Since transgenic complementation of ORF2, ORF3, and ORF4 does not produce a phenotype, cloning ORF1 is the only reliable candidate gene for RFFA.
[0080] SEQ ID NO:1 is an intronless open reading frame (ORF) of 2376 bases from the RFFA gene of rice Jinhui 3, which was isolated and cloned.
[0081] SEQ ID NO:2 is the sequence of the RFFA gene containing promoter regulatory elements and a 5' untranslated region.
[0082] SEQ ID NO:3 is the 3' untranslated region sequence of the RFFA gene.
[0083] SEQ ID NO:4 is the amino acid sequence of the RFFA gene isolated and cloned from rice variety Jinhui 3.
[0084] Example 4: Creation of a new rice source male-sterile line 93-11A
[0085] To obtain a stable male-sterile line for subsequent transgenic complementation experiments, we used Jinnong 2A as the female parent and rice variety 93-11 (see the Chinese Rice Variety and Pedigree Database: https: / / www.ricedata.cn / variety / varis / 600611.htm) as the male parent for hybridization, obtaining the F1 hybrid. We then planted the hybrid and continued backcrossing it with variety 93-11 as the recurrent male parent for seven generations to obtain BC7F1 plants. Through backcrossing, we obtained a material whose nuclear genomic DNA was essentially identical to that of variety 93-11 while retaining the cytoplasm of Jinnong 2A. We named this rice material New Variety 93-11A. Phenotypic examinations were conducted on rice varieties 93-11 and 93-11A at flowering and maturity, respectively. The results showed that 93-11 pollen was fertile when iodized, while 93-11A pollen was sterile when iodized. 93-11 produced normal seeds at maturity, while 93-11A failed to produce seeds normally at maturity, with a seed set rate of 0%. Using these methods, we obtained a stable sterile line, 93-11A.
[0086] The seeds of the new rice male-sterile line 93-11A obtained in this embodiment were deposited with the China Center for Type Culture Collection, Wuhan University, Wuhan, China on July 28, 2021. The deposit information is as follows:
[0087] Depository Institution: China Center for Type Culture Collection (CCTCC)
[0088] Address of the depository: Wuhan University, Wuhan, China
[0089] Date of preservation: July 28, 2021
[0090] Culture Name (Classification): New Rice Seed Culture 93-11A
[0091] Accession number: CCTCC NO: P202115.
[0092] Example 5: Transgenic Complementation Experiment of RFFA
[0093] Based on the predicted full-length candidate gene sequence, a pair of oligonucleotide primers with restriction endonucleases BamHI and PstI adapters were designed for PCR amplification. The primer sequences are shown in SEQ ID NO:5 (underlined is the restriction endonuclease BamHI cleavage site) and SEQ ID NO:6 (underlined is the restriction endonuclease PstI cleavage site).
[0094] SEQ ID NO:5:
[0095] 5'-GAGCTCGGTACCCGG GGATCC TCGGTCCCGTATTTTGAATC-3'
[0096] SEQ ID NO:6:
[0097] 5'-GCCAAGCTTGCATGC CTGCAG TAGAAGAGCAGCTGCACCAA-3'
[0098] A 5071 bp fragment containing a promoter, coding region, and downstream termination sequence was amplified from the subclone of Jin Hui 3 using PCR technology. The PCR reaction system was as follows: 50 μl of reaction mixture contained 1x reaction buffer, 200 μM dNTPs, 100 ng subclone DNA, 0.3 μM primers, and 1.0 U KOD FX polymerase. The reaction program was as follows: Step 1: 95℃ for 5 min; Step 2: 95℃ for 20 s, 55℃ for 30 s, 72℃ for 5 min (30 cycles); Step 3: 72℃ for 7 min; Step 4: 25℃ for 1 min. After the reaction, the PCR product was purified. The vector pCAMBIA1300 (CAMBIA, Canberra, Australia) was purified using restriction endonucleases BamHI and PstI. Figure 2 After digestion, the PCR products, which were also digested with restriction endonucleases BamHI and PstI, were ligated into a vector. The correct, mutation-free clone vector was selected and introduced into Agrobacterium EHA105. Mature seeds of the new rice male-sterile line, Xinzi 93-11A, were used to induce callus formation on induction medium. EHA105 containing the target gene transformation vector was used to infect the callus of Xinzi 93-11A. After co-culture, screening for hygromycin-resistant callus, differentiation, rooting, hardening, and transplanting, transgenic rice plantlets were obtained.
[0099] The steps, culture media, and preparation methods for the above genetic transformation are described below:
[0100] (1) Abbreviations for reagents and solutions
[0101] The abbreviations for the reagents and plant hormones used in the culture medium are as follows: 6-BA (6-Benzylaminopurine); CN (Carbenicillin); KT (Kinetin); NAA (Napthaleneacetic acid); IAA (Indole-3-acetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid); AS (Acetosringone); CH (Casein Enzymatic Hydrolysate); HN (Hygromycin B); DMSO (Dimethyl Sulfoxide); N6 max (N6 macro-elemental composition solution); N6 mix (N6 trace element solution); MS max (MS macro-elemental composition solution); MS mix (MS trace element composition solution)
[0102] (2) Solution formulation
[0103] 1) N6 max Culture medium stock solution of macroelements (prepared according to 10x concentrate):
[0104]
[0105] Dissolve each of the above reagents one by one, then dilute to 1000 ml with distilled water at room temperature and store at room temperature.
