A recombinant expression plasmid, recombinant saccharomyces cerevisiae and transformation method for synthesizing ursodeoxycholic acid from chenodeoxycholic acid

By constructing the recombinant expression plasmid pEU-E7α-Rt7β-HSDH in Saccharomyces cerevisiae, the efficient conversion of goose deoxycholic acid to ursodeoxycholic acid is achieved, solving the problems of high cost, serious pollution and complex steps in UDCA synthesis, and achieving efficient and economical UDCA production.

CN115717153BActive Publication Date: 2025-09-05TIANJIN UNIV OF SCI & TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211336817.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-28
Publication Date
2025-09-05
Estimated Expiration
2042-10-28

AI Technical Summary

Technical Problem

The existing UDCA synthesis methods have problems such as harm, high cost, serious pollution, high risk of reaction conditions and complex steps to wild animals, making it difficult to achieve green, efficient and economical synthesis.

Method used

The recombinant expression plasmid pEU-E7α-Rt7β-HSDH was constructed. By expressing E7αHSDH and Rt7βHSDH dehydrogenase in Saccharomyces cerevisiae, the fermentation medium was used to directly catalyze the synthesis of ursodeoxycholic acid to avoid the addition of expensive cofactors and simplify the operation steps.

Benefits of technology

It has achieved efficient UDCA production, with a conversion rate of up to 94.9%, and a yield of up to 83.0%, reducing production costs, simplifying operating procedures, and in line with the concept of green development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115717153B_ABST
    Figure CN115717153B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of microbial catalytic synthesis technology and relates to a recombinant expression plasmid, recombinant Saccharomyces cerevisiae, and a transformation method for synthesizing ursodeoxycholic acid from chenodeoxycholic acid. The recombinant expression plasmid catalyzes the conversion of ursodeoxycholic acid from chenodeoxycholic acid. The recombinant expression vector is based on a dual-promoter vector and is linked to genes encoding two dehydrogenases, E7αHSDH and Rt7βHSDH. The recombinant expression plasmid constructed in the present invention is stable, uses a simple fermentation medium, is low-cost, and can achieve efficient production of ursodeoxycholic acid after transformation into Saccharomyces cerevisiae.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of microbial catalytic synthesis, and particularly relates to a recombinant expression plasmid, recombinant saccharomyces cerevisiae and a transformation method for synthesizing ursodeoxycholic acid from chenodeoxycholic acid. Background Art

[0002] Ursodeoxycholic acid (UDCA), chemical name 3α,7β-dihydroxy-5β-cholestane-24-oic acid, molecular formula C 24 H 40 O4, one of the main active ingredients in the precious traditional Chinese medicine bear bile powder, is clinically used to treat various gallstones and liver diseases and possesses extremely high medicinal value. UDCA, the first first-line drug approved by the US FDA for the treatment of primary biliary cirrhosis (PBC), has extensive applications in the food and pharmaceutical sectors. UDCA can increase the solubility of cholesterol in bile, reduce cholesterol precipitation, and minimize gallstone formation, offering hepatoprotective and choleretic benefits. With the deepening of UDCA research, its clinical application is becoming increasingly widespread, and market demand is also increasing. Currently, UDCA synthesis methods mainly include natural bile extraction, traditional chemical synthesis, and enzymatic synthesis. However, natural bile extraction mainly involves bile extraction from live bears or drainage, which not only violates the purpose of the newly revised "Wildlife Protection Law" in 2017, but also has low extraction rates and extremely high costs. Traditional chemical synthesis methods have harsh reaction conditions, high risks, and serious pollution, with high environmental costs, which runs counter to the concept of green development advocated by the country. The use of enzymatic methods not only avoids the harm to wildlife caused by natural acquisition methods, but also solves the problem of high risks and high pollution of chemical synthesis methods. However, the enzyme has poor in vitro stability and low activity, and the separation and purification steps are complicated and tedious. The enzymatic reaction requires the provision of expensive cofactors. These factors greatly increase the economic and time costs of synthesizing UDCA. Therefore, the development of a green, environmentally friendly, efficient and economical UDCA synthesis process is of great application value. Summary of the Invention

[0003] The present invention aims to provide a recombinant expression plasmid, recombinant Saccharomyces cerevisiae, and a transformation method for synthesizing ursodeoxycholic acid from chenodeoxycholic acid. The present invention constructs a stable recombinant expression plasmid, uses a simple and low-cost fermentation medium, and enables efficient production of ursodeoxycholic acid after transfer into Saccharomyces cerevisiae.

