A paper-based microfluidic method for detecting antibiotics based on multicolor carbon quantum dots

Abstract

This invention discloses a paper-based microfluidic method for detecting antibiotics based on multicolor carbon quantum dots, belonging to the field of detection technology. Combining paper-based microfluidic chip detection technology with a fluorescent nanomaterial biosensor platform, the method can be applied to the simultaneous visual detection of three antibiotics. By incorporating biorecognition molecules, the detection method achieves enhanced specificity, eliminating the previous need for specialized personnel and reliance on large-scale detection equipment, enabling rapid detection. Furthermore, the chip's simple, low-cost, and portable manufacturing method makes it suitable for real-time, on-site detection.

Description

Technical Field

[0001] The invention relates to a paper-based microfluidic method for detecting antibiotics based on multicolor carbon quantum dots, and belongs to the technical field of detection. Background Art

[0002] Since the advent of antibiotics nearly a century ago, they have been primarily used to treat and prevent human and animal diseases. In aquaculture, antibiotics are commonly used to control various bacterial diseases, promote the growth of aquatic products, improve feed utilization, and reduce the demand for certain nutrients. However, the widespread use of antibiotics in aquaculture and their difficulty in degradation inevitably lead to large amounts of antibiotic residues in the aquatic environment, resulting in bioaccumulation and high toxicity to non-target organisms. Therefore, the detection of antibiotic residues in aquatic products is of great significance to food safety. Detection technologies based on microbiological methods, chromatography, and traditional immunoassays are relatively mature, but have disadvantages such as high cost, high reagent consumption, and complex procedures.

[0003] Paper-based microfluidic chips (μPADs) replace traditional microfluidic chip substrates (glass, silicon wafers, etc.) with paper. Microfabrication techniques (wax printing, photolithography, etc.) create a network of channels on the paper surface for analysis and detection. These devices integrate a series of complex operations, including liquid injection, molecular reactions, and signal detection. They offer advantages such as low cost, portability, ease of operation, good biocompatibility, and the ability to perform multiplexed detection.

[0004] Carbon quantum dots (CQDs) are a new type of nanomaterial discovered in recent years, with a carbon skeleton structure. They are dispersed, spherical nanoparticles less than 10 nm in size. Because CQDs exhibit excellent fluorescence properties, including excellent fluorescence, strong stability, good photostability, good bleaching resistance, and tunable emission wavelength, they also possess low toxicity, excellent biocompatibility, a low relative molecular weight, and an extremely small particle size. Therefore, they hold great promise for replacing traditional fluorescent dyes and quantum dots in applications in optics and life sciences.

[0005] If paper-based microfluidic chips can be combined with fluorescent nanomaterial analysis and detection technology, a new type of sensitive, fast, and inexpensive paper-based microfluidic chip multiple detection and analysis device can be developed, which will have important scientific significance and value for the future fields of biological and chemical analysis. Summary of the Invention

[0006] The present invention discloses a low-cost paper-based microfluidic chip based on multicolor fluorescent carbon quantum dots. The chip can be used for the simultaneous visual detection of three antibiotics. By combining with biorecognition molecules, the detection method has better specificity, which can solve the problems of requiring professional operation and reliance on large detection instruments in the past, and achieve rapid detection. At the same time, the manufacturing method of the chip is simple, low-cost, and portable, making it suitable for on-site real-time detection.

[0007] The present invention provides a paper-based microfluidic detection chip based on multicolor fluorescent carbon quantum dots. The paper-based microfluidic detection chip is fan-shaped and includes a black hydrophobic area, three hydrophilic detection areas of different shapes, three circular hydrophilic buffer areas, three hydrophilic channels, and a hydrophilic tip. The three hydrophilic detection areas of different shapes are a rectangular area on the left, a circular area in the middle, and a hexagonal area on the right. The three hydrophilic detection areas of different shapes are respectively connected to the three hydrophilic channels. The three hydrophilic channels are evenly distributed on the paper-based microfluidic detection chip and are used to connect the hydrophilic detection areas and the hydrophilic tips. The three circular hydrophilic buffer areas are respectively located in the middle of each hydrophilic channel and are respectively connected to the three hydrophilic detection areas of different shapes. The hydrophilic tip is the bottom tip of the fan-shaped test paper and is used to absorb the solution to be tested during detection.

[0008] The paper-based microfluidic detection chip includes three hydrophilic detection areas of different shapes, three circular hydrophilic buffer areas, three hydrophilic channels, and a hydrophilic tip, which are the black hydrophobic areas.

[0009] The three hydrophilic detection areas of different shapes are used to detect different antibiotics in the sample to be tested, and respectively have a detection probe with red fluorescent carbon quantum dots, a detection probe with green fluorescent carbon quantum dots, and a detection probe with blue fluorescent carbon quantum dots. The detection probes have a nucleotide aptamer sequence that can bind to antibiotics. The detection probes that are not bound to antibiotics do not exhibit fluorescence, and the detection probes that are bound to antibiotics restore fluorescence.

[0010] The left rectangular area is used for the detection of sulfamethazine, the middle circular area is used for the detection of oxytetracycline, and the right hexagonal area is used for the detection of chloramphenicol.

[0011] The paper-based microfluidic chip is fan-shaped with a radius of 30 mm.

[0012] The size of the left rectangular area is 5 mm×5 mm, the diameter of the middle circular area is 5 mm, and the right hexagonal area is a regular hexagon with a side length of 3 mm.

[0013] The three circular hydrophilic buffer zones are all circular with a diameter of 4 mm.

