Bifidobacterium breve strain for alleviating psoriasis and use thereof
By using Bifidobacterium breve CCFM683 to prepare lyophilized powder, the problems of large side effects and potential risks in existing psoriasis treatments have been solved, achieving safe and effective skin pathological improvement and immune regulation effects.
Patent Information
- Application Number
- CN202211374083.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-03
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2042-11-03
AI Technical Summary
Existing treatments for psoriasis have significant side effects, potential carcinogenicity, and adverse reactions. Furthermore, traditional medications such as vitamin D3 derivatives and retinoids may cause skin atrophy, pigmentation, and liver toxicity. Therefore, it is particularly important to find safer and more effective alternative treatment options.
The lyophilized powder was prepared using Bifidobacterium breve CCFM683. It reduced the area of psoriatic lesions, alleviated skin tissue damage, downregulated the levels of pro-inflammatory cytokines and nuclear transcription factors, reduced the number of inflammatory cells, and regulated the immune response. The preparation method included culturing in MRS medium, centrifugation, washing, and vacuum freeze-drying.
It significantly reduces the area and severity index of psoriasis lesions, reduces weight loss, alleviates skin tissue damage, downregulates the expression of keratin and pro-inflammatory cytokines, improves skin tissue inflammation, and provides a safe alternative treatment option.
Smart Images

Figure CN115708835B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a strain of Bifidobacterium breve which can relieve psoriasis and its application, which can be added to various health foods and health foods, belonging to the field of microbial technology. BACKGROUND
[0002] Psoriasis is a chronic skin disease mediated by immunity, and its main features are excessive proliferation of keratinocytes, dilation of blood vessels in the dermis, and inflammatory infiltration of leukocytes. Among them, the most common type is psoriasis vulgaris, accounting for 90% of all cases, and the common symptoms are skin itching, red patches, dryness, scales, and even rupture and bleeding.
[0003] The cause of psoriasis is still unclear, and it is currently believed to be the result of the interaction of external pathogen infection, genetic factors and immune effects.
[0004] Psoriasis vulgaris can occur anywhere on the body, and the most common sites are the extensor sides of the limbs, especially the sacrococcygeal region, elbows and knees, and the affected skin usually shows symmetry. All types of psoriasis are accompanied by common symptoms such as itching, acid pain and burning, and other types of psoriasis have more severe symptoms on the basis of psoriasis vulgaris.
[0005] Psoriasis directly affects the physical health and quality of life of patients, leading to changes in social life and psychological state. Choosing the right treatment method is crucial to improving the quality of life of patients with psoriasis. There are more and more studies on the use of drugs for routine treatment, aiming to reduce epidermal proliferation and inflammatory symptoms. The commonly used treatment drugs are: vitamin D3 derivatives such as tacalcitol, calcipotriol and calcitriol; retinoid drugs such as tazarotene and adapalene, however, the use of the above drugs may cause skin atrophy, pigmentation, liver toxicity and other symptoms, and there is a potential carcinogenicity, thereby affecting the success of treatment.
[0006] Due to the many problems existing in the current treatment regimen, it is particularly important to replace the traditional method of relieving psoriasis, and new treatment regimens include monoclonal antibodies, prebiotics, probiotics, and some microbial metabolites such as unsaturated fatty acids and short-chain fatty acids. The feasibility of the above-mentioned therapies also prompts us to continue to search for dietary supplements that are more widely used, have greater potential, and have the effect of relieving psoriasis. SUMMARY
[0007] The application provides application of Bifidobacterium breve CCFM683 in preparation of a medicine for preventing and treating psoriasis, the Bifidobacterium breve CCFM683 has been preserved in the China General Microbiological Culture Collection Center on December 4, 2015, and the preservation number is CGMCC No. 11828, and is disclosed in a patent application document with the publication number CN106038611A.
[0008] In an embodiment, the psoriasis is psoriasis vulgaris.
[0009] In an embodiment, the medicine has at least one of the following effects:
[0010] (1) reducing the psoriasis lesion area of a psoriasis individual, and reducing the damage of skin tissue;
[0011] (2) reducing the weight loss of a psoriasis individual;
[0012] (3) down-regulating the mRNA level of keratin k16, IvI and Lor, and down-regulating the expression amount of keratin k17 and proliferating cell nuclear antigen PCNA protein;
[0013] (4) reducing the keratinization degree of the epidermis layer of skin tissue;
[0014] (5) down-regulating the concentration of proinflammatory cytokines IL-17, TNF-α, IL-1β and IL-6;
[0015] (6) down-regulating the mRNA level of nuclear transcription factor NF-κB p65;
[0016] (7) reducing the number of inflammatory cells in the epidermis layer and the dermis layer of skin tissue.