[0004] The invention provides a recombinant expression plasmid for catalyzing chenodeoxycholic acid to synthesize ursodeoxycholic acid. The recombinant expression vector uses a dual promoter vector as a basic plasmid and is connected with genes of two dehydrogenases, E7αHSDH and Rt7βHSDH.

[0005] Preferably, the dual promoter vector comprises pESC-URA.

[0006] The present invention also provides a method for constructing the recombinant expression plasmid described in the above technical solution, comprising the following steps:

[0007] Amplifying the E7αHSDH gene by PCR, digesting the amplified E7αHSDH gene and the dual-promoter vector respectively, and ligating the digested E7αHSDH gene with the digested dual-promoter vector to obtain a recombinant plasmid;

[0008] The Rt7βHSDH gene was amplified by PCR, and the amplified Rt7βHSDH gene and the recombinant plasmid were digested with enzymes respectively. The digested Rt7βHSDH gene and the digested recombinant plasmid were ligated to obtain a recombinant expression plasmid.

[0009] Preferably, the primers used for PCR amplification of the E7αHSDH gene include E-7α-F and E-7α-R; the nucleotide sequence of the E-7α-F is shown in SEQ ID NO.1, and the nucleotide sequence of the E-7α-R is shown in SEQ ID NO.2;

[0010] The primers used for PCR amplification of the Rt7βHSDH gene include R-7β-F and R-7β-R; the nucleotide sequence of the R-7β-F is shown in SEQ ID NO.3, and the nucleotide sequence of the R-7β-R is shown in SEQ ID NO.4.

[0011] The present invention also provides a recombinant Saccharomyces cerevisiae that catalyzes the synthesis of ursodeoxycholic acid from chenodeoxycholic acid. The recombinant Saccharomyces cerevisiae is constructed by transferring the recombinant expression plasmid described in the above technical solution or the recombinant expression plasmid obtained by the construction method described in the above technical solution into Saccharomyces cerevisiae.

[0012] Preferably, the Saccharomyces cerevisiae comprises Saccharomyces cerevisiae INVSc1.

[0013] The present invention also provides the use of the recombinant expression plasmid described in the above technical solution, the recombinant expression plasmid obtained by the construction method described in the above technical solution, or the recombinant Saccharomyces cerevisiae described in the above technical solution in catalyzing the synthesis of ursodeoxycholic acid from chenodeoxycholic acid.

[0014] The present invention also provides a method for catalyzing chenodeoxycholic acid to synthesize ursodeoxycholic acid, comprising the following steps:

[0015] The recombinant cerevisiae yeast described in the above technical solution is inoculated into a liquid culture medium for fermentation culture to obtain a fermentation culture solution, and the fermentation culture solution is mixed with chenodeoxycholic acid and galactose for fermentation conversion culture to obtain ursodeoxycholic acid.

[0016] Preferably, the liquid culture medium includes YPD liquid culture medium; the addition amount of chenodeoxycholic acid is 4.0-6.0 g / L; the volume percentage of galactose added is 1-3%; the fermentation culture conditions include fermentation at 28-30° C. for 24 hours; and the fermentation conversion culture conditions are fermentation and conversion at 28-30° C. for 72 hours.

[0017] The present invention also provides a method for separating ursodeoxycholic acid, comprising the following steps:

[0018] The fermentation liquid obtained by fermentation conversion culture in the method described in the above technical solution is extracted with ethyl acetate to obtain ursodeoxycholic acid.

[0019] The present invention provides a recombinant expression plasmid that catalyzes the synthesis of ursodeoxycholic acid from chenodeoxycholic acid. The recombinant expression plasmid of the present invention is stable, the culture medium used for fermentation is simple, the cost is low, and after being transferred into Saccharomyces cerevisiae, efficient production of ursodeoxycholic acid can be achieved. Specifically, the present invention uses molecular cloning technology to construct the genes of two dehydrogenases, E7αHSDH and Rt7βHSDH, into a dual-promoter vector (pESC-URA) to obtain a recombinant expression plasmid (pEU-E7α-Rt7β-HSDH). The recombinant plasmid pEU-E7α-Rt7β-HSDH is transformed into Saccharomyces cerevisiae INVSc1 to obtain recombinant Saccharomyces cerevisiae ZL51CU, and CDCA is converted into UDCA using ZL51CU whole cells as a catalyst. The fermentation product is extracted from the fermentation broth using ethyl acetate, and the conversion of the fermentation product is analyzed by TLC and HPLC.