[0106] 2) N6 min Culture medium trace element stock solution (prepared according to 100x concentration):
[0107]
[0108] Dissolve the above reagents at room temperature and bring the volume to 1000 ml with distilled water. Store at room temperature.
[0109] 3) Iron salts (Fe 2+ EDTA stock solution (prepared according to 100X concentrate):
[0110] Dissolve 3.73 g of disodium ethylenediaminetetraacetate (Na2EDTA·2H2O) and 2.78 g of FeSO4·7H2O separately, mix them, and bring the volume to 1000 mL with distilled water. Incubate at 70°C for 2 hours, and store at 4°C for later use.
[0111] 4) Vitamin stock solution (prepared according to 100X concentrate):
[0112]
[0113] Add distilled water to a final volume of 1000 ml and store at 4°C for later use.
[0114] 5) MS medium for macro-elements (MS) max Mother liquor (prepared according to 10X concentrate):
[0115]
[0116] Dissolve the above reagents at room temperature and bring the volume to 1000 ml with distilled water. Store at room temperature.
[0117] 6) MS medium trace element stock solution (MS) min Mother liquor (prepared according to 100X concentrate):
[0118]
[0119]
[0120] Dissolve the above reagents at room temperature and bring the volume to 1000 ml with distilled water. Store at room temperature.
[0121] 7) Preparation of 2,4-D stock solution (1 mg / mL):
[0122] Weigh 100 mg of 2,4-D, dissolve it in 1 mL of 1N potassium hydroxide for 5 minutes, then add 10 mL of distilled water to dissolve completely and bring the volume to 100 mL. Store at room temperature.
[0123] 8) Preparation of 6-BA stock solution (1 mg / mL):
[0124] Weigh 100 mg of 6-BA, dissolve it in 1 mL of 1N potassium hydroxide for 5 minutes, then add 10 mL of distilled water to dissolve completely and bring the volume to 100 mL. Store at room temperature.
[0125] 9) Preparation of NAA stock solution (1 mg / mL):
[0126] Weigh 100 mg of NAA, dissolve it in 1 mL of 1N potassium hydroxide for 5 minutes, then add 10 mL of distilled water to dissolve completely and bring the volume to 100 mL. Store at 4°C protected from light.
[0127] 10) Preparation of IAA stock solution (1 mg / mL):
[0128] Weigh 100 mg of IAA, dissolve it in 1 mL of 1N potassium hydroxide for 5 minutes, then add 10 mL of distilled water to dissolve completely and bring the volume to 100 mL. Store at 4°C protected from light.
[0129] 11) Preparation of glucose storage solution (0.5 g / mL):
[0130] Weigh 125 grams of glucose, then dissolve it in distilled water to a final volume of 250 ml. After sterilization, store at 4°C for later use.
[0131] 12) Preparation of AS stock solution:
[0132] Weigh 0.392 g of AS, dissolve it in 10 mL of DMSO, dispense into 1.5 mL centrifuge tubes, and store at -20°C for later use.
[0133] 13) Preparation of 1N potassium hydroxide stock solution:
[0134] Weigh 5.6 grams of potassium hydroxide, dissolve it in distilled water and bring the volume to 100 ml. Store at room temperature for later use.
[0135] (3) Culture medium formulation for rice genetic transformation:
[0136] 1) Induction medium
[0137]
[0138] Add distilled water to 900 ml, adjust the pH to 5.9 with 1N potassium hydroxide, boil and bring the volume to 1000 ml, dispense into 50 ml Erlenmeyer flasks (30 ml / flask), seal and sterilize using standard methods (e.g., sterilize at 121°C for 15 minutes; the sterilization method for the culture medium described below is the same as that for this culture medium).
[0139] 2) Subculture medium:
[0140]
[0141]
[0142] Add distilled water to 900 ml, adjust the pH to 5.9 with 1N potassium hydroxide, boil and bring the volume to 1000 ml, dispense into 50 ml Erlenmeyer flasks (30 ml / flask), seal, and sterilize as described above.
[0143] 3) Pre-culture medium (this step can be omitted for japonica rice):
[0144]
[0145] Add distilled water to 250 ml, adjust the pH to 5.6 with 1N potassium hydroxide, seal, and sterilize as described above.
[0146] Before use, heat and dissolve the culture medium, then add 5 ml of glucose stock solution and 250 μL of AS stock solution, and dispense into petri dishes (25 ml / dish).
[0147] 4) Suspension culture medium:
[0148]
[0149] Add distilled water to 100 ml, adjust the pH to 5.4, dispense into two 100 ml Erlenmeyer flasks, seal, and sterilize as described above.
[0150] Add 1 ml of sterile glucose stock solution and 100 μL of AS stock solution before use.
[0151] 5) Co-culture medium:
[0152]
[0153] Add distilled water to 250 ml, adjust the pH to 5.6 with 1N potassium hydroxide, seal, and sterilize as described above.