[0017] In an embodiment, in the medicine, the viable bacterial count of the Bifidobacterium breve is not less than 2×10 9 CFU / mL or 2×10 9 CFU / g.
[0018] In an embodiment, the medicine is a freeze-dried powder.
[0019] In an embodiment, the preparation method of the freeze-dried powder is as follows: inoculating the Bifidobacterium breve CCFM683 into a culture medium to culture, to obtain a seed liquid; inoculating the seed liquid into the culture medium to culture, to obtain a culture liquid; centrifuging the culture liquid to collect bacterial slurry; washing the bacterial slurry with normal saline and resuspending to obtain a resuspension liquid; adding a freeze-drying protective agent to the resuspension liquid to obtain a mixed liquid; vacuum freeze-drying the mixed liquid to obtain the freeze-dried powder.
[0020] In an embodiment, the seed liquid is inoculated into the culture medium at an inoculation amount of 2-4% (v / v) for culture.
[0021] In an embodiment, the components of the freeze-drying protective agent include skimmed milk powder, trehalose, sucrose and water.
[0022] In an embodiment, the components of the freeze-drying protective agent are 80-120 g / L skimmed milk powder, 80-140 g / L trehalose, 140-180 g / L sucrose and water.
[0023] In an embodiment, the components of the freeze-drying protective agent include 100 g / L skimmed milk powder, 100 g / L trehalose, 160 g / L sucrose and water.
[0024] In an embodiment, the freeze-drying protective agent is added in the resuspension liquid at an amount of 2-4 times the total weight of the bacterial slurry.
[0025] In an embodiment, the seed culture medium is MRS solid medium and the fermentation culture medium is MRS liquid medium.
[0026] In an embodiment, the MRS liquid medium is MRS liquid medium added with cysteine hydrochloride.
[0027] In an embodiment, the cysteine hydrochloride is added at a mass fraction of 0.04-0.1%.
[0028] In an embodiment, the seed liquid is inoculated into the MRS liquid medium at an inoculation amount of 2-4% for culture under the following conditions: anaerobic culture at 34-38°C for 24-36 h, centrifugation at 7000-12000 rpm for 20-30 min, collection of the bacterial slurry, washing with normal saline for 3-4 times and resuspension.
[0029] The present application also provides a medicine for preventing and / or treating psoriasis, wherein the medicine contains the above-mentioned Bifidobacterium breve CCFM683.
[0030] In an embodiment, the number of viable Bifidobacterium breve CCFM683 in the product is not less than 2x10 9 CFU / g.
[0031] Beneficial effects
[0032] (1) The Bifidobacterium breve CCFM683 provided by the present application is isolated from the intestinal flora of a healthy person, and has no toxic side effects on the human body, so the medicine prepared from the Bifidobacterium breve CCFM683 has certain advantages compared with traditional medicines for treating psoriasis, and the strain can be used to make probiotic preparations and the like, and has a broad market prospect.
[0033] (2) The Bifidobacterium breve CCFM683 provided by the present application can significantly reduce the psoriasis lesion area and severity index of psoriasis mice, and reduce the loss of body weight.
[0034] (3) Compared with the model group mice, the skin tissue damage of the Bifidobacterium breve CCFM683 intervention group mice is significantly reduced, and the histopathological score is significantly reduced.
[0035] (4) The Bifidobacterium breve CCFM683 intervention significantly down-regulates the mRNA level of keratin k16, down-regulates the mRNA level of keratin layer structure protein IvI and Lor, and down-regulates the expression amount of keratin k17 and proliferating cell nuclear antigen PCNA protein. The observation results of the skin pathological section also show that the keratinization degree of the epidermis layer of the skin tissue of the Bifidobacterium breve CCFM683 intervention group mice is significantly reduced.
[0036] (5) The Bifidobacterium breve CCFM683 intervention significantly down-regulates the concentration of pro-inflammatory cytokines IL-17, TNF-α, IL-1β, IL-6 and IFN-γ, and down-regulates the mRNA level of nuclear transcription factor NF-κB p65. The observation results of the skin pathological section also show that the number of inflammatory cells in the epidermis layer and the dermis layer of the skin tissue of the Bifidobacterium breve CCFM683 intervention group mice is significantly reduced. BRIEF DESCRIPTION OF DRAWINGS
[0037] Figure 1 : Psoriasis-like skin lesions of mice in different groups.