[0020] Test results show that under the conditions of a substrate CDCA concentration of 4 g / L and an inducer galactose concentration of 2%, the substrate is converted in YPD medium for 3 days using whole cells of Saccharomyces cerevisiae containing the recombinant expression plasmid of the present invention as a catalyst, and the CDCA conversion rate can reach as high as 94.9%, and the UDCA yield is 83.0%. The fermentation medium used in the present invention is simple, the reaction can be carried out at a constant temperature, and high-purity ursodeoxycholic acid can be obtained by directly extracting the fermentation broth obtained by the fermentation conversion without the need for centrifugation to collect cells. In addition, the present invention does not require the addition of expensive cofactors and has low economic cost. The present invention provides a new method for synthesizing UDCA and has great reference significance for future industrial applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 A diagram of the cascade reaction catalyzed by the 7αHSDH and 7βHSDH enzymes provided by the present invention;

[0023] Figure 2 Schematic diagram of the construction of the pEU-E7α-Rt7β-HSDH recombinant plasmid provided by the present invention;

[0024] Figure 3 The figure below shows the enzyme digestion verification result of the pEU-E7α-Rt7β-HSDH recombinant plasmid provided by the present invention; the left figure shows the enzyme digestion verification result of the single gene plasmid obtained by integrating the E7αHSDH gene into the pESC-URA vector. In the figure below, M: GeneRuler TM 1kb DNA Ladder; 1-4: pEU-E7α-HSDH; The right picture shows the enzyme digestion verification result of integrating the Rt7βHSDH gene into the pEU-E7α-HSDH vector to obtain a double-gene plasmid. In the right picture, M: GeneRuler TM 1kb DNALadder;1-3:pEU-E7α-Rt7β-HSDH;

[0025] Figure 4 PCR verification results of E7αHSDH (left) and Rt7βHSDH (right) genes in the recombinant yeast ZL51CU of Saccharomyces cerevisiae provided by the present invention; wherein, in the left figure, M: GeneRuler TM 1kb DNA Ladder; B: INVScI-pESC-URA provides a template as a control; 1-6: INVScI-pEU-E7α-Rt7β-HSDH provides a template to verify the E7αHSDH target gene; in the right figure, M: GeneRuler TM 1kb DNA ladder; B: INVScI-pESC-URA provided the template as a control; C: INVScI-pEU-E7α-HSDH provided the template as a control; 1-6: INVScI-pEU-E7α-Rt7β-HSDH provided the template to verify the Rt7βHSDH target gene;

[0026] Figure 5 This is a TLC analysis result diagram of the synthesis of UDCA from CDCA provided by the present invention; wherein, C: CDCA; U: UDCA; M: CDCA and UDCA; 1-2: INVSc1-pESC-URA; 3-4: INVSc1-pEU-E7α-HSDH; 5-6: INVSc1-pEU-E7α-Rt7β-HSDH; i.e., the recombinant strain ZL51CU;

[0027] Figure 6This is a graph showing the HPLC analysis results of the synthesis of UDCA from CDCA provided by the present invention. DETAILED DESCRIPTION

[0028] The present invention provides a recombinant expression plasmid that catalyzes the synthesis of ursodeoxycholic acid from chenodeoxycholic acid. The recombinant expression vector is based on a dual-promoter vector and is linked to genes for two dehydrogenases, E7αHSDH and Rt7βHSDH. In the present invention, the dual-promoter vector preferably comprises pESC-URA. The genes for E7αHSDH and Rt7βHSDH described in the present invention are preferably derived from E. coli MG1655 and Ruminococcus torques, respectively. The amino acid sequence of E7αHSDH of the present invention is shown in SEQ ID NO.5, and its corresponding nucleotide sequence is shown in SEQ ID NO.6. The amino acid sequence of Rt7βHSDH of the present invention is shown in SEQ ID NO.7, and its corresponding nucleotide sequence is shown in SEQ ID NO.8. The present invention does not particularly limit the source of the pESC-URA dual-promoter vector; conventional commercially available products can be used, such as those purchased from Shanghai Baifeng Biotechnology Co., Ltd. The present invention preferably uses the pESC-URA dual-promoter vector stored in the Steroid Microbial Transformation Laboratory, School of Chemical Engineering and Materials, Tianjin University of Science and Technology.

[0029] The cascade reaction catalyzed by the 7αHSDH and 7βHSDH enzymes of the present invention is as follows: Figure 1 shown.

[0030] The present invention also provides a method for constructing the recombinant expression plasmid described in the above technical solution, comprising the following steps:

[0031] The E7αHSDH gene was amplified by PCR, and the amplified E7αHSDH gene and the dual-promoter vector (pESC-URA) were digested with enzymes respectively. The digested E7αHSDH gene and the dual-promoter vector were ligated to obtain a recombinant plasmid (pEU-E7α-HSDH);

[0032] The Rt7βHSDH gene was amplified by PCR, and the amplified Rt7βHSDH gene and the recombinant plasmid (pEU-E7α-HSDH) were respectively digested with enzymes. The digested Rt7βHSDH gene and the digested recombinant plasmid were ligated to obtain a recombinant expression plasmid (pEU-E7α-Rt7β-HSDH).