[0154] Before use, heat and dissolve the culture medium, then add 5 ml of glucose stock solution and 250 μL of AS stock solution, and dispense into petri dishes (25 ml / dish).
[0155] 6) Screening culture medium:
[0156]
[0157]
[0158] Add distilled water to 250 ml, adjust the pH to 6.0, seal, and sterilize using the method described above.
[0159] Before use, dissolve the culture medium by adding 250 μL of HN (50 mg / mL) and 400 μL of CN (10 g CN / 36 mL water) and dispense into petri dishes (25 mL / dish). (Note: The carbenicillin concentration in the first screening medium is 400 mg / L, and the carbenicillin concentration in the second and subsequent screening media is 250 mg / L).
[0160] 7) Predifferentiation medium (this step can be omitted for japonica rice):
[0161]
[0162] Add distilled water to 250 ml, adjust the pH to 5.9 with 1N potassium hydroxide, seal, and sterilize as described above.
[0163] Dissolve the culture medium before use: 250 μL HN (50 mg / mL) and 250 μL CN (250 mg / mL), and dispense into petri dishes (25 mL / dish).
[0164] 8) Differentiation medium:
[0165]
[0166] Add distilled water to 900 ml and adjust the pH to 6.0 with 1N potassium hydroxide.
[0167] Boil and dilute to 1000 ml with distilled water, dispense into 100 ml Erlenmeyer flasks (50 ml / flask), seal, and sterilize as described above.
[0168] 9) Rooting medium
[0169]
[0170]
[0171] Add distilled water to 900 ml and adjust the pH to 5.8 with 1N potassium hydroxide.
[0172] Boil the contents and dilute to 1000 ml with distilled water. Dispense the contents into rooting tubes (25 ml / tube), seal the tubes, and sterilize them as described above.
[0173] (4) Steps of Agrobacterium-mediated genetic transformation:
[0174] 4.1 Callus Induction
[0175] 1) Remove the husks from mature Zhonghua 11 rice seeds, then treat them sequentially with 70% ethanol for 1 minute and 0.15% mercuric chloride (HgCl2) for 15 minutes to disinfect the seed surface.
[0176] 2) Wash the seeds 4-5 times with sterile water;
[0177] 3) Place 8-10 seeds on the induction medium;
[0178] 4) Place the inoculated culture medium in the dark for 4-5 weeks at a temperature of 26±1℃.
[0179] 4.2 Callus succession:
[0180] Select bright yellow, firm and relatively dry embryogenic callus, and culture them in the dark for 2 weeks on subculture medium at a temperature of 25±1℃.
[0181] 4.3 Pre-culture:
[0182] Select firm and relatively dry embryogenic callus and culture them in the dark for 2 weeks on pre-medium at a temperature of 26±1℃.
[0183] 4.4 Agrobacterium culture:
[0184] 1) Streaking and pre-culturing Agrobacterium EHA105 (this strain is from the publicly available Agrobacterium strain from CAMBIA) on LA medium with corresponding resistance selection (LA medium preparation refers to J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, translated by Jin Dongyan et al., Science Press, 2002, Beijing) for two days at 28°C.
[0185] 2) Transfer Agrobacterium to suspension culture medium and incubate on a shaker at 28°C for 2-3 hours.
[0186] 4.5 Agrobacterium infection:
[0187] 1) Transfer the pre-cultured callus to a sterilized bottle;
[0188] 2) Adjust the Agrobacterium suspension to an OD600 of 0.8-1.0;
[0189] 3) Soak the callus in Agrobacterium suspension for 30 minutes;
[0190] 4) Transfer the callus to sterilized filter paper and blot dry; then place it on a co-culture medium and incubate for 3 days at a temperature of 19-20℃.
[0191] 4.6 Callus washing and selective culture:
[0192] 1) Wash the callus with sterile water until Agrobacterium is no longer visible;
[0193] 2) Soak in sterile water containing 400 mg / L carbenicillin (CN) and shake for 30 minutes;
[0194] 3) Transfer the callus to sterilized filter paper and blot dry;
[0195] 4) Transfer the callus to the selection medium and culture it 2-3 times, 2 weeks each time, until good resistant callus grows.
[0196] 4.7 Differentiation:
[0197] 1) Transfer the resistant callus to predifferentiation medium and culture in the dark for 5-7 days;
[0198] 2) Transfer the predifferentiated callus to differentiation medium, with three independent callus distributed evenly in each bottle. Culture under light for 5-6 weeks until large seedlings grow, at a temperature of 26℃.
[0199] 4.8 Rooting and hardening off:
[0200] 1) Cut off the old roots that develop during differentiation;
[0201] 2) Transfer it to a rooting medium and culture it under light for 2-3 weeks until large seedlings grow. After that, remove the sealing film, add some tap water to harden the seedlings for a week, and then transplant them at a temperature of 26℃.
[0202] 4.9 Transplanting
[0203] Wash away any residual culture medium from the roots, transfer seedlings with good root systems to a greenhouse, keep them moist for the first few days, and then transplant them to the field once they are growing well.