[0014] The three hydrophilic channels are all 13 mm in length and 1.5 mm in width.

[0015] The hydrophilic tip is a quarter circle with a radius of 12 mm.

[0016] The second object of the present invention is to provide a method for preparing the paper-based microfluidic detection chip based on multicolor fluorescent carbon quantum dots, the method comprising the following steps:

[0017] (1) Print a fan-shaped pattern on the test paper using a toner laser printer according to the fan-shaped shape designed by AutoCAD software, cut along the edge of the fan-shaped pattern to obtain a fan-shaped test paper, heat it in a high-temperature oven at 200°C for 1 hour, cool it to room temperature, and place it in a ziplock bag for later use;

[0018] (2) Add red fluorescent carbon quantum dot detection probe, green fluorescent carbon quantum dot detection probe, and blue fluorescent carbon quantum dot detection probe to the hydrophilic detection area on the paper-based microfluidic chip to be used; the amount of detection probe added to each hydrophilic detection area is 25 μL.

[0019] The method for preparing the red fluorescent carbon quantum dot detection probe comprises: synthesizing red fluorescent carbon quantum dots using citric acid and neutral red by a hydrothermal method;

[0020] Specifically, the carboxyl groups of red carbon quantum dots were ultrasonically activated with EDC / NHS for 30 minutes, and then incubated with 5 μM amino-modified aptamer 1 for 12 hours. After the incubation, the aptamer was incubated with 0.25 mg / mL molybdenum disulfide nanosheets for 15 minutes before use. The aptamer 1 is a sulfamethazine aptamer with the sequence CGTACGGTCGACGCTAGCTTAGCTTATGCGTTGGCCGGGATAAGGATCCAGCCGTTGTAG ATTTGCGTTCTAACTCTCCACGTGGAGCTCGGATCC.

[0021] The method for preparing the green fluorescent carbon quantum dot detection probe comprises: synthesizing green fluorescent carbon quantum dots using citric acid and p-phenylenediamine by a hydrothermal method;

[0022] Specifically, the carboxyl groups of green carbon quantum dots were ultrasonically activated with EDC / NHS for 30 minutes, and then incubated with 5 μM amino-modified aptamer 2 for 12 hours. After the incubation, the aptamer was incubated with 0.3 mg / mL molybdenum disulfide nanosheets for 15 minutes before use. The aptamer 2 is an oxytetracycline aptamer with the sequence CGTACGGAATTCGCTAGCCGAGTTGAGCCGGGCGCGGTACGGGTACTGGTATGTGTGGGGATCCGAGCTCCACGTG.

[0023] The method for preparing the detection probe of blue fluorescent carbon quantum dots comprises: synthesizing blue fluorescent carbon quantum dots using citric acid and o-phenylenediamine by a hydrothermal method;

[0024] Specifically, the carboxyl groups of blue carbon quantum dots were ultrasonically activated with EDC / NHS for 30 minutes and incubated with aptamer 3 modified with amino groups at a concentration of 5 μM for 12 hours. After the incubation, the mixture was incubated with molybdenum disulfide nanosheets at a concentration of 0.3 mg / mL for 15 minutes and then used. The aptamer 3 was a chloramphenicol aptamer with the sequence of AGCAGCACAGAGGTCAGATGACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGTGGTAGCCTATGCGTGCTACCGTGAA.

[0025] The present invention also provides an application of the paper-based microfluidic detection chip based on multicolor fluorescent carbon quantum dots in the simultaneous detection of three antibiotics, wherein the three antibiotics are sulfamethazine, oxytetracycline, and chloramphenicol.

[0026] The present invention also provides a method for simultaneously and rapidly detecting three antibiotics: sulfamethazine, oxytetracycline, and chloramphenicol. The method comprises the following steps: using the above-mentioned paper-based microfluidic detection chip based on multicolor fluorescent carbon quantum dots for detection, inserting the hydrophilic tip of the paper-based microfluidic detection chip into the solution to be tested, reacting for 10 minutes, placing the fluorescent paper-based microfluidic chip under a 365nm ultraviolet light source, and directly identifying the intensity of different colors of fluorescence through a smartphone color-picking APP.

[0027] The detection principle of the method is as follows:

[0028] (1) Sulfamethazine: The red fluorescent carbon quantum dots modified with the Sulfamethazine aptamer are adsorbed onto the surface of the MoS2 nanosheets through π-π chelation and hydrophobic bonding. The fluorescence of the red fluorescent carbon quantum dots is quenched due to the FRET effect. In the presence of Sulfamethazine, the red fluorescent carbon quantum dots modified with the Sulfamethazine aptamer fall off from the MoS2 nanosheet surface due to the high specificity of the Sulfamethazine aptamer binding to Sulfamethazine. The FRET effect is weakened, and the fluorescence of the red fluorescent carbon quantum dots is restored.

[0029] (2) Oxytetracycline: The green fluorescent carbon quantum dots modified with the oxytetracycline aptamer are adsorbed onto the surface of the MoS2 nanosheets through π-π chelation and hydrophobic bonding. The fluorescence of the green fluorescent carbon quantum dots is quenched due to the FRET effect. In the presence of oxytetracycline, the green fluorescent carbon quantum dots modified with the oxytetracycline aptamer fall off from the MoS2 nanosheet surface due to the high specificity of the oxytetracycline aptamer binding to oxytetracycline. The FRET effect weakens and the fluorescence of the green carbon quantum dots recovers.