[0033] In the present invention, the primers used for PCR amplification of the E7αHSDH gene preferably include E-7α-F and E-7α-R; the nucleotide sequence of the E-7α-F is shown in SEQ ID NO.1, and the nucleotide sequence of the E-7α-R is shown in SEQ ID NO.2;

[0034] The primers used for PCR amplification of the Rt7βHSDH gene preferably include R-7β-F and R-7β-R; the nucleotide sequence of the R-7β-F is shown in SEQ ID NO.3, and the nucleotide sequence of the R-7β-R is shown in SEQ ID NO.4.

[0035] The present invention does not particularly limit the conditions for PCR amplification, and conventional PCR amplification conditions well known to those skilled in the art can be used. The present invention does not particularly limit the conditions for enzyme digestion and ligation reactions, and conventional enzyme digestion and ligation reaction conditions well known to those skilled in the art can be used.

[0036] The invention constructs a double-gene single plasmid, the plasmid is stable, the culture medium used for fermentation is simple, and the cost is low.

[0037] The present invention also provides a recombinant Saccharomyces cerevisiae that catalyzes the conversion of chenodeoxycholic acid to ursodeoxycholic acid. The recombinant Saccharomyces cerevisiae is constructed by transferring the recombinant expression plasmid described in the above technical solution or the recombinant expression plasmid obtained by the construction method described in the above technical solution into Saccharomyces cerevisiae. The present invention directly utilizes recombinant Saccharomyces cerevisiae cells heterologously expressing a double dehydrogenase as a cell catalyst. The substrate CDCA and the inducer galactose are directly added to a YPD culture medium containing the recombinant Saccharomyces cerevisiae cells to convert CDCA to UDCA.

[0038] In the present invention, the brewer's yeast includes Saccharomyces cerevisiae INVSc1. The present invention has no particular limitation on the source of Saccharomyces cerevisiae INVSc1, and conventional commercial products can be used. The present invention preferably uses Saccharomyces cerevisiae INVSc1 stored in the Microbial Culture Collection Center of Tianjin University of Science and Technology.

[0039] The present invention also provides the use of the recombinant expression plasmid described in the above technical solution, the recombinant expression plasmid obtained by the construction method described in the above technical solution, or the recombinant Saccharomyces cerevisiae described in the above technical solution in catalyzing the synthesis of ursodeoxycholic acid from chenodeoxycholic acid.

[0040] The present invention also provides a method for catalyzing chenodeoxycholic acid to synthesize ursodeoxycholic acid, comprising the following steps:

[0041] The recombinant cerevisiae yeast described in the above technical solution is inoculated into a liquid culture medium for fermentation culture to obtain a fermentation culture solution, and the fermentation culture solution is mixed with chenodeoxycholic acid and galactose for fermentation conversion culture to obtain ursodeoxycholic acid.

[0042] That is, the invention utilizes recombinant saccharomyces cerevisiae to catalyze the reaction of chenodeoxycholic acid to synthesize ursodeoxycholic acid in a mixed base of liquid culture medium and galactose.

[0043] In the present invention, the inoculation amount of recombinant Saccharomyces cerevisiae in the liquid culture medium is preferably 1-3%, more preferably 2%. In the present invention, the liquid culture medium preferably includes YPD liquid culture medium. In the present invention, the addition amount of chenodeoxycholic acid is preferably 4.0-6.0 g / L, more preferably 4.0 g / L. In the present invention, the volume percentage of galactose added is preferably 1-3%, more preferably 2%. In the present invention, the fermentation and culture conditions preferably include fermentation at 28-30°C for 24 hours, more preferably fermentation at 28°C for 24 hours. In the present invention, the fermentation and conversion culture conditions are preferably fermentation and conversion at 28-30°C for 72 hours, more preferably fermentation at 28°C for 72 hours.

[0044] The present invention also provides a method for separating ursodeoxycholic acid, comprising the following steps:

[0045] The fermentation broth obtained by the fermentation conversion culture in the method described in the above technical solution is extracted with ethyl acetate to obtain ursodeoxycholic acid. In the present invention, the amount of ethyl acetate required to extract 1 mL of fermentation broth is preferably 400 μL.