[0038] Figure 2 : Psoriasis lesion area and severity index PASI of mice in different groups.
[0039] Figure 3 : Body weight change of mice in different groups.
[0040] Figure 4 HE staining of skin tissue of different groups of mice.
[0041] Figure 5 Pathological score of skin tissue of different groups of mice.
[0042] Figure 6 Expression amount of k16 mRNA of skin tissue of different groups of mice.
[0043] Figure 7 Expression amount of IvI mRNA of skin tissue of different groups of mice.
[0044] Figure 8 Expression amount of k17 protein of skin tissue of different groups of mice.
[0045] Figure 9 Expression amount of PCNA protein of skin tissue of different groups of mice.
[0046] Figure 10 Expression amount of IL-17 protein of skin tissue of different groups of mice.
[0047] Figure 11 Expression amount of TNF-α protein of skin tissue of different groups of mice.
[0048] Figure 12 Expression amount of IL-1β protein in skin tissue of different groups of mice.
[0049] Figure 13 Expression amount of IL-6 protein of skin tissue of different groups of mice.
[0050] Figure 14 Expression amount of NF-κB p65 mRNA of skin tissue of different groups of mice.
[0051] Figures 1-14 In the table, “*”, “**”, “***”, “****” all represent significant difference with the IMQ group, and the more the asterisks, the greater the significant difference. DETAILED DESCRIPTION
[0052] The present application will be further described below in conjunction with specific examples and the accompanying drawings.
[0053] The mice involved in the following examples are 6-week-old female SPF (Specific pathogen free) level BALB / C mice purchased from Zhejiang Vito Lihua Company; the imiquimod cream involved in the following examples is purchased from 3M Health Care; the IL-17, TNF-α, IL-1β, IL-6, ELISA kit involved in the following examples is purchased from R&D Systems; the skimmed milk powder, trehalose, sucrose, paraformaldehyde involved in the following examples are purchased from National Pharmaceutical Group Chemical Reagent Co., Ltd.
[0054] The Bifidobacterium breve CCFM1078 used in the following examples was deposited in the Guangdong Microbial Culture Collection Center on May 6, 2020, with the accession number GDMCC No: 61011, and disclosed in the patent with publication number CN112111424B; the Bifidobacterium breve CCFM1025 was deposited in the Guangdong Microbial Culture Collection Center on June 11, 2018, with the accession number GDMCC No: 60386, and disclosed in the patent with publication number CN108949640B.
[0055] The culture medium involved in the following examples is as follows:
[0056] MRS liquid medium: tryptone 10 g / L, beef extract 10 g / L, yeast powder 5 g / L, glucose 20 g / L, anhydrous sodium acetate 2 g / L, magnesium sulfate heptahydrate 0.5 g / L, manganese sulfate monohydrate 0.25 g / L, diammonium hydrogen citrate 2 g / L, dipotassium hydrogen phosphate trihydrate 2.6 g / L, Tween 80 1 mL / L, cysteine hydrochloride 0.5 g / L.
[0057] MRS solid medium: tryptone 10 g / L, beef extract 10 g / L, yeast powder 5 g / L, glucose 20 g / L, anhydrous sodium acetate 2 g / L, magnesium sulfate heptahydrate 0.5 g / L, manganese sulfate monohydrate 0.25 g / L, diammonium hydrogen citrate 2 g / L, dipotassium hydrogen phosphate trihydrate 2.6 g / L, Tween 80 1 mL / L, cysteine hydrochloride 0.5 g / L, agar 20 g / L.
[0058] The detection method involved in the following examples is as follows:
[0059] The detection method of Psoriasis Area and Severity Index (PASI) is as follows:
[0060] The PASI score system includes three aspects of erythema, desquamation and lesion area. During the modeling, the erythema, desquamation and lesion area of the back skin of the mice were observed every day, and were scored from 0 to 4 (0 for "none", 1 for "mild", 2 for "moderate", 3 for "significant", and 4 for "very significant"), and the PASI was the sum of the scores of the three aspects, i.e. PASI = erythema score + desquamation score + lesion area score.