[0204] This experiment yielded 14 independent transgenic complementary T0 generation rice plants, including 7 positive and 7 negative plants. The positive plants were planted in the field, and pollen was collected at the heading and flowering stage. Microscopic examination with potassium iodide staining revealed that the T0 generation plants had a fertile pollen rate of over 80% and a self-pollination spikelet set rate of over 60%; while the control sterile line had a fertile pollen rate of zero and failed to set seeds through self-pollination. Seeds from the T0 generation plants were harvested and planted in the field for further observation of the T1 phenotypic trait. Phenotypic examination was conducted at maturity, and the results are as follows: Figure 3 As shown, the T1 generation population exhibited segregation between fertile and sterile individuals, with fertile plants achieving a seed setting rate exceeding 70%, while sterile plants achieved a seed setting rate of zero. The results of this experiment demonstrate that transforming the restorer gene RFFA into sterile varieties that previously lacked the functional RFFA can create new restorer lines. This experiment also proves that the biological function of this gene is to restore fertility in cytoplasmic male sterility. This application identifies this gene, cloned from the RFFA locus in the rice restorer line genome, as the target gene, namely the cytoplasmic male sterility restorer gene RFFA.
[0205] We crossed T1 generation positive plants transgenic with the RFFA gene with the new basal male-sterile line Xinzhi 1A (see the Chinese Rice Variety and Pedigree Database: https: / / www.ricedata.cn / variety / varis / 621300.htm) to obtain F1 generation plants. We planted F1 generation plants and the male-sterile line Xinzhi 1A in the field of Wuhan. When the rice was heading and flowering, pollen was collected, stained with potassium iodide, and examined under a microscope. After the rice matured, spikelets were collected to investigate the seed setting rate. The results are as follows: Figure 4 As shown, the pollen of the sterile line 1A was sterile after staining with potassium iodide, with a seed set rate of zero; the pollen of the F1 generation plants was fertile after staining with potassium iodide, with a seed set rate of over 80%. This experiment also proves that the restorer line created after introducing the restorer gene RFFA can restore the fertility of the new source sterile line.
[0206] Example 6: Expression Analysis of RFFA
[0207] The expression of this gene was analyzed using RT-PCR. The primer sequences used for RT-PCR are shown in SEQ ID NO:7 and SEQ ID NO:8 below.
[0208] SEQ ID NO:7: 5'-GATGTACTTTGCAAGTCAGG-3'
[0209] SEQ ID NO:8:5'-CCTTCTTTGCAAAGATTGCT-3'
[0210] RT-PCR analysis results are as follows Figure 5 As shown. Figure 5 The results showed that the RFFA gene in Jinhui 3 was expressed in various tissues such as roots, stems, leaves and young spikelets. This expression is constitutive expression, so the gene belongs to constitutive expression.
[0211] References
[0212] Ge Xiaoping, Zhang Dongfu, Wu Lindi, et al. Preliminary study on the relationship between temperature and safe seed production of rice male-sterile line Tianfeng A in Jianning, Fujian [J]. Hybrid Rice, 2012, 27(3):23-27.
[0213] Huang Qingyang, He Yuqing, Jing Runchun, et al. Locating the cytoplasmic male sterility restorer gene in rice Honglian type using microsatellite markers [J]. Chinese Science Bulletin, 1999, 44(14): 1517-1520.
[0214] Wang Naiyuan. Study on rice quality of new cytoplasmic improved male sterile lines of wild rice (O,rufipogon) [J]. Acta Agronomica Sinica, 2006a, 32: 253-259.
[0215] Wang Naiyuan. Study on new male-sterile restorer lines of wild rice (Oryza rufipogon) [J]. Acta Agronomica Sinica, 2006b, 32: 1884-1891.
[0216] Wang Naiyuan, Liang Kangjing, Li Yu, et al. Screening of parental resources for the new CMS-FA hybrid rice system [J]. Acta Agronomica Sinica, 2008a, 34(9):1549-1556.
[0217] Wang Naiyuan, Liang Kangjing, Li Yu, et al. Inheritance of male sterility restoration gene in rice new source (CMS-FA) [J]. Acta Agronomica Sinica, 2008b, 34(11): 1929-1937.
[0218] Xi Jianmin, Zhang Xiongfei, Tang Yalin, et al. A preliminary study on the relationship between fertility and temperature and light in indica three-line male-sterile lines [J]. Hybrid Rice, 2011, 26(1):72-75.
[0219] Akagi H,Yokozeki Y,Inagaki A,et al.A codominant DNA marker closelylinked to the rice nuclear restorer gene,RF-1,identified with inter-SSRfingerprinting[J].Genome,1996, 39(6):1205-1209.
[0220] Hu J,Wang K,Huang W,et al.The rice pentatricopeptide repeat proteinRF5restores fertility in Hong-Lian cytoplasmic male-sterile lines via acomplex with the glycine-rich protein GRP162[J].Plant Cell,2012,24(1):109-22.
[0221] Huang W,Hu J,Yu C,et al.Two non-allelic nuclear genes restorefertility in a gametophytic pattern and enhance abiotic stress tolerance inthe hybrid rice plant[J]. Theoretical and applied genetics,2012,124(5):799-807.
[0222] Huang W,Yu C,Hu J,et al.Pentatricopeptide-repeat family proteinRF6functions with hexokinase 6to rescue rice cytoplasmic male sterility[J].Proceedings of the National Academy of Sciences of the United States ofAmerica,2015,112(48):14984-9.