[0046] The present invention relies on the dehydrogenases 7α-hydroxysteroid dehydrogenases (7αHSDH) and 7β-hydroxysteroid dehydrogenases (7βHSDH) produced by microbial (recombinant Saccharomyces cerevisiae) fermentation to catalyze the substrate chenodeoxycholic acid (CDCA) to synthesize UDCA (i.e., directly using the whole cells of Saccharomyces cerevisiae as catalysts). The present invention puts the substrate into the culture medium and adds an inducer (galactose) to keep the cells in a viable state without the need to add expensive cofactors ((NAD(P) + The invention avoids the tedious steps of protein purification and directly extracts the recombinant Saccharomyces cerevisiae whole-cell catalyst, significantly reducing the application cost of industrial production. At the same time, the fermentation process is simple and safe.

[0047] To further illustrate the present invention, a recombinant expression plasmid, recombinant Saccharomyces cerevisiae, and transformation method for synthesizing ursodeoxycholic acid from chenodeoxycholic acid provided by the present invention are described in detail below with reference to the accompanying drawings and examples. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0048] The present invention involves strains and vectors: Saccharomyces cerevisiae INVSc1, E. coli MG1655, Tianjin University of Science and Technology Microbial Culture Collection Center; pESC-URA dual promoter vector, Tianjin University of Science and Technology College of Chemical Engineering and Materials Steroid Microbial Transformation Laboratory.

[0049] Example 1

[0050] Construction of recombinant plasmid pEU-E7α-Rt7β-HSDH

[0051] 1. PCR amplification of target fragment:

[0052] E. coli MG1655 glycerol stock was removed from a -80°C freezer and inoculated into 5 mL of LB medium at a 1% volume percentage. The cells were cultured overnight at 37°C, 200 rpm / min. 1 mL of the cells was collected and the genome was extracted using the Ezup column-based bacterial genomic DNA extraction kit (Shanghai Sangon Biotech Co., Ltd.). Successful extraction of the E. coli MG1655 genome was confirmed by agarose gel electrophoresis.

[0053] The target gene E7αHSDH was amplified by PCR using the E. coli MG1655 genome as a template. The primers were synthesized by Beijing Liuhe BGI Genomics Co., Ltd.

[0054] E-7α-F: CGCggatccATGTTTAATTCTGACAACCTGA (SEQ ID NO. 1)

[0055] E-7α-R: CGGggtaccTTAATTGAGCTCCTGTACCC (SEQ ID NO. 2)

[0056] R-7β-F: Ggaattc ATGAACTTAAGAGAAAAATACGGTGAG (SEQ ID NO.3)

[0057] R-7β-R:

[0058] ATAAGAATgcggccgcCTTACTATCTTCAACAAACTCATGAACACG(SEQ ID NO.4)

[0059] (1) PCR reaction system (25 μL):

[0060]

[0061] (2) PCR reaction conditions:

[0062]

[0063] The PCR amplified target fragment was verified to be correct by agarose gel electrophoresis, with high specificity and almost no mixed bands. It was then purified using a purification kit and stored in a -20°C refrigerator for subsequent experiments.

[0064] 1. Double enzyme digestion to prepare vector backbone:

[0065] Enzyme digestion system: (50 μL)

[0066]

[0067] According to the above enzyme digestion reaction system, the pESC-URA dual promoter vector and the E7αHSDH target gene were reacted in a 37°C water bath for 3 hours, and then purified and recovered using a small amount of DNA purification kit. The two were gel-verified and the bands were correct.

[0068] 2. Ligation reaction and colonization

[0069] Ligation system: (10 μL)

[0070]

[0071] The linearized vector pESC-URA and the target fragment E7αHSDH were ligated using the above reaction system at 22°C for 20 minutes. The cells were then transformed into E. coli by adding 10 μL of the ligation product to thawed competent E. coli JM109 cells and incubating on ice for 30 minutes. The cells were then heat-shocked at 42°C for 90 seconds, cooled for 2 minutes, and then rehydrated in 1 mL of antibiotic-free LB buffer at 37°C for 45 minutes. The resuspension buffer was then centrifuged at 5000 rpm / min, and 1 mL of the supernatant was discarded. Finally, the remaining liquid was resuspended and plated on an LB plate containing Amp (100 μg / mL) and cultured overnight at 37°C.

[0072] 3. Enzyme Digestion Verification and Sequencing

[0073] Single colonies grown on LB plates were picked and streaked densely. After plasmid extraction, double enzyme digestion with BamHI and NotI was performed for verification (double enzyme digestion verification results are shown in the table). Figure 3 In the left figure, the upper and lower bands are the vector backbone pESC-URA and the target gene E7αHSDH gene, respectively. The band sizes are consistent with the theoretical values. The plasmids with correct enzyme digestion were sent to Beijing Liuhe BGI for sequencing, and the successfully constructed plasmids were used for subsequent experiments.