[0061] Method for detecting skin histopathological features:
[0062] A 2mm x 2mm skin sample was cut from the lesioned skin of the back about 1cm from the tail end, and was immersed in 4% paraformaldehyde fixing solution at 4°C for 24h to obtain the fixed skin tissue; the fixed skin tissue was sequentially dehydrated, transparentized and wax-embedded, and was embedded in a wax block using a Leica paraffin embedding machine to obtain a wax block of the embedded skin tissue; the specific steps of the dehydration, transparentization and wax-embedding were as follows: (1) dehydration: the fixed tissue was sequentially dehydrated in 70%, 80% and 90% (v / v) gradient ethanol solutions for 30min each, and was then placed in 95% and 100% (v / v) alcohol solutions for 20min each; (2) transparentization: the tissue was first placed in an equal volume mixture of alcohol and xylene for 15min, and was then placed in xylene I and xylene II for 3min each; (3) wax-embedding: the tissue sample was placed in 62°C paraffin I and paraffin II liquids for 30min each.
[0063] The wax block embedded with the skin tissue is sliced by a Leica manual rotary microtome to obtain skin tissue sections with a thickness of 5 μm; the skin tissue sections are subjected to spreading and fishing, baking, hematoxylin staining, differentiation, rinsing, eosin re-staining, dehydration, transparency, and mounting to obtain H&E skin sections; wherein, the specific operations of spreading and fishing, baking, hematoxylin staining, differentiation, rinsing, eosin re-staining, dehydration, transparency, and mounting are as follows: (1) spreading and fishing: the sections are placed in a 42 °C constant temperature water bath for spreading and then carefully fished out with a glass slide; (2) baking: the sections are placed in a 65 °C oven for baking for 1 h; (3) hematoxylin staining: the sections are first hydrated (i.e., the sections are first placed in xylene I and xylene II for 5 min, and then placed in 100%, 95%, 90%, 80%, and 70% (v / v) gradient alcohol solutions for 5 min, and finally placed in distilled water for 3 min), then stained (i.e., the sections are placed in a hematoxylin staining solution for about 20 s), and finally washed with water (i.e., the sections are washed with tap water for about 30 min); (4) differentiation: the sections are placed in a 1% (v / v) hydrochloric acid ethanol solution for 7 s for decolorization; (5) rinsing: the sections are washed with tap water for about 20 min; (6) re-staining: the sections are immersed in an eosin staining solution and immediately taken out; (7) dehydration: the sections are first placed in 95% (v / v) ethanol solution I, 95% (v / v) ethanol solution II, and 70% (v / v) ethanol solution, and immediately taken out after being placed, then immersed in 80% (v / v) ethanol solution for 50 s, and finally immersed in 100% (v / v) ethanol for 2 min; (8) transparency: the sections are first immersed in an equal volume mixture of ethanol and xylene for 1 min, and then immersed in xylene I and xylene II for 2 min each; (9) mounting: the sections are mounted with neutral balsam.
[0064] The prepared H&E skin sections are scanned by a Pannoramic MIDI digital section scanner, photographed, and the skin tissue sections of each group are scored for tissue damage, which includes cell hypertrophy, keratinization, inflammatory cell infiltration, and lesion range (see Table 1 for specific criteria).
[0065] Table 1 Tissue damage scoring criteria
[0066]
[0067]
[0068] Determination of biochemical indicators of skin tissue:
[0069] Skin tissues were added with tissue lysis buffer (containing 1% (v / v) protease inhibitor and 1% (v / v) phosphatase inhibitor) at 1:9, and the skin tissues were broken by a high-throughput crusher to obtain homogenate, then centrifuged at 12000g, 4℃ for 15 min, and the supernatant was collected to obtain skin tissue supernatant; the activity of interleukin-17 (IL-17), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6) in the skin tissue supernatant was detected by an ELISA kit, and the unit was ng / mg skin protein. The concentration of total protein in the skin tissue supernatant was measured by a BCA kit (Bi Yun Tian Biotechnology Co., Ltd.), and the unit was μg / ml.
[0070] Determination of the expression amount of the target gene mRNA in skin tissues:
[0071] The transcription level of the target gene in skin tissues was detected by RT-qPCR. Total RNA of skin samples was extracted by TRIzol (purchased from Invitrogen, USA), 1 μg of RNA was reversely transcribed according to the instructions of PrimeScript TM 1st Strand cDNA Synthesis Kit, and the real-time fluorescence quantitative system was prepared according to the instructions of iTaq TM Universal SYBR Green Supermix, and real-time fluorescence quantitative PCR analysis was performed by Bio-Rad CFX Connect TM Real-time System, and the quality of RT-qPCR data was evaluated by melting curve and amplification curve. The qPCR program was as follows: 50℃ for 2 min; 95℃ for 10 min; 40 cycles (95℃ for 15 s, 60℃ for 30 s); 95℃ for 15 s, the primer sequences of the detected genes were shown in Table 2, and the data were analyzed by 2 -ΔΔCt method.
