H3n2 canine influenza recombinant virus strain and application thereof

By constructing a recombinant H3N2 canine influenza virus strain and employing specific preparation techniques, the problem of the lack of effective canine influenza vaccines in existing technologies has been solved, achieving efficient and safe canine influenza vaccine preparation and immunization effects.

CN115725517BActive Publication Date: 2026-01-02ACAD OF MILITARY SCI PLA CHINA ACAD OF MILITARY MEDICAL SCI INST OF MILITARY VETERINARY MEDICINE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211066379.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-01
Publication Date
2026-01-02
Estimated Expiration
2042-09-01

AI Technical Summary

Technical Problem

Currently, there is a lack of effective H3N2 canine influenza vaccines. Existing influenza vaccines have complicated production processes and many uncontrollable factors. Furthermore, the canine influenza virus spreads uncontrollably among dogs, which can easily lead to viral mutations and cross-species infection in humans. Humans lack resistance to H3N2 canine influenza.

Method used

A recombinant H3N2 canine influenza virus strain was constructed using a reverse genetics operating system. A canine influenza vaccine strain with high immunogenicity and safety was prepared by recombination of the HA, NA, PB1, PB2, PA, NP, M, and NS genes. The virus droplet size and purity were improved by suspension MDCK cell culture, β-propiolactone inactivation, 300 kDa membrane concentration, and 4FF column chromatography purification techniques.

Benefits of technology

A recombinant H3N2 canine influenza vaccine with high immunogenicity and safety was obtained, which can induce high antibody levels in mice, reduce production costs, increase vaccine yield, and meet vaccine production standards.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115725517B_ABST
    Figure CN115725517B_ABST
Patent Text Reader

Abstract

The application belongs to the field of vaccines and genetic engineering technology, and relates to an H3N2 canine influenza recombinant virus strain and application thereof. Specifically, the application relates to a recombinant canine influenza vaccine strain which is obtained by recombination of the following genes: an HA gene, an NA gene, a PB1 gene, a PB2 gene, a PA gene, an NP gene, an M gene and an NS gene; wherein the sequence of the HA gene is shown as SEQ ID NO:1; and / or the sequence of the NA gene is shown as SEQ ID NO:2. The application also relates to an H3N2 canine influenza recombinant vaccine and a method for preparing the H3N2 canine influenza recombinant vaccine.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of vaccine and genetic engineering technology, and relates to an H3N2 canine influenza recombinant virus strain and application thereof. The present application also relates to an H3N2 canine influenza recombinant vaccine and a method for preparing the H3N2 canine influenza recombinant vaccine. BACKGROUND

[0002] Influenza virus (IV) belongs to Orthomyxoviridae, and has a diameter of 80-120 nm. Its structure is divided into three parts from inside to outside, namely nucleoprotein (NP), matrix protein (M) and envelope. Its genome RNA is composed of eight segments of single-stranded RNA, which are PB2, PB1, PA, HA, NP, NA, M and NS genes. Currently, 18 HA subtypes and 11 NA subtypes of A influenza virus have been found, among which H1-H16 HA subtypes and N1-N9 NA subtypes are derived from avian influenza, and H17N10 and H18N11 subtypes are only found in bats. Currently, H3, H6 and H9 subtypes of influenza virus can cause canine infection, among which H3 subtype has been confirmed as a unique strain capable of stable transmission in vivo, which is called canine influenza virus (CIVs), and is derived from equine H3N8 and avian H3N2.

[0003] Without secondary infection, H3N2 canine influenza virus only shows mild / moderate respiratory symptoms in clinic, and the symptoms disappear in 3-5 days, and the mortality rate is only 2%-2.5%. This influenza virus with low pathogenicity to dogs is easy to be ignored, and the virus is quietly spread, spread and prevalent in the dog population. However, this uncontrolled prevalence and spread among populations provides opportunities for virus variation and recombination. In addition, for a long time, people believe that dogs do not have the ability to be infected with influenza. Canine influenza has attracted people's attention since the first outbreak of canine influenza, because dogs can also bind SA-α-2,3-Gal and SA-α-2,6-Gal receptors. Dogs have become a potential "mixer" of influenza virus.