[0074] At this point, the recombinant plasmid pEU-E7α-HSDH was successfully constructed. Then, based on this plasmid, the gene encoding Rt7βHSDH was successfully constructed on this plasmid according to the method of constructing this plasmid, and then the recombinant plasmid pEU-E7α-Rt7β-HSDH was obtained. The results of double enzyme digestion verification of this recombinant plasmid are shown in the figure. Figure 3 As shown in the right figure (the upper and lower bands are respectively the vector backbone pEU-E7α-HSDH and the target gene Rt7βHSDH, and the band sizes are consistent with the theoretical values), the construction process is as follows Figure 2 shown.

[0075] Example 2

[0076] pEU-E7α-Rt7β-HSDH recombinant plasmid was transformed into Saccharomyces cerevisiae using lithium acetate method

[0077] 1. Transformation of ZL51CU Saccharomyces cerevisiae:

[0078] (1) Take out three INVSc1 Saccharomyces cerevisiae competent cells from the -80°C freezer and thaw on ice for 5 minutes. Take 10 μL (100-200 ng) of the pEU-E7α-Rt7β-HSDH plasmid and add it to 50 μL of Saccharomyces cerevisiae competent cells. At the same time, add 10 μL of salmon sperm DNA and 700 μL of 1×LiAc / 40% PEG-3350 / 1×TE solution. Mix by gently pipetting and place in a 28°C constant temperature incubator for 30 minutes.

[0079] 1×LiAc / 40% PEG-3350 / 1×TE solution: Mix 8 mL of Solution 1, 1 mL of Solution 2, and 1 mL of Solution 3.

[0080] Solution 1: Weigh 1.211 g Tris and 0.37 g EDTA, dilute to 100 mL with ultrapure water, adjust the pH to 7.5 with HCl, and sterilize at 121°C for 20 min.

[0081] Solution 2: Weigh 10.202 g of LiAc, dilute to 100 mL with ultrapure water, adjust the pH to 7.5 with acetic acid, and sterilize at 121°C for 20 min.

[0082] Solution 3: 50% PEG3350: Weigh 50 g of PEG3350 and dilute it to 100 mL of ultrapure water, then sterilize it by filtering.

[0083] (2) Remove the EP tube after static culture in step (1) from the 28°C constant temperature incubator, add 88 μL of DMSO, slowly pipette and pipette to mix, then place the EP tube in a 42°C constant temperature water bath for 7 minutes, centrifuge at 14,000 rpm / min for 10 seconds, and discard the supernatant;

[0084] (3) Resuspend the yeast cell pellet obtained in step (2) after discarding the supernatant in 1 mL of pre-cooled 1×TE solution, mix well and centrifuge again, discard the supernatant, retain about 100 μL of liquid, mix well by gentle pipetting, and evenly spread on an SC plate. Incubate the plate in a 28°C constant temperature incubator for 2 to 3 days until transformants grow.

[0085] Saccharomyces cerevisiae gene extraction and PCR verification:

[0086] a. Pick several transformants from the SC plate and inoculate them onto YPD plates. Incubate at 28°C for 1-2 days. Then, pick single colonies from each YPD plate and transfer them to 5mL YPD tubes. Incubate at 28°C, 200 rpm, and shake for 24 hours. Transfer 1.5mL of the culture to a 2mL centrifuge tube and centrifuge at 14,000 rpm for 5 minutes. Remove the supernatant and remove the pellet. Repeat this step once, then add 200μL of lysis buffer and vortex to mix thoroughly.

[0087] b. Add an appropriate amount of quartz sand to the centrifuge tube to make the bacterial solution appear to be dry but not dry. After vortexing on a vortex shaker for 30 minutes, add 200 μL of lysis buffer and 5 μL of RNase. Vortex evenly on a shaker, let it stand for 5 minutes, and then centrifuge at 14,000 rpm for 12 minutes.

[0088] c. Pipette the supernatant into a new 2 mL centrifuge tube, add equal volumes of chloroform and balanced phenol, shake vigorously and evenly, centrifuge at 14000 rpm for 10 min, and repeat this step once.

[0089] d. Transfer the supernatant to a new 2 mL centrifuge tube, add an equal volume of chloroform, shake vigorously, and centrifuge at 14,000 rpm / min for 10 minutes. Transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of anhydrous ethanol, let stand at -20°C for 6 minutes, and centrifuge at 14,000 rpm / min for 5 minutes before discarding the precipitate.

[0090] e. Wash the precipitate with 1 mL of 70% ethanol and centrifuge at 14,000 rpm for 2 minutes. Discard the supernatant and centrifuge again for 30 seconds. Discard the supernatant again and air-dry in a fume hood for 10 minutes. Add 25-30 μL of ddH2O and mix thoroughly. Store at -20°C.