[0072] Table 2 RT-qPCR primer sequences
[0073] Gene Forward primer (5'→ 3') Reverse primer (5'→ 3') k16 GGTGGCCTCTAACAGTGATCT TGCATACAGTATCTGCCTTTGG Ivl ATGTCCCATCAACACACACTG TGGAGTTGGTTGCTTTGCTTG NF-κB p65 AGGCTTCTGGGCCTTATGTG TGCTTCTCTCGCCAGGAATAC β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT
[0074] Example 1: Preparation of Bifidobacterium breve CCFM683 bacterial suspension
[0075] The preparation method of Bifidobacterium breve CCFM683 bacterial solution was as follows:
[0076] (1) From the glycerol tube, Bifidobacterium breve CCFM683 bacterial liquid was streaked on MRS solid medium, and incubated at 37°C for 48h in an anaerobic environment to obtain single colonies; a single colony was picked and inoculated in MRS liquid medium, and incubated at 37°C for 48h in an anaerobic environment for activation culture, and the operation was repeated for 3 times to obtain the activated bacterial liquid.
[0077] (2) The activated bacterial liquid obtained in step (1) was inoculated into MRS liquid medium at an inoculation amount of 2% (v / v), and after 24h of incubation at 37°C, a fermentation liquid was obtained; the fermentation liquid was centrifuged to collect the bacterial cells, the bacterial cells were resuspended with normal saline, and the viable cell count was adjusted to 2×10 9 CFU / mL to prepare a bacterial suspension.
[0078] Example 2: Bifidobacterium breve CCFM683 alleviates the symptoms of IMQ-induced psoriasis mice
[0079] The preparation method of the bacterial suspension refers to Example 1, and the steps of the animal experiment are as follows:
[0080] (1) 48 healthy 6-week-old female Balb / c mice were randomly divided into 6 groups, and the 6 groups were named as: blank group, model group (IMQ group), positive drug methotrexate intervention group (methotrexate group), Bifidobacterium breve CCFM1078 intervention group (CCFM1078 group), Bifidobacterium breve CCFM683 intervention group (CCFM683 group), and Bifidobacterium breve (CCFM1025 intervention group (CCFM1025 group); 8 mice in each group, and the experimental scheme and the treatment method of each group of mice are shown in Table 3.
[0081] (2) The blank group, IMQ group, methotrexate group, CCFM1078 group, CCFM683 group and CCFM1025 group were treated as follows:
[0082] The treatment method of the CCFM1078 group, CCFM683 group and CCFM1025 group is as follows: from the 1st to the 21st day of the experiment, the mice were given 2×10 9 CFU / mL of the corresponding bacterial suspension 200μL, and on the 14th day, the mouse back hair was removed with a hair remover, with an area of about 2cm×2cm; from the 15th to the 21st day of the experiment, 62.5mg of 5% imiquimod cream (Imiquimod, IMQ) was applied to the back of the mouse every day;
[0083] The treatment method of the IMQ group is as follows: from the 1st to the 21st day of the experiment, the IMQ group was given 200μL of normal saline by gavage every day, and on the 14th day, the mouse back hair was removed with a hair remover, with an area of about 2cm×2cm; from the 15th to the 21st day of the experiment, 62.5mg of 5% imiquimod cream was applied to the back of the mouse every day;
[0084] The treatment method of the blank group is: from the 1st to the 21st day of the experiment, the blank control group is given 200 μL of physiological saline by gavage every day, and on the 14th day, the mice are shaved on the back with an area of about 2 cm x 2 cm; from the 15th to the 21st day of the experiment, 62.5 mg of vaseline is applied to the back of the mice every day.
[0085] Table 3 Treatment scheme of experimental mice
[0086]
[0087]
[0088] After the modeling is completed, the mice in each group are sacrificed, and the appearance of the back skin is observed, and the damaged back skin is taken.