[0004] Dogs are important animal companions for humans, and there are as many as 900 million domesticated dogs worldwide. The form of dog raising in China is complex, including pet dogs, farm dogs (guard dogs), meat dogs and stray dogs in cities. In most cases, pet dogs in cities live with humans in the same room, and this close contact with humans promotes the possibility of human-dog influenza transmission. Once H3N2 CIVs appears to cross-species infect humans, human H3 seasonal influenza antibodies do not have the ability to resist H3N2 CIVs attack. Cutting off the source of infection from the source is an important means of preventing influenza. It is urgent to vaccinate dogs against influenza virus as soon as possible.

[0005] However, there is no approved canine influenza vaccine in China at present, and there is still a gap in the prevention of H3N2 canine influenza. It is of great public health significance to rapidly develop canine influenza vaccine to fill the gap in prevention and control. In addition, most of the existing clinical human and veterinary influenza vaccines use chicken embryo medium to amplify the immunogen, but the production process is complicated, uncontrollable factors are many, and antigen variation occurs, etc.

[0006] The rescue system of influenza virus constructed by reverse genetic system is the embodiment of early reverse genetic technology. Subsequently, reverse genetic systems such as rabies and Newcastle disease were established. The application and achievements of the influenza virus reverse genetic system are more remarkable, such as the study of influenza virus enhancement / attenuation by reverse genetic system. Type A influenza virus is a segmented RNA virus, and in the natural environment, two or more than two influenza viruses infect host cell receptors at the same time, which is particularly prone to genetic reassortment. It is just by taking advantage of this point that the reverse genetic system of type A influenza virus is first established. SUMMARY

[0007] The present inventors have established and obtained a canine influenza recombinant virus strain, i.e., H3N2 canine influenza recombinant virus strain, by using reverse genetic operation system through in-depth research and creative labor. The present inventors have surprisingly found that the canine influenza recombinant virus strain has good immunogenicity, can induce a higher antibody level in the body, and has high safety, and has good potential for preparing canine influenza vaccine. The recombinant canine influenza virus strain of the present application is also called recombinant canine influenza vaccine strain, which is abbreviated as canine influenza vaccine strain. The following invention is provided:

[0008] One aspect of the present application relates to a recombinant canine influenza vaccine strain, which is obtained by recombination of the following genes:

[0009] HA gene, NA gene, PB1 gene, PB2 gene, PA gene, NP gene, M gene, and NS gene;

[0010] Among them,

[0011] The sequence of the HA gene is shown in SEQ ID NO: 1; and / or

[0012] The sequence of the NA gene is shown in SEQ ID NO: 2.

[0013] In some embodiments of the present application, the canine influenza vaccine strain, wherein,

[0014] The sequence of the PB1 gene is shown in SEQ ID NO: 3;

[0015] The sequence of the PB2 gene is shown in SEQ ID NO: 4.

[0016] The sequence of the PA gene is set forth in SEQ ID NO: 5;

[0017] The sequence of the NP gene is set forth in SEQ ID NO: 6;

[0018] The sequence of the M gene is set forth in SEQ ID NO: 7; and / or

[0019] The sequence of the NS gene is set forth in SEQ ID NO: 8.

[0020] The sequence of the HA gene is

[0021]

[0022] Sequence of the NA gene

[0023]

[0024] Sequence of the PB1 gene

[0025]

[0026] Sequence of the PB2 gene

[0027]

[0028] Sequence of the PA gene

[0029]

[0030] Sequence of the NP gene

[0031]

[0032] Sequence of M gene

[0033]