[0030] (3) Chloramphenicol: The blue fluorescent carbon quantum dots modified with the chloramphenicol aptamer are adsorbed onto the surface of the MoS2 nanosheets through π-π chelation and hydrophobic bonding. The fluorescence of the blue fluorescent carbon quantum dots is quenched due to the FRET effect. In the presence of chloramphenicol, the blue fluorescent carbon quantum dots modified with the chloramphenicol aptamer fall off from the MoS2 nanosheet surface due to the high specificity of the chloramphenicol aptamer. The FRET effect weakens and the fluorescence of the blue carbon quantum dots recovers.

[0031] The beneficial technical effects of the present invention are:

[0032] (1) The present invention designs a fan-shaped paper-based microfluidic chip prepared by a carbon powder laser printer. The key points of the paper-based microfluidic chip are miniaturization and low sample consumption, so the chip should be miniaturized as much as possible, with a small hydrophilic area and narrow microfluidic channels. On this basis, the normal flow of liquid in the chip should be guaranteed. The microfluidic channel forms a hydrophilic channel by printing a hydrophobic area on the paper chip with carbon powder and heating it. After heating, the carbon powder will enter the interior of the paper base and expand to a certain extent. If the microfluidic channel is too narrow, the channel will be blocked by the carbon powder entering the interior of the paper base after heating, resulting in the liquid being unable to enter the detection area through the hydrophilic channel. In order to control the free flow of the solution on the paper-based chip, the present invention optimizes the printing pattern and size of the paper-based microfluidic chip, and after printing the paper-based chip, optimizes the heating conditions of the paper-based chip, including heating time and heating temperature. The paper-based microfluidic chip designed by the present invention can meet the key points of the paper-based microfluidic chip while taking into account the aesthetics of the chip, and obtains the final size.

[0033] The paper-based microfluidic detection chip is designed to be fan-shaped in the present invention so that the paper-based chip can have a hydrophilic tip. When sampling, it can be directly inserted into the test liquid to absorb the sample without the assistance of sampling equipment such as a pipette gun and a dropper.

[0034] The paper-based microfluidic detection chip of the present invention is provided with three circular hydrophilic buffer areas to prevent the liquid from flowing too fast when sampling on the paper chip. If the flow rate is too fast and directly rushes into the detection area, the detection probes in the detection area will be rushed to the top of the detection area, causing accumulation, affecting the accuracy of the detection results.

[0035] The present invention designs the detection area of ​​the paper-based microfluidic detection chip into three different shapes, which can facilitate the distinction between different detection objects when detecting different types of antibiotics.

[0036] The present invention sets the hydrophobic area of ​​the paper-based microfluidic detection chip to black, mainly because when the paper-based microfluidic detection chip is detected under 365nm ultraviolet light, the black hydrophobic area as a background will not affect the fluorescence of the detection signal.

[0037] (2) The method of the present invention combines paper-based microfluidic chip detection technology with a fluorescent nanomaterial biosensor platform, making the detection method have higher specificity and better sensitivity, and is easy to prepare, has good biocompatibility, and has low preparation cost, and can achieve simultaneous rapid detection of three antibiotics.

[0038] The challenges in integrating paper-based microfluidic chip detection technology with a fluorescent nanomaterial biosensor platform lie in controlling the flow of the solution within the paper-based microfluidic chip, as well as controlling the fluorescence intensity of the carbon dots on the paper substrate and the intensity of fluorescence recovery after the addition of the analyte. To achieve this, the concentration of molybdenum disulfide nanosheets in the detection probe and the incubation time of the paper-based chip with the analyte were optimized, ensuring consistent fluorescence intensity of the carbon dots within the detection probe. The results were expressed as grayscale values ​​of the fluorescence intensity on the paper substrate.

[0039] (3) The present invention combines a smartphone imaging system and a color-picking APP to achieve visual quantitative detection of three antibiotics. During detection, under 365nm ultraviolet light, the detection area of ​​the fluorescent paper-based microfluidic chip generates a fluorescent signal. The fluorescent image of the reaction area in each channel is captured using the rear camera of the mobile phone. The RGB value of the detection area is extracted using the smartphone color-picking APP ColorColl, and the RGB value is converted into a grayscale value according to the formula Gray = R×0.299+G×0.587+B×0.114. The average grayscale value of three points in each detection area is taken as the detection signal intensity, and the detection results are calculated. The minimum detection limits of sulfamethazine, oxytetracycline, and chloramphenicol obtained are 0.47ng / mL, 0.48ng / mL, and 0.34ng / mL, respectively. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Design pattern for fluorescent paper-based microfluidic chip.

[0041] Figure 2 This is the preparation process of multi-color fluorescent carbon quantum dot detection probes.

[0042] Figure 3 This is a transmission electron microscope (TEM) image of the multicolor fluorescent carbon quantum dots prepared in Example 1 (left: red; middle: green; right: blue).

[0043] Figure 4 This is the X-ray diffraction (XRD) pattern of the multicolor fluorescent carbon quantum dots prepared in Example 1 (left: red; middle: green; right: blue).

[0044] Figure 5This is a Fourier transform infrared spectrum (FT-IR) of the multicolor fluorescent carbon quantum dots prepared in Example 1 (left: red; middle: green; right: blue).

[0045] Figure 6 This is the X-ray photoelectron spectrum (XPS) of the multicolor fluorescent carbon quantum dots prepared in Example 1 (left: red; middle: green; right: blue).

[0046] Figure 7 These are the ultraviolet absorption spectrum, fluorescence excitation spectrum, fluorescence emission spectrum of the multicolor fluorescent carbon quantum dots prepared in Example 1, as well as actual images under natural light and 365nm ultraviolet light (left: red; middle: green; right: blue).