[0089] The back skin of the IMQ group of mice is thickened, white scales and erythema are formed, which is consistent with the pathological characteristics of psoriasis; the back skin thickness of the CCFM683 group, the methotrexate group and the CCFM1078 group is reduced, and the scales and erythema are significantly reduced; the CCFM1025 group is close to the IMQ group, and the pathological characteristics are not significantly improved. Figure 1
[0090] At the end of the modeling, the PASI of the IMQ group of mice increased to 8.38; the intervention of Bifidobacterium breve CCFM683 reduced the PASI of the mice to 6.375, which was significantly improved compared with the IMQ group; the PASI of the methotrexate group and the CCFM1078 group was reduced to 5.75 and 6.50, respectively; and the PASI of the CCFM1025 group was 8.125, close to the IMQ group. Figure 2
[0091] At the end of the modeling, the body weight of the IMQ mice decreased to 94.3% of the body weight before modeling, while the body weight of the CCFM683 group decreased to only 98.6% of the body weight before modeling, which was significantly improved compared with the IMQ group; the body weight of the methotrexate group of mice was further reduced compared with the IMQ group, only 87.8% of the body weight before modeling; the body weight of the CCFM1078 group and the CCFM1025 group of mice was close to the IMQ group, which was 96.7% and 94.1% of the body weight before modeling, respectively. Figure 3
[0092] Example 3: Protective effect of Bifidobacterium breve CCFM683 on skin tissue of psoriasis mice
[0093] The specific implementation method is the same as steps (1)-(2) in Example 2;
[0094] The mice were sacrificed after the end of modeling in step (2) in Example 2, and a 2mm x 2mm skin sample at the back of the mice 1cm from the tail end was fixed, dehydrated, embedded, HE stained, and observed for skin tissue HE staining of the mice in different groups.
[0095] By Figure 4 It can be seen that after IMQ induction, the mouse skin tissue has obvious damage, including keratinization of the epidermis, thickening of the spinous layer, and scattered distribution of capillaries, neutrophil infiltration in the dermis, and destruction of collagen fibers. Therefore, the skin structure of the IMQ group is destroyed, the inflammatory cell infiltration is severe, the keratinocytes abnormally proliferate and differentiate, and the capillaries proliferate. The methotrexate group and the CCFM683 group only have mild keratinization, thin spinous layer, and fewer neutrophils in the dermis. The CCFM1078 group and the CCFM1025 group of mice are similar to the IMQ group and fail to significantly improve the damage to the skin tissue.
[0096] The histopathological scoring standard is referred to the related literature (specifically, the paper "Bovine milk fat enriched in conjugated linoleic and vaccenic acids attenuates allergic dermatitis in mice" published in 2011).
[0097] The histopathological score shows that the pathological score of the IMQ group reaches 5.875 points; while the scores of the methotrexate group and the CCFM683 group are significantly lower than those of the modeling group, both being 4.375 points; the CCFM1078 group and the CCFM1025 group are 4.875 points and 6.125 points, respectively, which have no significant difference with the IMQ group Figure 5 ). Therefore, the strain Bifidobacterium breve CCFM683 has a good protective effect on the skin tissue of mice, and the effect is better than that of Bifidobacterium breve CCFM1078.
[0098] Example 4: Effect of Bifidobacterium breve CCFM683 on keratinocyte proliferation in psoriasis mice
[0099] The specific implementation is the same as steps (1)-(2) in Example 2;
[0100] The mice were sacrificed after the end of modeling in step (2) in Example 2, and the skin tissue of the back was taken, and the mRNA level of the keratin layer structure protein was detected by RT-qPCR method, including the mRNA level of keratin 16 (k16) and involucrin (Ivl).
[0101] By Figures 6-7It was found that the mRNA levels of k16 and IVl in the skin of mice in the IMQ group increased to 11.53 times and 5.28 times that of the control group, respectively. Compared with the IMQ group, interventions with Bifidobacterium breve CCFM683, the positive drug methotrexate, and Bifidobacterium breve CCFM1078 significantly reduced the mRNA levels of the two keratinocyte structural proteins. Intervention with Bifidobacterium breve CCFM1025 significantly reduced the expression of IVl, but had no significant effect on k16.
[0102] Immunoblot assay was used to detect keratin 17 (k17) in skin tissue. Figure 8 ) and proliferating nuclear antigen PCNA ( Figure 9 The expression level of ) (for specific methods, refer to the 2022 paper "A multifunctional composite hydrogel asan intrinsic and extrinsic coregulator for enhanced therapeutic efficacy for psoriasis").