[0223] Tang H,Luo D,Zhou D,et al.The Rice Restorer Rf4for Wild-Abortivecytoplasmic male sterility encodes a mitochondrial-localized PPR protein thatfunctions in reduction of WA352transcripts[J].Molecular Plant,2014,7(9):1497-1500.
[0224] Kazama T,Toriyama K.A fertility restorer gene,Rf4,widely used forhybrid rice breeding encodes a pentatricopeptide repeat protein[J].Rice,2014,7(1):1-5.
[0225] Komori T,Ohta S,Murai N,et al.Map-based cloning of a fertilityrestorer gene,Rf-1,in rice(Oryza sativa,L.)[J].Plant Journal,2004,37(3):315-25.
[0226] Komori T,Yamamoto T,Takemori N,et al.Fine genetic mapping of thenuclear gene,Rf-1, that restores the BT-type cytoplasmic male sterility inrice(Oryza sativa,L.)by PCR-based markers[J].Euphytica,2003,129(2):241-247.
[0227] Shinjyo C.Genetical Studies of Cytoplasmic Male Sterility andFertility Restoration in Rice,Oryza sativa L.(Department of Agriculture)[J].Science Bulletin of the College of Agriculture University of Ryukyus,1975,22:1-57.
[0228] Wang Z, Zou Y, Li
[0229] Yao F,Xu C,Yu S,et al.Mapping and genetic analysis of two fertilityrestorer loci in the wild-abortive cytoplasmic male sterility system of rice(Oryza sativa L.)[J].Euphytica, 1997,98:183-187. sequence list <110> China Seed Group Co., Ltd. <120> Rice cytoplasmic male sterility restorer gene RFFA and its application <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2376 <212> DNA / RNA <213> Rice (Oryza sativa) <400> 1 atggcgcgcc gcgccgcttc ccgcgctgtt ggcgcccttc gctcggacgg ctcgatccaa gggcgaggag gccgcgcggg gggcagtggc gccgaggacg cacgccacgt gttcgacgaa 120 ttgctccgcc gtggcagggg cgcctcgatc tacggcttga accgcgccct cgccgacgtc 180 gcgcgtcaca gccccgcggc cgccgtgtcc cgctacaacc gcatggcccg agccggcgcc 240 ggcaaggtaa ctcccaccgt gcacacctat gccatcctca tcggctgctg ctgccgcgcg 300 ggccgcttgg acctcggttt cgcggccttg ggcaatgtca ttaagaaggg atttagagtg 360 gaagccatca ccttcactcc tctgctcaag ggcctctgtg ccgacaagag gacgagcgac 420 gcaatggaca tagtgctccg cagaatgacc gagctcggct gcataccaga tgtcttctcc 540. tacaatattc ttctcaaggg tctgtgtgat gagaacagaa gccaagaagc tctcgagctg ctgcacatga tggctgatga tcgaggagga ggtagcccac ctgatgttgt gtcgtatacc 600. actgtcctca atggcttctt caaagagggg gattcagaca aagcttacag tacataccat gaaatgctgg accgggggat tttaccagat gttgtgacct acagctctat tattgctgcg tttgcaagg ctcaagctat ggacaaagcc atggaggtac ttaccacgat ggttaagaat 780 ggtgtcatgc ctgattgcat gacatatact agtatcatgc atggatattg ctcttcaggg 840 cagccgaaag aggctattgg atttctcaaa aagatgcgca gtgatggtgt cgaaccaaat 900 gttttactt atagatcact gatgaattat ctttgcaaga atggaagatc caccgaagct 960 agaaagattt tcgattctat gaccaagagg ggcctagagc ctgatattgc tacctatcgt 1020 accctgcttc aggggtatgc taccaaagga gcccttgttg agatgcatgc tctcttggat 1080 ttgatggtac gaaatggtat ccaaccggat catcatgtat tcaacattct aatatgtgca 1140 tacgctaaac aagagaaagt agatcaggca atgcttgtat tcagcaaaat gaggcagcat 1200 ggattgaatc cgaatgtagt gacctatgga acagttatag atgtactttg caagtcaggc 1260 agtgtagatg atgctatgct ttattttgag cagatgatcg atgaaggact aacccctaac 1320 attattgtgt atacctccct aattcatggt ctgtgcacct atgacaagtg ggagaaggct 1380 gaagagttat ttttaaaat gttggacagt ggcatctgtc cgaacactgt tttctttagt 1440 tcaatatta gcaatctttg caaagaaggg agggttatag aatctgaaaa actttttgac ctgatggtac gtattggtgt gaagcccaat gtcattacgt acaatactct tatcgatgga tgctgcttag ctggtaagat ggatgaagca atgaagttac tttctggcat ggtctcagtt gggttgaaac ctaatactgt tacttatagc actttgatta atggctactg caaaattagt aggatggaag acgcgttagt tctttttaag gagatggaga gcagtggtgt tagtcctgat 1740. attached to the father tctgcaaggt ttatttcaaa ccagaagaac tgctgctgca aaagaactct atgtcaggat taccgaaagt