[0047] Figure 8 This is a characterization diagram of the zeta potential of the successful coupling of the multicolor fluorescent carbon quantum dots with the aptamer in Example 1. After coupling with the aptamer, the negative value of the zeta potential increases significantly (left: red; middle: green; right: blue).

[0048] Figure 9 1 is a fluorescence lifetime diagram of the multicolor fluorescent carbon quantum dots and the multicolor fluorescent carbon quantum dot biosensing detection probe in Example 1 (left: red; middle: green; right: blue).

[0049] Figure 10 The fluorescence emission spectrum of the multicolor fluorescent carbon quantum dots prepared in Example 1 and the ultraviolet absorption spectrum of molybdenum disulfide nanosheets are shown.

[0050] Figure 11 This is a feasibility verification diagram of the multi-color fluorescent carbon quantum dot detection probe prepared in Example 1, including the feasibility verification in a homogeneous system and the feasibility verification on a paper-based microfluidic chip (left: red; middle: green; right: blue).

[0051] Figure 12 This is a physical picture of the paper-based microfluidic chip prepared in Example 2.

[0052] Figure 13 This is a diagram showing the optimized heating conditions for preparing the paper-based microfluidic chip in Example 2.

[0053] Figure 14 This is a scanning electron microscope (SEM) image of the fluorescent paper-based microfluidic chip prepared in Example 2 (left: detection area of ​​a blank paper-based microfluidic chip; right: detection area of ​​a paper-based microfluidic chip with fluorescent carbon quantum dot detection probes added).

[0054] Figure 15The results of optimizing the concentration of molybdenum disulfide nanosheets in the multicolor fluorescent carbon quantum dot detection probe in Example 2 are shown as grayscale values ​​on a paper-based microfluidic chip and in a real-world image (left: red; center: green; right: blue).

[0055] Figure 16 The results of optimizing the incubation time for three antibiotics in the multicolor fluorescent carbon quantum dot paper-based microfluidic chip used in Example 2 are shown as grayscale values ​​on the paper-based microfluidic chip and in images of the actual chip (left: red; center: green; right: blue).

[0056] Figure 17 The flow of liquid during detection of the multi-color fluorescent carbon quantum dot paper-based microfluidic chip in Example 3 (ac: under visible light; df: under 365nm ultraviolet light).

[0057] Figure 18 The standard curve diagram and corresponding physical pictures of the three antibiotics detected at different concentrations in Example 3. DETAILED DESCRIPTION

[0058] The present invention will be described in detail below with reference to the accompanying drawings and embodiments.

[0059] The excitation wavelength of the paper-based microfluidic chip based on fluorescent carbon quantum dots is 365 nm. The captured images are extracted using smartphone colorimetric software and converted into grayscale values ​​for quantitative analysis.

[0060] Example 1 Preparation of multicolor fluorescent carbon quantum dot biosensor detection probe

[0061] Step 1: Preparation of multicolor fluorescent carbon quantum dots by hydrothermal method

[0062] Red fluorescent carbon dots (rCD): First, 1.5g of citric acid and 2.1mg of neutral red were dissolved in 20mL of ultrapure water and sonicated for 10min to completely dissolve the solid. The mixed solution was then transferred to a 50mL polytetrafluoroethylene-lined reactor and heated at 180°C for 4h. After naturally cooling to room temperature, the resulting solution was centrifuged at 10,000rpm for 10min to remove the precipitate. The supernatant was filtered with a 0.22μm water filter head, and the filtered solution was dialyzed in a dialysis bag (MW=500-1000Da) for 48 hours to remove unreacted raw materials and other small molecule impurities. Red fluorescent carbon dots with an emission wavelength of 614nm were obtained and stored at 4°C or freeze-dried at -50°C for 36h to obtain a solid powder for various characterizations.

[0063] Green fluorescent carbon dots (gCD): First, 0.54g of citric acid and 0.96g of p-phenylenediamine were dissolved in 20mL of ultrapure water and sonicated for 10 minutes to completely dissolve the solids. The mixed solution was then transferred to a 50mL polytetrafluoroethylene-lined reactor and heated at 200°C for 11 hours. After cooling naturally to room temperature, the resulting solution was centrifuged at 10,000rpm for 10 minutes to remove the precipitate. The supernatant was filtered through a 0.22μm water filter and dialyzed in a dialysis bag (MW = 500-1000Da) for 48 hours to remove unreacted raw materials and other small molecular impurities. This yielded green fluorescent carbon dots with an emission wavelength of 493nm. They were stored at 4°C or freeze-dried at -50°C for 36 hours to obtain a solid powder for various characterizations.

[0064] Blue fluorescent carbon dots (bCD): First, 0.5g of citric acid and 0.5g of o-phenylenediamine were dissolved in 20mL of ultrapure water and ultrasonicated for 10min to completely dissolve the solid. The mixed solution was then transferred to a 50mL polytetrafluoroethylene-lined reactor and heated at 200°C for 8h. After cooling naturally to room temperature, the resulting solution was centrifuged at 10,000rpm for 10min to remove the precipitate. The supernatant was filtered using a 0.22μm water filter. The filtered solution was dialyzed in a dialysis bag (MW=500-1000Da) for 48 hours to remove unreacted raw materials and other small molecular impurities. Blue fluorescent carbon dots with an emission wavelength of 439nm were obtained and stored at 4°C or freeze-dried at -50°C for 36h to obtain a solid powder for various characterizations.