[0103] Immunoblotting results showed that IMQ treatment significantly increased the relative expression levels of k17 and PCNA proteins in mouse skin tissue, while interventions with Bifidobacterium breve CCFM683, methotrexate, and Bifidobacterium breve CCFM1078 all significantly downregulated the expression of both proteins. Therefore, intervention with Bifidobacterium breve CCFM683 can significantly inhibit the proliferation of keratinocytes in skin tissue.
[0104] Example 5: The regulatory effect of Bifidobacterium breve CCFM683 on the immunity of psoriatic mice
[0105] The specific implementation method is the same as steps (1)-(2) in Example 2;
[0106] After the modeling process in step (2) of Example 2 was completed, the mice were sacrificed, and the skin tissue on the back was taken to detect the biochemical indicators in the skin tissue supernatant according to the skin tissue biochemical index determination method, including the expression levels of IL-17, TNF-α, IL-1β and IL-6 in the skin tissue.
[0107] Depend on Figures 10-13It was found that IMQ treatment significantly increased the concentrations of IL-17, TNF-α, IL-1β, and IL-6 in skin tissue, reaching 1.710 ng / mg protein, 0.3558 ng / mg protein, 0.9344 ng / mg protein, and 0.5193 ng / mg protein, respectively. Compared with the IMQ group, intervention with Bifidobacterium breve CCFM683 significantly reduced the upregulation of these four pro-inflammatory cytokines, with concentrations of 1.001 ng / mg protein, 0.2425 ng / mg protein, and 0.8389 ng / mg protein, respectively. The levels of IL-17 and TNF-α were 0.3663 ng / mg protein and 0.3663 ng / mg protein, respectively. Methotrexate intervention failed to reduce the upregulation of these four pro-inflammatory factors, and their expression levels were not significantly different from those in the IMQ group. Intervention with Bifidobacterium breve CCFM1078 significantly reduced the concentrations of IL-17 and TNF-α to 1.126 ng / mg protein and 0.2613 ng / mg protein, respectively, without significantly affecting other cytokines. Intervention with Bifidobacterium breve CCFM1025 resulted in expression levels of the four cytokines that were similar to those in the IMQ group, and did not affect the expression of inflammatory factors in mouse skin tissue.
[0108] The mRNA level of nuclear transcription factor NF-κB p65 was detected by RT-qPCR, and the results showed that ( Figure 14 IMQ treatment significantly upregulated NF-κB p65 mRNA levels, while intervention with Bifidobacterium breve CCFM683 significantly inhibited this upregulation. Methotrexate, Bifidobacterium breve CCFM1078, and Bifidobacterium breve CCFM1025 failed to inhibit NF-κB p65 upregulation, and their expression levels were not significantly different from the IMQ group. Therefore, intervention with Bifidobacterium breve CCFM683 significantly improved the skin's immune response, and the improvement effect was superior to that of the positive control drugs methotrexate and Bifidobacterium breve CCFM1078.
[0109] Example 6: Preparation of lyophilized formulation of Bifidobacterium breve CCFM683
[0110] The specific steps are as follows:
[0111] (1) Activation of the strain: Take the bacterial solution of Bifidobacterium breve CCFM683 from the glycerol tube and streak it on MRS solid medium. Incubate at 37℃ for 48h under anaerobic conditions to obtain single colonies. Pick a single colony and inoculate it into MRS liquid medium. Incubate at 37℃ for 48h under anaerobic conditions for activation culture. Repeat this operation 3 times to obtain the activated bacterial solution.
[0112] (2) The bacterial culture obtained in step (1) was inoculated into MRS liquid medium at an inoculation rate of 3%, and anaerobic cultured at 37℃ for 28 h to obtain fermentation broth. The obtained fermentation broth was centrifuged at 10000 rpm for 20 min and the bacterial sludge was collected. The bacterial sludge was washed 3 times with physiological saline and then used for later use. The viable cell count was adjusted to 1×10⁻⁶. 11 CFU / mL.
[0113] (3) Preparation of freeze-drying protective agent: 100 g / L skimmed milk powder, 100 g / L trehalose, 160 g / L sucrose and the rest of water are mixed to obtain the freeze-drying protective agent.
[0114] (4) The freeze-drying protective agent prepared above is added to the bacterial slurry obtained in step (2), wherein the weight of the freeze-drying protective agent is 3 times the weight of the bacterial slurry, and then mixed uniformly, followed by vacuum freeze-drying, and finally the freeze-dried preparation is vacuum packaged.