ggaatgcagc ttgaactttg gacatacaac fatherccttc atgggctttg caaaaacaat ctcactgacg aggcacttcg aatgtttcag aatctatgtt tgacggattt acagctggag actaggactt ttaacattat gattggtgcc ttcttaaat gtggaagaat ggatgaagct aaggatttgt ttgcagctct ctcggctaac ggtttagtgc cagatgttag gacctacagt ttaatggcag aaaatcttat agagcagggg ttgctagaag aattggatga tctatttctt tcaatggagg agaatggctg tactgccaac tcccgcatgc taaattccat tgttaggaaa ctgttacaga ggggtgatat aaccagggct 2220 ggcacttacc tgttcatgat tgatgagaag cacttctccc tcgaagcatc cactgcttcc 2280 ttgtttttag atcttttgtc tgggggaaaa tatcaagaat atcataggtt tctccctgaa 2340 aaatataagt cctttataga atctttgagc tgctga 2376 <210> 2 <211> 2113 <212> DNA / RNA <213> Rice (Oryza sativa) <400> 2 tcggtcccgt attttgaatc tgcggaaccg tcgctgtccc gcgtttccgt ttcgcgggat 60 gcgtatattt ttataaaacc tccccatgca tgtatataaa cataaattat tgaaaaaata 120 agtatatttg caaatttttt tcgagagctc agcactacat tgcaaagatt tgggcaactc 180 tgacaatttc catgttctac aagcttgacg tcgagggaat ggagaacctg ccaccgaata 240 gtagccctgc tatctatgtt gcgaaccatc agagtttttt ggatatctat acccttctaa 300 ctctaggaag gtgtttcaag tttataagca agacaagtat atttatgttc cgaattattt 360 gatgggcaat gtatctctta ggagtaattc ctttgcggcg tatggacagc aggagccagc 420 tggtatggct gtagtctcat ccctgctttc ttaagtagac atatatgcaa ttacagaatt 480 tggtaaacaa acaagatttt atgaatcata tatgattttg gggaaaacac caaactctct 540 ttggtggctg ccttgaacat agttctattc acacagttat agcaccttct ttaaaatgaa 600 gaactttgtt gcatacacat atggccaaac cacataatga attttgttta tttctatctt 660 tgaatgttag caccttattt tcatgcatat catgctaatt tgcttgccca cgttgagtgg 720 gaattttttt ccatgtttta taatttatat atgttctaga cttatagtcc acaatttatc 780 tacttcatgt tcctgagcct ctagtatggc tggtagcaga ctaggtgctg agtgctgtcc 840 atttttgcag actgaagaga ggagaaatac aggactgtcc gttgttagtc agatttgtaa 900 aaatagactc tgatgtagtt tattttagcc cctattttat atttaacaat acaaatatat 960 aacgtatcct aagaacttat cgtaatttag gagaagttgc tcgtttcatt aaattaaact 1020 gtgaagtaaa aatgtgtgct cgagtctgtc aatgcaatcc tgtgttcttg tttgaagata 1080 tggtgtaggg caggctagga tcgaacactg aatggtaaga ctgcttctgc cttcatttgt 1140 gcacttggtg ctgccacgcc gattaagcag tagacaag taatttgtc gtgcacaaat 1200 gagttattatt tcattgaaa tcgaagtgaaaatgaaccaa agatagaag aaaagggaa 1260 acttggtaat tatatactcc acatgtacgc tccgtatgaa ataagttcac tttaggtcct 1320 ttaagttgcc tctgaattgt tcccaggccg gccgcactat tgggccaccc cataggccat 1380 gtgtacgctc cgcacagaat aatttcgctt tagctcctt aatttgctcct ctcaacttc 1440 taaaaccagt gcaatcttt aatttt tcaccattg caaccacgg gcatatttgc 1500 tagtgacata taatatgaaa cgaaggatgt agcagactat agaatttaaa ctgtgctttc 1560 attttagagc atcactact gttatttaga ttttattatta aaaatgct gaatgatgt 1620 ttttaatcat gattaattta aaaaaatta aatccaacca ttcatatta ttcacggcg 1680 cgcggtagga aaatgcgcag ctgttgtcgc ttacggtggg agagaaggga cattgtttat 1740 ttccagaact atctttatta actcccatgg aactttaaaa taatataat cattattata 1800 gcattagtttt tttcttgca acggacgggc attttttc agttttccttc tgaacggaaa 1860 tttctgtttt ttttccccca ggagcgccgc gcagaagaga tcgatcgcga tctccctgcc 1920 ccgacgtcgc cggccgatct ctcattctct ccacgccctg ctcgtcgccg atctcctaca 1980 ccatccctgc catctcctcc ttcccctccc ctctatcctc cactggtgcc gcccacctct 2040 ccgtataaga caaactgcgt tgcggcgttg gtttccgccg gcgctgctgc tgcacctgtc 2100 agctagggcg ggc 2113 <210> 3 <211> 582 <212> DNA / RNA <213> Rice (Oryza sativa) <400> 3 agccttttgc agctttgaaa ttctgtgttg gagttctttt ctcctacagt cgtattagag 60 gagggatctt ctctttatgt gtaaatagcg aggtatgtat gtcacctctc cgaattattt 120 ttactctggt tcctagacgg taaacaagca attatgttct gcctttgatg ccagaaaaaa 180 cacaaaagtt tgtcgttatc tctactaacg gatcataaag gaatttgtaa ctggagtttc 240 aaacttaatt tgtctaggca gtagttttgg cattagatcc