[0034] Sequence of the NS gene

[0035] AGCAAAAGCAGGGTGACAAAGACATAATGGATCCAAACACTGTGTCAAGCTTTCAGGTAGATTGCTTTCTTTGGCATGTCCGCAAACGAGTTGCAGACCAAGAACTAGGTGATGCCCCATTCCTTGATCGGCTTCGCCGAGATCAGAAATCCCTAAGAGGAAGGGGCAGCACTCTCGGTCTGGACATCGAGACAGCCACACGTGCTGGAAAGCAGATAGTGGAGCGGATTCTGAAAGAAGAATCCGATGAGGCACTTAAAATGACCATGGCCTCTGTACCTGCGTCGCGTTACCTAACTGACATGACTCTTGAGGAAATGTCAAGGGACTGGTCCATGCTCATACCCAAGCAGAAAGTGGCAGGCCCTCTTTGTATCAGAATGGACCAGGCGATCATGGATAAGAACATCATACTGAAAGCGAACTTCAGTGTGATTTTTGACCGGCTGGAGACTCTAATATTGCTAAGGGCTTTCACCGAAGAGGGAGCAATTGTTGGCGAAATTTCACCATTGCCTTCTCTTCCAGGACATACTGCTGAGGATGTCAAAAATGCAGTTGGAGTCCTCATCGGAGGACTTGAATGGAATGATAACACAGTTCGAGTCTCTGAAACTCTACAGAGATTCGCTTGGAGAAGCAGTAATGAGAATGGGAGACCTCCACTCACTCCAAAACAGAAACGAGAAATGGCGGGAACAATTAGGTCAGAAGTTTGAAGAAATAAGATGGTTGATTGAAGAAGTGAGACACAAACTGAAGATAACAGAGAATAGTTTTGAGCAAATAACATTTATGCAAGCCTTACATCTATTGCTTGAAGTGGAGCAAGAGATAAGAACTTTCTCGTTTCAGCTTATTTAATAATAAAAAACACCCTTGTTTCTACT (SEQ ID NO: 8)

[0036] In some embodiments of the present application, the canine influenza vaccine strain further comprises a nucleoprotein, a matrix protein and an envelope.

[0037] In some embodiments of the present application, the canine influenza vaccine strain has a virus particle of 80-120 nm, 90-110 nm, 95-105 nm or 100 nm.

[0038] In some embodiments of the present application, the canine influenza vaccine strain is a recombinant H3N2 canine influenza vaccine strain.

[0039] In some embodiments of the present application, the canine influenza vaccine strain further comprises backbone plasmids pHH21-NS, pHH21-PB1, pHH21-PB2, pHH21-M, pHH21-NP, pHH21-PA; four auxiliary plasmids pCAGGS-NP, pCAGGS-PA, pCAGGS-PB1 and pCAGGS-PB2, and a HAT plasmid.

[0040] In some embodiments of the present application, the canine influenza vaccine strain is deposited with the China General Microbiological Culture Collection Center (CGMCC) on June 24, 2021, and has a deposit number of CGMCC No. 21899.

[0041] Another aspect of the present application relates to a canine influenza virus liquid prepared from the canine influenza vaccine strain of any one of the present application;

[0042] Preferably, the canine influenza virus liquid is prepared by the following steps:

[0043] (1) culturing the canine influenza vaccine strain of any one of the present application to obtain a virus liquid;

[0044] (2) inactivating the virus liquid to obtain an inactivated virus liquid; optionally, concentrating the inactivated virus liquid to obtain a concentrated liquid;

[0045] (3) purifying the inactivated virus liquid or the concentrated liquid thereof to obtain a purified virus liquid.

[0046] In some embodiments of the present application, the canine influenza virus liquid, wherein,

[0047] In step (1), the canine influenza vaccine strain is cultured in a medium of suspended MDCK cells; preferably, the culture conditions are 37°C, 5% CO2, Do 60%, 120 rpm, and the culture time is 48-72 hours.

[0048] In some embodiments of the present application, the canine influenza virus liquid, wherein,

[0049] In step (2), β-propiolactone is used for inactivation.

[0050] Preferably, the ratio of beta-propiolactone: virus liquid (v / v) is 1:1500;

[0051] Preferably, the beta-propiolactone is mixed with the virus liquid and then inactivated at 4°C.

[0052] In some embodiments of the application, the canine influenza virus liquid, wherein,

[0053] In step (2), the inactivated virus liquid is concentrated using a 300 KDa membrane pack to obtain a concentrated liquid;

[0054] Preferably, the concentration is 20-30 fold;

[0055] Preferably, the concentration is 24 fold.

[0056] In some embodiments of the application, the canine influenza virus liquid, wherein,

[0057] In step (3), the purification is performed using a 4FF as a column chromatography medium;

[0058] Preferably, the purified HA titer is greater than or equal to 8192.

[0059] The present application also relates to a method for preparing a canine influenza virus liquid, comprising the steps described above.

[0060] In another aspect, the present application relates to a canine influenza virus vaccine composition comprising the canine influenza virus liquid of any one of the present application, and one or more pharmaceutically acceptable adjuvants, such as an aluminum hydroxide adjuvant;

[0061] Preferably, the canine influenza virus vaccine composition is a canine influenza virus vaccine formulation;

[0062] Preferably, the unit dose of the canine influenza virus vaccine composition is 2560 HAUs-5120 HAUs.