[0115] According to the verification method of examples 2-5, the results show that the freeze-dried powder containing Bifidobacterium breve CCFM683 can also significantly reduce the psoriasis lesion area and severity index of psoriasis mice, reduce body weight loss, reduce skin tissue damage, reduce histopathological score, and can significantly down-regulate the mRNA level of keratin k16 and Ivl, down-regulate the expression amount of keratin k17 and proliferating cell nuclear antigen PCNA protein, reduce the degree of keratinization of the epidermis layer of the skin tissue, and can down-regulate the concentration of pro-inflammatory cytokines IL-17, TNF-α, IL-1β and IL-6, down-regulate the mRNA level of nuclear transcription factor NF-κB p65, reduce the number of inflammatory cells in the epidermis layer and dermis layer of the skin tissue, and has the effect of relieving the symptoms of psoriasis.
[0116] Although the present application has been disclosed with the preferred embodiments as above, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, therefore the protection scope of the present application should be defined by the claims.
Claims
1. The use of Bifidobacterium breve CCFM683 in the preparation of drugs for the prevention and / or treatment of psoriasis, characterized in that, The preservation number of the Bifidobacterium breve CCFM683 is CGMCC No.11828.
2. The application as described in claim 1, characterized in that, The psoriasis mentioned is common psoriasis.
3. The application as described in claim 1, characterized in that, The viable count of Bifidobacterium breve CCFM683 in the drug is not less than 2 × 10⁻⁶. 9 CFU / g or 2×10 9 CFU / mL.
4. The application as described in claim 2, characterized in that, The viable count of Bifidobacterium breve CCFM683 in the drug is not less than 2 × 10⁻⁶. 9 CFU / g or 2×10 9 CFU / mL.
5. The application as described in any one of claims 1 to 4, characterized in that, The drug has at least one of the following effects: (1) Reduce the area of psoriatic lesions in individuals with psoriasis and alleviate skin tissue damage; (2) Reduce weight loss in individuals with psoriasis; (3) Downregulate the mRNA levels of keratin K16 and IVL, and downregulate the expression levels of keratin K17 and proliferating nuclear antigen PCNA protein; (4) Reduce the degree of keratinization in the epidermal layer of skin tissue; (5) Downregulates the concentrations of pro-inflammatory cytokines IL-17, TNF-α, IL-1β, IL-6 and IFN-γ; (6) Downregulates the mRNA level of nuclear transcription factor NF-κB p65; (7) Reduce the number of inflammatory cells in the epidermis and dermis of the skin tissue.
6. The application as described in any one of claims 1 to 4, characterized in that, The drug is a lyophilized powder containing Bifidobacterium breve CCFM683.
7. The application as described in claim 6, characterized in that, The method for preparing the freeze-dried powder is as follows: inoculate the Bifidobacterium breve CCFM683 into a culture medium and culture it, and collect the cell culture medium; then centrifuge the cell culture medium and collect the bacterial sludge; then mix the bacterial sludge with a freeze-drying protectant to prepare freeze-dried powder.
8. The application as described in claim 7, characterized in that, The freeze-drying protectant contains 80–120 g / L skim milk powder, 80–140 g / L trehalose, 140–180 g / L sucrose, and water.
9. The use of *Bifidobacterium breve* as described in claim 7 or 8 in the preparation of products for the prevention and / or treatment of psoriasis, characterized in that, The amount of the freeze-drying protectant added to the resuspension is 2-4 times the total weight of the bacterial sludge; the resuspension is prepared by inoculating the Bifidobacterium breve CCFM683 into a culture medium for cultivation to obtain a seed solution; The seed culture was inoculated into the culture medium for cultivation to obtain the culture solution; the culture solution was centrifuged and the mycelial sludge was collected; the mycelial sludge was washed with physiological saline and resuspended to obtain the resuspension.
Citation Information
Patent Citations
Bifidobacterium breve CCFM1025, its fermented foods and their applications
CN108949640B
A strain of Bifidobacterium breve that can alleviate rheumatoid arthritis and its application
CN112111424B
Bifidobacterium breve C11 and application thereof
CN106038611A
Bifidobacterium breve capable of inhibiting release of IL-23 and Th17 axis related inflammatory factors and application of bifidobacterium breve
CN112546074A
Bifidobacterium breve capable of down-regulating IL-17 and relieving constipation and application of bifidobacterium breve
CN114774328A