[0065] The TEM test results of three fluorescent carbon dots are shown in Figure 3 ,The results showed that they were well-dispersed and uniformly spherical, ,with good dispersibility and uniform size, and the average particle ,sizes were 3.49±0.63nm, 4.74±0.65nm and 5.03±0.69nm, respectively.

[0066] XRD characterized the crystallinity of three fluorescent carbon dots, such as Figure 4 As shown. Compared with the nitrogen-derived neutral red (NR) of rCDs, the red-emitting CDs exhibit a new sharp diffraction peak at 20.0°. gCDs and bCDs show broad diffraction patterns centered at 2θ = 20.7° and 20.8°, respectively. These three characteristic peaks in the CDs XRD spectrum are all caused by the interlayer spacing (002) of the graphite structure. To further investigate the functional groups and nitrogen doping of CDs, the chemical composition of CDs was studied using FT-IR and XPS.

[0067] Figure 5The FT-IR spectra of the three CDs are shown. The infrared spectra of the three fluorescent carbon dots are similar, with COC (1195, 1166 and 1145 cm -1 ), CN (1417, 1394 and 1400 cm -1 ), C=O (1720, 1627 and 1621 cm -1 ) and OH / NH (3502, 3413 and 3437 cm -1 ) stretching vibrations and NH (779, 827 and 912 cm -1 ) bending vibration.

[0068] The surface elements of the three CDs were analyzed using XPS. Figure 6 As shown, the results show that the three fluorescent carbon dots have different atomic contents of C (284.8 eV), N (400 eV) and O (531 eV).

[0069] Figure 7 The optical properties of the three fluorescent carbon dots were characterized, including UV absorption spectra, fluorescence excitation spectra and fluorescence emission spectra. The results showed that the absorption bands of the three CDs at 530 nm, 360 nm and 370 nm overlapped with the excitation spectra recorded by monitoring the emissions at 614 nm, 490 nm and 470 nm, respectively, and under excitation wavelengths of 518, 362 and 374 nm, the three CDs exhibited maximum emission wavelengths at 614 nm, 493 nm and 439 nm, respectively. Figure 7 The physical picture in FIG shows that the three fluorescent carbon dots show their strong fluorescence under the irradiation of 365nm ultraviolet light.

[0070] Step 2: Carbodiimide method to couple aptamers

[0071] 5mg EDC and 5mg NHS were mixed in 1mL PBS buffer (10mM, pH 7.4). 100μL of the above-mentioned carbon quantum dot solution was mixed with 100μL of the above-mentioned EDC / NHS solution respectively. After ultrasonic activation at room temperature for 30min, 20μL of the reaction solution was added to 80μL PBS buffer (10mM, pH 7.4) containing 5μM aptamers. The mixture was incubated with shaking at 37°C for 12h, and then ultrafiltration was performed using an ultrafiltration tube (MW=30KD) to remove the uncoupled aptamers to obtain a complex of three carbon quantum dots and aptamers. This step is applicable to carbon quantum dots with three different colors of fluorescent emission: red fluorescent carbon quantum dots coupled to sulfamethazine aptamers, green fluorescent carbon quantum dots coupled to oxytetracycline aptamers, and blue fluorescent carbon quantum dots coupled to chloramphenicol aptamers.

[0072] The binding of aptamers to CDs was characterized by Zeta potential. Figure 8As shown in the figure, due to the abundant negative charge on the phosphate backbone of the aptamer, the potentials of rCDs, gCDs, and bCDs before and after binding to the aptamer increased from -2.33 mV, -8.81 mV, and -8.86 mV to -11.7 mV, -12.2 mV, and -14.7 mV, respectively. These results indicate that rCDs-apt 1, gCDs-apt 2, and bCDs-apt 3 were successfully prepared.

[0073] Step 3: Preparation of multicolor fluorescent carbon quantum dot biosensor detection probes

[0074] Take 2mg of molybdenum disulfide nanosheet solid powder and dissolve it in 10mL PBS buffer (10mM, pH 7.4) to prepare a 0.2mg / mL molybdenum disulfide nanosheet solution. Take 50μL of the 0.2mg / mL molybdenum disulfide nanosheet solution and add it to 50μL of the carbon quantum dot and aptamer-coupled complex, and shake the reaction at room temperature for 30min. This step is applicable to the complexes obtained by coupling three carbon quantum dots with different colors of fluorescent emission and aptamers for three different antibiotics, obtaining three "turn-on" fluorescent carbon quantum dot biosensor detection probes.

[0075] Feasibility verification of multicolor fluorescent carbon quantum dot biosensing detection probe:

[0076] Instrument: Hitachi F-7000 fluorescence spectrophotometer. Experimental Method: Fluorescence spectra of the following four solution systems were measured: a. Three-color fluorescent carbon quantum dot solutions (CD); b. A mixture of three-color fluorescent carbon quantum dot solutions and a molybdenum disulfide nanosheet solution (CD-MoS2); c. A mixture of three-color fluorescent carbon quantum dot-aptamer complexes added to a molybdenum disulfide nanosheet solution (CD-apt-MoS2); d. A mixture of three-color fluorescent carbon quantum dot-aptamer complexes added to a molybdenum disulfide nanosheet solution and then the corresponding antibiotic solution (CD-apt-MoS2-target). Each of the four solution systems contained 200 μL of carbon quantum dot solution, containing 50 μL of the carbon quantum dot solution, to ensure consistent concentrations of the fluorescent material. The fixed excitation wavelengths were 518 nm for the red carbon quantum dot system, 362 nm for the green carbon quantum dot system, and 374 nm for the blue carbon quantum dot system.