[0063] In another aspect, the present application relates to the use of the canine influenza vaccine strain of any one of the present application for the preparation of a canine influenza virus vaccine;

[0064] Preferably, the canine influenza virus vaccine is an inactivated vaccine;

[0065] Preferably, the canine immunization dose is 2560 HAUs / animal-5120 HAUs / animal;

[0066] Preferably, the canine influenza virus vaccine is administered subcutaneously.

[0067] The application takes a new H3N2 subtype canine influenza virus QIAOKE01 strain isolated from a throat swab of a canine with respiratory symptoms as a parent strain, adopts an A / PueaoRico / 8 / 31 (PR8) reverse genetic operation system, and constructs a HA and NA of the parent virus QIAOKE01 strain into a vaccine skeleton as donor genes to rescue a recombinant H3N2 CIVs candidate vaccine strain based on the PR8 / 31 system.

[0068] The application uses suspended MDCK cells as a medium to amplify, and can obtain a high-titer virus liquid with an HA hemagglutination titer of 2048, which is 4 times that of a chicken embryo medium. The use of the suspended cell culture technology reduces the production cost and has a significant effect on improving the vaccine yield. There is no antigen difference between the inactivated candidate vaccine strain and the parent strain. The 24-fold concentration is performed through a 300KDa membrane bag, and the 4FF is used as a column chromatography medium for purification, and the HA titer after purification is 8192, reaching the vaccine production standard. The cell medium of the influenza virus takes MDCK as a preferred cell line, the MDCK suspended cell technology is combined with the serum-free culture medium process to simplify the production cost and improve the yield, and the application prospect is very broad.

[0069] The application uses a mouse body as a model, and the highest antibody level can be obtained by subcutaneous injection, and reaches 1:1024 after 42 days. The immune dose of 256 HAUs can completely resist the infection of a 10x MLD50 virulent strain. It can be seen that the candidate vaccine strain 32Q-PR8 based on the PR8 / 31 skeleton constructed by the reverse genetic technology and taking the new H3N2 canine influenza QIAOKE01 as a parent strain can induce a higher antibody level in the body.

[0070] Based on the mouse immune results, the application performs a test research on target animals, first, the best immune dose is screened, and it is finally determined that 2560 and 5120 HAUs can induce a high-efficiency antibody in the body and can resist the infection of the epidemic strain QIAOKE01, among 640, 1280, 2560 and 5120 UHAs four immune doses. The antibody correlation research shows that when the HI (hemagglutination inhibition) antibody titer is 1:64, the protection rate is 80%, and when the antibody level is below 1:32, the ability to resist the epidemic strain is not possessed. At the same time, the safety evaluation of the vaccine is verified by the safety test of the single-dose repeated inoculation and the once super-dose inoculation of the mice and beagles, and it is verified that the candidate vaccine strain 32Q-PR8 cooperated with the aluminum hydroxide gel adjuvant has good safety.

[0071] The application carries out the canine immune duration and immune protection test with 2560 HAUs as the immune dose for preparing the immunogen. The antibody reaches the peak value at 30 days after the immunization, the peak value is maintained to 60 days, the 90 days starts to be in the descending trend, but the antibody level is maintained between 256-1024, when the 120 days, the HI antibody level can be maintained above 256, and can completely resist the attack of the QIAOKE01 epidemic strain QIAOKE01. The HI antibody is between 64-256 at the 150 days, after the attack of the QIAOKE01 strain, only one has the body temperature rise, but the body temperature is recovered to normal. The protection rate is 80% at the 180 days. After the attack, one has the typical respiratory symptom and the increased excretion amount, the dog has the HI antibody of 64 at the 180 days. It can be seen that the minimum immune dose of the new type H3N2 canine influenza virus vaccine candidate strain (32Q-PR8 strain) for the dog is 2560 HAUs.

[0072] In addition, the preservation period research result shows that, in the 2-8℃ environment, it can be preserved for 12 months, completely meets the vaccine production standard, and is suitable for large-scale production. BRIEF DESCRIPTION OF DRAWINGS

[0073] Figure 1 : The HA and NA recombinant plasmid identification result provided by the embodiment 1 of the application.

[0074] Figure 2: The recombinant virus 32Q-PR8 strain cytopathic effect provided by the embodiment 2 of the application, in the figure, A is the cytopathic effect, and B is the normal cell.