[0091] f. Take 1 μL of the Saccharomyces cerevisiae gene stored at -20°C in step e and perform PCR verification using the primers used in Example 1 for PCR amplification of the target fragment. The PCR system and procedure are as follows:

[0092] PCR system (10 μL):

[0093]

[0094]

[0095] PCR amplification procedure:

[0096]

[0097] g. Agarose gel electrophoresis to verify the correct PCR product (see Figure 4 ) was further sent to BGI for sequencing. The recombinant bacteria with correct sequencing were the recombinant Saccharomyces cerevisiae strain ZL51CU, and the bacteria were stored at -70℃.

[0098] Figure 4 Left: Using the genes of six selected transformants of recombinant Saccharomyces cerevisiae as PCR templates, primers that amplify E7αHSDH were used for amplification, and the target band (E7αHSDH gene) appeared in all amplifications. At the same time, INVSc1-pESC-URA (B) was used as a template as a negative control, and no target band was found, indicating that the recombinant bacteria possessed the E7αHSDH gene. Similarly, the right figure uses the genes of six selected transformants of recombinant Saccharomyces cerevisiae as PCR templates, and primers that amplify the Rt7βHSDH gene were used for amplifications. The target band (Rt7βHSDH gene) appeared in all amplifications. INVSc1-pESC-URA (B) and INVSc1-pEU-E7α-HSDH (C) transformant genes were used as negative controls, indicating that the recombinant bacteria possessed the Rt7βHSDH gene.

[0099] Figure 4 The labeled area indicates the recombinant Saccharomyces cerevisiae used as a template for PCR amplification. The position of the amplified band indicates the size of the corresponding target gene. B and C are negative controls; no target band should be produced. B represents the INVSc1-pESC-URA empty strain, and C represents the previously constructed INVSc1-pEU-E7α-HSDH recombinant strain containing the E7αHSDH gene.

[0100] Example 3

[0101] Fermentation transformation analysis of recombinant ZL51CU Saccharomyces cerevisiae

[0102] (1) TLC analysis of fermentation conversion products

[0103] An appropriate amount of cells were picked from the YPD plates of INVSc1-pESC-URA (blank control bacteria), INVSc1-pEU-E7α-HSDH (single gene control bacteria), and ZL51CU recombinant Saccharomyces cerevisiae and inoculated into 50 mL of YPD liquid culture medium. The culture was shaken in a 250 mL shake flask at 28°C for 24 h, and CDCA (concentration of 4.0 g / L, this concentration is relative to the culture medium) and galactose (concentration of 2%, this concentration is also relative to the culture medium) were added. The fermentation and conversion were continued for 72 h. After that, 1 mL of the sample was taken and the supernatant was extracted with 400 μL of ethyl acetate. The product was qualitatively analyzed by TLC. The results are as follows: Figure 5 As shown, the blank control bacteria INVSc1-pESC-URA as a catalyst neither consumed the substrate CDCA nor synthesized the product UDCA; the single-gene control bacteria INVSc1-pEU-E7α-HSDH as a catalyst converted CDCA but did not synthesize the product UDCA. The recombinant Saccharomyces cerevisiae bacteria ZL51CU as a catalyst almost completely converted CDCA into UDCA.

[0104] Figure 5 The 4‰ here means that the feed amount for this fermentation is 4g / L CDCA. Figure 5 Figures 1 and 2 represent fermentation results of S. cerevisiae containing the empty pESC-URA vector, 3 and 4 represent fermentation results of S. cerevisiae containing the pEU-E7α-HSDH recombinant plasmid, and 5 and 6 represent fermentation results of the recombinant S. cerevisiae strain ZL51CU containing the dual-gene recombinant plasmid. C represents the CDCA standard, U represents the UDCA standard, and M represents the mixed CDCA and UDCA standard. The circled bands in 5 and 6 highlight the corresponding positions of the substrate CDCA and product UDCA in the fermentation results.

[0105] (2) HPLC-ELSD analysis of fermentation conversion products

[0106] Take 1 mL of fermentation broth of recombinant Saccharomyces cerevisiae ZL51CU, extract with 400 μL of ethyl acetate, and then aspirate 100 μL of the supernatant into a clean EP tube to dry. Resuspend in 100 μL of methanol and pass through a 0.22 μm organic membrane to prepare a sample. The synthesized product was analyzed by HPLC-ELSD. The liquid chromatography detection conditions are as follows:

[0107] Chromatographic column: C18 column (4.6mm DL×250Lmm, 5μm)

[0108] Injection volume: 10 μL;

[0109] The mobile phase and elution conditions are shown in Table 1:

[0110] Table 1 Mobile phase and elution conditions

[0111]

[0112] Flow rate: 0.8 mL / min; column temperature: 30°C; evaporation temperature: 110°C; gas flow rate: 2.0 L / min.