[0077] Figure 11 The results show that the fluorescence intensity of the CD-MoS2 system is slightly lower than that of the CD system, indicating that CD is almost unaffected by the shielding effect of MoS2; the fluorescence intensity of the CD-apt-MoS2 system is significantly lower than that of the CD system. Figure 9 and Figure 10, the fluorescence lifetime of carbon quantum dots decreased, and the fluorescence spectrum of carbon quantum dots overlapped with the ultraviolet absorption spectrum of molybdenum disulfide nanosheets, indicating that three fluorescent carbon quantum dot biosensing detection probes based on the FRET principle were successfully prepared. Figure 11 Curve d shows that after adding the corresponding antibiotic target to the system, the target preferentially binds to the aptamer, the fluorescent carbon quantum dots separate from the molybdenum disulfide nanosheets, and the fluorescence intensity recovers. This indicates that the multicolor fluorescent carbon quantum dot biosensor probe of the present invention can be used for the detection of antibiotics.

[0078] Example 2 Preparation of a paper-based microfluidic detection chip based on multicolor fluorescent carbon quantum dots

[0079] Step 1: Preparation of paper-based microfluidic chips by carbon powder laser printing

[0080] like Figure 1 As shown, the chip is fan-shaped with a radius of 30 mm, including a black hydrophobic area, three hydrophilic detection areas of different shapes, three circular hydrophilic buffer areas, three hydrophilic channels, and a hydrophilic tip; the three hydrophilic detection areas are connected to the hydrophilic tip of the paper-based microfluidic chip through the three hydrophilic channels.

[0081] The three hydrophilic detection areas are 5mm x 5mm rectangular detection area 1, 5mm diameter circular detection area 2, and 3mm hexagonal detection area 3. The three circular hydrophilic buffer zones are all 4mm in diameter. The three hydrophilic channels are all 13mm long and 1.5mm wide. The hydrophilic tip is a quarter-circle with a radius of 12mm.

[0082] First, use AutoCAD software to draw a fan-shaped paper base pattern and separate the hydrophilic and hydrophobic areas. The hydrophobic area is colored black, and the hydrophilic area is colorless. Then, Whatman Grade 1 filter paper is glued to the surface of A4 printing paper with solid glue. Place it in a HP toner laser printer and print the pattern designed by AutoCAD software on the filter paper surface. Separate the filter paper and A4 paper in time. Trim the printed pattern along the printed edge to the target shape. Heat it in a preheated 200℃ high-temperature oven for 1 hour. After cooling to room temperature, place it in a self-sealing bag for later use. The actual picture of the paper base is as follows Figure 12 shown.

[0083] like Figure 13 Figure 2 shows the back of a paper chip after absorbing a pink dye solution under different drying conditions. When dried in an oven at 200°C for 60 minutes, the pink dye was well confined to the hydrophilic region of the paper chip. However, at lower temperatures or shorter drying times, the pink dye overflowed the hydrophilic region, indicating that the hydrophobic barrier was not fully formed.

[0084] Step 2: Preparation of paper-based microfluidic chips based on multicolor fluorescent carbon quantum dots

[0085] Place the prepared paper-based microfluidic chip horizontally in a glass dish. Add 5 μL of red fluorescent carbon quantum dot detection probe to the rectangular detection area; 5 μL of green fluorescent carbon quantum dot detection probe to the circular detection area; and 5 μL of blue fluorescent carbon quantum dot detection probe to the regular hexagonal detection area. Transfer the chip to a 37°C oven and dry for 5 minutes. Repeat this step five times. Finally, place the dried multicolor fluorescent carbon quantum dot-based paper-based microfluidic chip in a ziplock bag and store at 4°C until use.

[0086] Figure 14 This image shows SEM images of the paper-based microfluidic chip at the same magnification, showing the detection area before and after the addition of the detection probe. Before the probe was added, only the fibrous structure of the filter paper was visible in the detection area. After the nanoprobes were fixed to the detection area, they adhered to the surface of the cellulose filter paper, and the nanostructures were observed.

[0087] In order to improve the detection effect of the paper-based microfluidic chip, the concentration of molybdenum disulfide nanosheets in the detection probe and the incubation time with the antibiotic to be tested were optimized. Figure 15 and Figure 16 As shown in the figure, among the three detection probes, the grayscale value on the paper substrate reached its lowest value when the concentration of molybdenum disulfide nanosheets was 0.25 mg / mL, 0.3 mg / mL, and 0.3 mg / mL, respectively. As the concentration continued to increase, the grayscale value remained unchanged. When the three detection probes were incubated with the corresponding antibiotic targets, the fluorescence intensity of the three detection probes returned to its highest value at approximately 15 minutes. As the incubation time continued to increase, the fluorescence intensity value hardly changed.

[0088] Feasibility verification of paper-based microfluidic chip based on multicolor fluorescent carbon quantum dots:

[0089] Test instrument: Smartphone color picking software: Colorcoll. Use a smartphone imaging system to capture images of the following four fluorescent paper-based microfluidic chips under a 365nm ultraviolet light source: a. A paper-based microfluidic chip with a carbon quantum dot solution (CD) of three fluorescent colors added; b. A paper-based microfluidic chip with a mixed solution of a carbon quantum dot solution and a molybdenum disulfide nanosheet solution (CD-MoS2) added; c. A paper-based microfluidic chip with the multi-color carbon quantum dot biosensor detection probe (CD-apt-MoS2) added; d. A paper-based microfluidic chip with an antibiotic sample solution (CD-apt-MoS2-target) added to the paper-based microfluidic chip with the detection probe added. The results are as follows. Figure 11 As shown in the actual pictures, the fluorescence intensity of the four paper-based microfluidic chips is Figure 11The four curves of fluorescence spectra a, b, c, and d correspond to each other, indicating that the multicolor fluorescent carbon quantum dot paper-based microfluidic chip of the present invention can be effectively used for the simultaneous detection of multiple antibiotics.