aacattgtgt aggattcatt 300 tgtgtgtatc attctatagg gtttcattaa atttcgttta tgtgtactgt ttaggtgttg 360 aatagtttga cttgtttttt aactgaacaa aagatactga aatcgttcca ttcaacaaac 420 acatgttccg ttaatgaaat tattatacgt taccttttgt tttcttactc acaagtgtcc 480 tcttttctta tatcctatag attggtacaa caaattattg attcaatttt ggttttgaac 540 attgatgatc ctccctgcac tattggtgca gctgctcttc ta 582 <210> 4 <211> 791 <212> PRT <213> Oryza sativa <400> 4 Met Ala Arg Arg Ala Ala Ser Arg Ala Val Gly Ala Leu Arg Ser Asp 1 5 10 15 Gly Ser Ile Gln Gly Arg Gly Gly Arg Ala Gly Gly Ser Gly Ala Glu 20 25 30 Asp Ala Arg His Val Phe Asp Glu Leu Leu Arg Arg Gly Arg Gly Ala 35 40 45 Ser Ile Tyr Gly Leu Asn Arg Ala Leu Ala Asp Val Ala Arg His Ser 50 55 60 Pro Ala Ala Ala Val Ser Arg Tyr Asn Arg Met Ala Arg Ala Gly Ala 65 70 75 80 Gly Lys Val Thr Pro Thr Val His Thr Tyr Ala Ile Leu Ile Gly Cys 85 90 95 Cys Cys Arg Ala Gly Arg Leu Asp Leu Gly Phe Ala Ala Leu Gly Asn 100 105 110 Val Ile Lys Lys Gly Phe Arg Val Glu Ala Ile Thr Phe Thr Pro Leu 115 120 125 Leu Lys Gly Leu Cys Ala Asp Lys Arg Thr Ser Asp Ala Met Asp Ile 130 135 140 Val Leu Arg Arg Met Thr Glu Leu Gly Cys Ile Pro Asp Val Phe Ser 145 150 155 160 Tyr Asn Ile Leu Leu Lys Gly Leu Cys Asp Glu Asn Arg Ser Gln Glu 165 170 175 Ala Leu Glu Leu Leu His Met Met Ala Asp Asp Arg Gly Gly Gly Ser 180 185 190 Pro Pro Asp Val Val Ser Tyr Thr Thr Val Leu Asn Gly Phe Phe Lys 195 200 205 Glu Gly Asp Ser Asp Lys Ala Tyr Ser Thr Tyr His Glu Met Leu Asp 210 215 220 Arg Gly Ile Leu Pro Asp Val Val Thr Tyr Ser Ser Ile Ile Ala Ala 225 230 235 240 Leu Cys Lys Ala Gln Ala Met Asp Lys Ala Met Glu Val Leu Thr Thr 245 250 255 Met Val Lys Asn Gly Val Met Pro Asp Cys Met Thr Tyr Thr Ser Ile 260 265 270 Met His Gly Tyr Cys Ser Ser Gly Gln Pro Lys Glu Ala Ile Gly Phe 275 280 285 Leu Lys Lys Met Arg Ser Asp Gly Val Glu Pro Asn Val Phe Thr Tyr 290 295 300 Arg Ser Leu Met Asn Tyr Leu Cys Lys Asn Gly Arg Ser Thr Glu Ala 305 310 315 320 Arg Lys Ile Phe Asp Ser Met Thr Lys Arg Gly Leu Glu Pro Asp Ile 325 330 335 Ala Thr Tyr Arg Thr Leu Leu Gln Gly Tyr Ala Thr Lys Gly Ala Leu 340 345 350 Val Glu Met His Ala Leu Leu Asp Leu Met Val Arg Asn Gly Ile Gln 355 360 365 Pro Asp His His Val Phe Asn Ile Leu Ile Cys Ala Tyr Ala Lys Gln 370 375 380 Glu Lys Val Asp Gln Ala Met Leu Val Phe Ser Lys Met Arg Gln His 385 390 395 400 Gly Leu Asn Pro Asn Val Val Thr Tyr Gly Thr Val Ile Asp Val Leu 405 410 415 Cys Lys Ser Gly Ser Val Asp Asp Ala Met Leu Tyr Phe Glu Gln Met 420 425 430 Ile Asp Glu Gly Leu Thr Pro Asn Ile Ile Val Tyr Thr Ser Leu Ile 435 440 445 His Gly Leu Cys Thr Tyr Asp Lys Trp Glu Lys Ala Glu Glu Leu Phe 450 455 460 Phe Lys Met Leu Asp Ser Gly Ile Cys Pro Asn Thr Val Phe Phe Ser 465 470 475 480 Ser Ile Ile Ser Asn Leu Cys Lys Glu Gly Arg Val Ile Glu Ser Glu 485 490 495 Lys Leu Phe Asp Leu Met Val Arg Ile Gly Val Lys Pro Asn Val Ile 500 505 510 Thr Tyr Asn Thr Leu Ile Asp Gly Cys Cys Leu Ala Gly Lys Met Asp 515 520 525 Glu Ala Met Lys Leu Leu Ser Gly Met Val Ser Val Gly Leu Lys Pro 530 535 540 Asn Thr Val Thr Tyr Ser Thr Leu Ile Asn Gly Tyr Cys Lys Ile Ser 545 550 555 560 Arg Met Glu Asp Ala Leu Val Leu Phe Lys Glu Met Glu Ser Ser Gly 565 570 575 Val Ser Pro Asp Ile Ile Thr Tyr Asn Ile Ile Leu Gln Gly Leu Phe 580 585 590 Gln Thr Arg Arg Thr Ala Ala Ala Lys Glu Leu Tyr Val Arg Ile Thr 595 600 605 Glu Ser Gly Met Gln Leu Glu Leu Trp Thr Tyr Asn Ile Ile Leu His 610 615 620 Gly Leu Cys Lys Asn Asn Leu Thr Asp Glu Ala Leu Arg Met Phe Gln 625 630 635 640 Asn Leu Cys Leu Thr Asp Leu Gln Leu Glu Thr Arg Thr Phe Asn Ile 645 650 655 