[0113] Analysis of test results:

[0114] From the liquid phase results ( Figure 6 ) analysis showed that the conversion rate of CDCA catalyzed by the recombinant Saccharomyces cerevisiae ZL51CU was 94.9%, and the yield of UDCA was 83.0%.

[0115] Note: Figure (a) substrate CDCA standard sample, Figure (b) product UDCA standard sample, Figure (c) intermediate 7-keto-lithocholic acid (7K-LCA) standard sample, Figure (d) fermentation product of ZL51CU recombinant Saccharomyces cerevisiae.

[0116] Conversion rate = (UDCA peak area + 7K-LCA peak area) / (CDCA peak area + UDCA peak area + 7K-LCA peak area)

[0117] Yield = UDCA peak area / (CDCA peak area + UDCA peak area + 7K-LCA peak area).

[0118] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A recombinant Saccharomyces cerevisiae that catalyzes the synthesis of ursodeoxycholic acid from chenodeoxycholic acid, characterized in that: The recombinant Saccharomyces cerevisiae is constructed by transferring a recombinant expression plasmid into Saccharomyces cerevisiae; the recombinant expression vector is based on a dual-promoter vector plasmid, connected to the genes of two dehydrogenases, E7αHSDH and Rt7βHSDH; the dual-promoter vector is pESC-URA; the Saccharomyces cerevisiae is Saccharomyces cerevisiae INVSc1; the nucleotide sequence of E7αHSDH is shown in SEQ ID NO.6; the nucleotide sequence of Rt7βHSDH is shown in SEQ ID NO.

8.

2. The recombinant Saccharomyces cerevisiae according to claim 1, characterized in that The method for constructing the recombinant expression plasmid comprises the following steps: Amplifying the E7αHSDH gene by PCR, digesting the amplified E7αHSDH gene and the dual-promoter vector respectively, and ligating the digested E7αHSDH gene with the digested dual-promoter vector to obtain a recombinant plasmid; The Rt7βHSDH gene was amplified by PCR, and the amplified Rt7βHSDH gene and the recombinant plasmid were digested with enzymes respectively. The digested Rt7βHSDH gene and the digested recombinant plasmid were ligated to obtain a recombinant expression plasmid.

3. The recombinant Saccharomyces cerevisiae according to claim 2, characterized in that The primers used for PCR amplification of the E7αHSDH gene include E-7α-F and E-7α-R; the nucleotide sequence of the E-7α-F is shown in SEQ ID NO.1, and the nucleotide sequence of the E-7α-R is shown in SEQ ID NO.2; The primers used for PCR amplification of the Rt7βHSDH gene include R-7β-F and R-7β-R; the nucleotide sequence of the R-7β-F is shown in SEQ ID NO.3, and the nucleotide sequence of the R-7β-R is shown in SEQ ID NO.

4.

4. Use of the recombinant Saccharomyces cerevisiae according to any one of claims 1 to 3 in catalyzing the synthesis of ursodeoxycholic acid from chenodeoxycholic acid.

5. A method for catalyzing the synthesis of ursodeoxycholic acid from chenodeoxycholic acid, characterized in that: The following steps are involved: The recombinant cerevisiae yeast according to any one of claims 1 to 3 is inoculated into a liquid culture medium for fermentation culture to obtain a fermentation culture solution, and the fermentation culture solution is mixed with chenodeoxycholic acid and galactose for fermentation conversion culture to obtain ursodeoxycholic acid.

6. The method according to claim 5, characterized in that The liquid culture medium includes YPD liquid culture medium; the addition amount of chenodeoxycholic acid is 4.0-6.0 g / L; the volume percentage of galactose added is 1-3%; the fermentation culture conditions include fermentation at 28-30° C. for 24 hours; and the fermentation conversion culture conditions include fermentation and conversion at 28-30° C. for 72 hours.

7. A method for separating ursodeoxycholic acid, comprising the following steps: The fermentation liquid obtained by fermentation conversion culture in the method according to claim 5 or 6 is extracted with ethyl acetate to obtain ursodeoxycholic acid.

Citation Information

Patent Citations

  • Preparation method of tauroursodeoxycholic acid

    CN107287272A

  • Recombinant yeast strain for efficiently converting chenodeoxycholic acid to synthesize ursodeoxycholic acid, and construction and application of recombinant yeast strain

    CN112852652A