[0090] Example 3 Visual detection of three antibiotics using a paper-based microfluidic chip based on multicolor fluorescent carbon quantum dots

[0091] Step 1: Detection method of multiple antibiotic standard samples:

[0092] First, the liquid sample to be tested is added to a glass dish. The hydrophilic tip of the prepared fluorescent paper chip is inserted into the test solution until the liquid level is below the black hydrophobic area. The test liquid then soaks into the hydrophilic tip and flows along three hydrophilic channels to the three detection areas. The reaction lasts for 10 minutes. The paper chip is removed and air-dried. The fluorescence intensity of the chip is observed under a 365nm ultraviolet light source. The degree of fluorescence recovery in the detection area is proportional to the antibiotic content.

[0093] Figure 17 The figure shows the liquid flow of the paper-based microfluidic chip under visible light and ultraviolet light. In order to show the flow more clearly, pink dye was chosen for display under visible light. Due to the inherent capillary absorption capacity of the filter paper and the limitation of the hydrophobic area on the paper chip, the dye is absorbed onto the paper chip. Subsequently, it flows rapidly along the hydrophilic channel and slows down when it reaches the buffer zone. Finally, the three detection areas are filled with pink dye. The whole process is continuous and the entire hydrophilic area is filled in about 30 seconds. Under ultraviolet light, the position where the test liquid flows on the paper base is marked by a dotted line. When the liquid does not flow to the detection area, the fluorescence intensity of the detection area does not change. After the liquid fills the hydrophilic area of ​​the paper chip and incubates for 15 minutes, the results are as follows Figure 17 As shown in (f), the fluorescence intensity of the three carbon dots in the detection area is restored.

[0094] Step 2: Smartphone Visual Quantitative Detection

[0095] Fluorescence intensity images of the three detection areas were simultaneously captured and processed using a smartphone camera. The specific process was as follows: Fluorescence images of the reaction area in each channel were captured using the smartphone's rear camera under a fixed UV light source. The RGB values ​​of the detection areas were extracted using the smartphone color-collection app ColorColl. These RGB values ​​were converted to grayscale using the formula Gray = R × 0.299 + G × 0.587 + B × 0.114. The average grayscale value of three points in each detection area was taken as the detection signal intensity, denoted as G. A fitting curve for the concentration of the tested antibiotic was plotted, with G - G0 (G0 = grayscale value of the blank sample) as the ordinate and the logarithm of the antibiotic concentration as the abscissa.

[0096] The standard curves for the three antibiotic tests are as follows: Figure 18As shown in the figure, the G value of the detection area gradually increases, and the G-G0 value gradually increases. Fitting curve R 2 The linearity was above 0.97, indicating good performance. The minimum detection limits were 0.47 ng / mL for sulfamethazine, 0.48 ng / mL for oxytetracycline, and 0.34 ng / mL for chloramphenicol. Based on the standard fitting curves, qualitative and quantitative analysis of multiple antibiotics in the test samples was possible.

[0097] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A paper-based microfluidic detection chip based on multicolor fluorescent carbon quantum dots, characterized in that: The paper-based microfluidic detection chip is fan-shaped and includes a black hydrophobic area, three hydrophilic detection areas of different shapes, three circular hydrophilic buffer areas, three hydrophilic channels, and a hydrophilic tip; the three hydrophilic detection areas of different shapes are a rectangular area on the left, a circular area in the middle, and a hexagonal area on the right, and the three hydrophilic detection areas of different shapes are respectively connected to the three hydrophilic channels; the three hydrophilic channels are evenly distributed on the paper-based microfluidic detection chip and are used to connect the hydrophilic detection areas and the hydrophilic tips; the three circular hydrophilic buffer areas are respectively located in the middle of each hydrophilic channel and are respectively connected to the three hydrophilic detection areas of different shapes; the hydrophilic tip is the bottom tip of the fan-shaped test paper and is used to absorb the solution to be tested during detection; The paper-based microfluidic detection chip includes three hydrophilic detection areas of different shapes, three circular hydrophilic buffer areas, three hydrophilic channels, and a hydrophilic tip, which are the black hydrophobic areas. The paper-based microfluidic chip is fan-shaped with a radius of 30 mm. The left rectangular area is 5 mm × 5 mm in size. The diameter of the middle circular area is 5 mm. The right hexagonal area is a regular hexagon with a side length of 3 mm. The three circular hydrophilic buffer areas are all 4 mm in diameter. The three hydrophilic channels are all 13 mm in length and 1.5 mm in width. The hydrophilic tip is a quarter circle with a radius of 12 mm. The three hydrophilic detection areas of different shapes are respectively used to detect different antibiotics in the sample to be tested, and respectively have a detection probe with red fluorescent carbon quantum dots, a detection probe with green fluorescent carbon quantum dots, and a detection probe with blue fluorescent carbon quantum dots. The detection probes have nucleotide aptamer sequences that can bind to antibiotics. The detection probes that are not bound to the antibiotics do not exhibit fluorescence, and the detection probes that are bound to the antibiotics resume fluorescence. The left rectangular area is used for the detection of sulfamethazine, the middle circular area is used for the detection of oxytetracycline, and the right hexagonal area is used for the detection of chloramphenicol.