Met Ile Gly Ala Leu Leu Lys Cys Gly Arg Met Asp Glu Ala Lys Asp 660 665 670 Leu Phe Ala Ala Leu Ser Ala Asn Gly Leu Val Pro Asp Val Arg Thr 675 680 685 Tyr Ser Leu Met Ala Glu Asn Leu Ile Glu Gln Gly Leu Leu Glu Glu 690 695 700 Leu Asp Asp Leu Phe Leu Ser Met Glu Glu Asn Gly Cys Thr Ala Asn 705 710 715 720 Ser Arg Met Leu Asn Ser Ile Val Arg Lys Leu Leu Gln Arg Gly Asp 725 730 735 Ile Thr Arg Ala Gly Thr Tyr Leu Phe Met Ile Asp Glu Lys His Phe 740 745 750 Ser Leu Glu Ala Ser Thr Ala Ser Leu Phe Leu Asp Leu Leu Ser Gly 755 760 765 Gly Lys Tyr Gln Glu Tyr His Arg Phe Leu Pro Glu Lys Tyr Lys Ser 770 775 780 Phe Ile Glu Ser Leu Ser Cys 785 790 <210> 5 <211> 41 <212> DNA / RNA <213> Artificial Sequence <400> 5 gagctcggta cccggggatc ctcggtcccg tattttgaat c 41 <210> 6 <211> 41 <212> DNA / RNA <213> Artificial Sequence <400> 6 gccaagcttg catgcctgca gtagaagagc agctgcacca a 41 <210> 7 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 7 gatgtacttt gcaagtcagg 20 <210> 8 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 8 ccttctttgc aaagattgct 20
Claims
1. A novel cytoplasmic male sterility restoration gene in rice RFFA It consists of the nucleotide sequence shown in SEQ ID NO:
1.
2. A novel cytoplasmic male sterility restoration gene in rice RFFA It consists of the nucleotide sequences shown in SEQ ID NO: 1, 2 and 3.
3. A protein derived from the novel rice cytoplasmic male sterility restoration gene of claim 1. RFFA coding.
4. The protein of claim 3, wherein it comprises the amino acid sequence shown in SEQ ID NO:
4.
5. An expression vector comprising the novel rice plasmonic cytoplasmic male sterility restoration gene as described in claim 1 or 2. RFFA .
6. A method for creating rice restorer lines, comprising using the novel rice plasmonic cytoplasmic male sterility restorer gene as described in claim 1 or 2. RFFA Or the expression vector described in claim 5 may be introduced into rice varieties.
7. The method of claim 6, wherein the introduction is performed via gene editing.
8. The method of claim 7, wherein the gene editing is performed by one or more sequence-specific nucleases selected from the following: CRISPR / Cas9, CRISPR / Cas12a, TALEN, a wide range of nucleases, and ZFN.
9. Methods for restoring fertility to new cytoplasmic male sterile lines of rice, including: The rice novel cytoplasmic male sterility restoration gene as described in claim 1 or 2 RFFA Or the expression vector described in claim 5 may be introduced into rice varieties to produce transgenic restorer lines; and The transgenic restorer line is crossed with the new rice cytoplasmic male sterile line to produce hybrid seeds with normal fertility.
10. The method of claim 9, wherein the introduction is performed via gene editing.
11. The method of claim 10, wherein the gene editing is performed by one or more sequence-specific nucleases selected from the group consisting of CRISPR / Cas9, CRISPR / Cas12a, TALEN, a wide range of nucleases, and ZFN.
12. The novel rice cytoplasmic male sterility restoration gene according to claim 1 or 2 RFFA Or the use of the expression vector as described in claim 5 in rice breeding or the creation of rice restorer lines or the restoration of fertility in rice cytoplasmic male sterile lines.
Citation Information
Patent Citations
Rice whole genome SNP chip and application thereof
CN102747138A
Rice protection cytoplasmic male sterile line and recovery line directive breeding method
CN1954666B
Cytoplasmic male sterility restorer gene in rice and application thereof
CN103865937A