2. The paper-based microfluidic detection chip according to claim 1, characterized in that: (1) Preparation method of red fluorescent carbon quantum dot detection probe: the carboxyl group 3 of the red carbon quantum dot is activated by ultrasonic activation with EDC / NHS, and then incubated with the amino-modified aptamer 1; after the incubation, the aptamer is incubated with 0.25 mg / mL molybdenum disulfide nanosheets for 15 minutes and then used; the aptamer 1 is a sulfamethazine aptamer; Preparation method of green fluorescent carbon quantum dot detection probe: using EDC / NHS ultrasonic activation of the carboxyl group of the green carbon quantum dots, incubating with amino-modified aptamer 2; after the incubation, incubating with 0.3 mg / mL molybdenum disulfide nanosheets for 15 minutes before use; the aptamer 2 is an oxytetracycline aptamer; Preparation method of blue fluorescent carbon quantum dot detection probe: use EDC / NHS ultrasonic activation of the carboxyl group of the blue carbon quantum dots, incubation with amino-modified aptamer 3; after the incubation is completed, incubation with molybdenum disulfide nanosheets at a concentration of 0.3 mg / mL for 15 minutes and then standby; the aptamer 3 is a chloramphenicol aptamer.

3. The paper-based microfluidic detection chip according to claim 2, characterized in that: The sequence of aptamer 1 is CGTACGGTCGACGCTAGCTTAGCTTATGCGTTGGCCGGGATAAGGATCCAGCCGTTGTAG ATTTGCGTTCTAACTCTCCACGTGGAGCTCGGATCC; the sequence of aptamer 2 is CGTACGGAATTCGCTAGCCGAGTTGAGCCGGGCGCGGTACGGGTACTGGTATGTGTGGG GATCCGAGCTCCACGTG; the sequence of aptamer 3 is AGCAGCACAGAGGTCAGATGACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGTGGT AGCCTATGCGTGCTACCGTGAA.

4. The method for preparing a paper-based microfluidic detection chip based on multicolor fluorescent carbon quantum dots according to any one of claims 1 to 3, characterized in that: The following steps are involved: (1) Printing the pattern of the paper-based microfluidic detection chip based on multicolor fluorescent carbon quantum dots on a test paper using a toner laser printer, cutting along the fan-shaped edge to obtain a fan-shaped test paper, then heating it in a high-temperature oven at 200° C. for 1 h, cooling it to room temperature, and placing it in a ziplock bag for later use; (2) Add red fluorescent carbon quantum dot detection probe, green fluorescent carbon quantum dot detection probe, and blue fluorescent carbon quantum dot detection probe to the hydrophilic detection area on the paper-based microfluidic chip to be used, respectively, and the amount of detection probe added to each hydrophilic detection area is 25 μL.

5. The method according to claim 4, characterized in that The preparation method of the detection probe is as follows: (1) Preparation method of red fluorescent carbon quantum dot detection probe: the carboxyl groups of the red carbon quantum dots were activated by ultrasonic activation with EDC / NHS for 30 min, and then incubated with 5 μM amino-modified aptamer 1 for 12 h; after the incubation, the aptamer was incubated with 0.25 mg / mL molybdenum disulfide nanosheets for 15 min and then used; the aptamer 1 was a sulfamethazine aptamer, the sequence of which was CGTACGGTCGACGCTAGCTTAGCTTATGCGTTGGCCGGGATAAGGATCCAGCCGTTGTAG ATTTGCGTTCTAACTCTCCACGTGGAGCTCGGATCC; (2) Preparation method of green fluorescent carbon quantum dot detection probe: the carboxyl groups of green carbon quantum dots were ultrasonically activated with EDC / NHS for 30 min, and then incubated with 5 μM amino-modified aptamer 2 for 12 h; after the incubation, the aptamer 2 was incubated with 0.3 mg / mL molybdenum disulfide nanosheets for 15 min and then used; the aptamer 2 was an oxytetracycline aptamer with the sequence of CGTACGGAATTCGCTAGCCGAGTTGAGCCGGGCGCGGTACGGGTACTGGTATGTGTGGG GATCCGAGCTCCACGTG; (3) Preparation method of detection probe of blue fluorescent carbon quantum dots: ultrasonically activate the carboxyl groups of blue carbon quantum dots with EDC / NHS for 30 minutes, and incubate with amino-modified aptamer 3 at a concentration of 5 μM for 12 hours; after the incubation, incubate with molybdenum disulfide nanosheets at a concentration of 0.3 mg / mL for 15 minutes and then set aside; the aptamer 3 is a chloramphenicol aptamer, and the sequence is AGCAGCACAGAGTCAGATGACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGTGGT AGCCTATGCGTGCTACCGTGAA.

6. Use of the paper-based microfluidic detection chip based on multicolor fluorescent carbon quantum dots according to any one of claims 1 to 3 in the simultaneous detection of three antibiotics, wherein the three antibiotics are sulfamethazine, oxytetracycline and chloramphenicol.

7. A method for detecting three antibiotics, sulfamethazine, oxytetracycline, and chloramphenicol, using the paper-based microfluidic detection chip based on multicolor fluorescent carbon quantum dots according to any one of claims 1 to 3, characterized in that: Insert the hydrophilic tip into the test solution. After the reaction is completed, place the fluorescent paper-based microfluidic chip under a 365nm ultraviolet light source. Use the smartphone color-picking APP to directly identify the intensity of different colors of fluorescence, and calculate the content of antibiotics in the test solution by comparing with the standard curve.

Images