[0075] Figure 2A : A is the MDCK cell infected with the recombinant virus.

[0076] Figure 2B : B is the normal MDCK cell.

[0077] Figure 3 : The PCR amplification result of the 8 gene fragments provided by the embodiment 2 of the application.

[0078] Figure 4 : The electron microscope photo of the recombinant influenza virus 32Q-PR8 strain provided by the embodiment 2 of the application.

[0079] Figure 5 : The virus particle electron microscope photo after the inactivation provided by the embodiment 4 of the application.

[0080] Figure 6 : The mouse survival curve change result provided by the embodiment 6 of the application.

[0081] Figure 7 : The mouse weight change result provided by the embodiment 6 of the application.

[0082] Figure 8The HI antibody titer determination results provided by the embodiment 6 of the present application.

[0083] Figure 9 The body temperature changes of the immunized dogs after challenge provided by the embodiment 6 of the present application. A-PBS is the body temperature change curve of the challenge protection experiment after injection with PBS; B-640 is the body temperature change curve of the challenge protection experiment after immunization with 640 HAUs of inactivated vaccine; C-1280 is the body temperature change curve of the challenge protection experiment after immunization with 1280 HAUs of inactivated vaccine; D-2560 is the body temperature change curve of the challenge protection experiment after immunization with 2560 HAUs of inactivated vaccine; E-5120 is the body temperature change curve of the challenge protection experiment after immunization with 5120 HAUs of inactivated vaccine; and control is the body temperature change curve of the dog without challenge.

[0084] Figure 10 The virus discharge conditions of the immunized dogs after challenge provided by the embodiment 6 of the present application. A-PBS is the virus titer of the challenge protection experiment after injection with PBS; B-640 is the virus titer of the challenge protection experiment after immunization with 640 HAUs of inactivated vaccine; C-1280 is the virus titer of the challenge protection experiment after immunization with 1280 HAUs of inactivated vaccine; D-2560 is the virus titer of the challenge protection experiment after immunization with 2560 HAUs of inactivated vaccine; E-5120 is the virus titer of the challenge protection experiment after immunization with 5120 HAUs of inactivated vaccine; and control is the virus titer of the dog without challenge.

[0085] Figure 11 The HI antibody growth and decline rules of the canine influenza virus provided by the embodiment 9 of the present application.

[0086] Figure 12 The body temperature changes of the Part 1 group, the Part 2 group and the Part 3 group after challenge provided by the embodiment 9 of the present application. Part 1-120 is the body temperature change of the immunized protection experiment dog after immunization for 120 days; Part 2-150 is the body temperature change of the immunized protection experiment dog after immunization for 150 days; Part 3-180 is the body temperature change of the immunized protection experiment dog after immunization for 180 days; virus is the body temperature change of the dog after challenge without immunization; and control is the body temperature change of the blank control dog.

[0087] Figure 13Part 1 group, Part 2 group and Part 3 group provided by the embodiment 9 of the present application are provided. Part 1-120 is the virus titer of the nasopharyngeal swab of the experimental dog after immunization for 120 days; Part 2-150 is the virus titer of the nasopharyngeal swab of the experimental dog after immunization for 150 days; Part 3-180 is the virus titer of the nasopharyngeal swab of the experimental dog after immunization for 180 days; virus is the virus titer of the nasopharyngeal swab of the dog after challenge without immunization; control is the virus titer of the nasopharyngeal swab of the blank control dog.

[0088] A H3N2 subtype canine influenza virus strain (QIAOKE01) was deposited with the China General Microbiological Culture Collection Center (CGMCC) on June 26, 2019, and has the accession number CGMCC No. 18171. The deposit address of the depositing unit is No. 3, Yikhina Street, Beijing City, Chaoyang District, China Institute of Microbiology, Chinese Academy of Sciences, and the postcode is 100101.

[0089] A H3N2 subtype canine influenza virus strain (QIAOKE01) was deposited with the China General Microbiological Culture Collection Center (CGMCC) on June 26, 2019, and has the accession number CGMCC No. 18171. The deposit address of the depositing unit is No. 3, Yikhina Street, Beijing City, Chaoyang District, China Institute of Microbiology, Chinese Academy of Sciences, and the postcode is 100101. DETAILED DESCRIPTION

[0090] The embodiments of the present application will be described in detail below with reference to the examples, but those skilled in the art will understand that the following examples are only for illustration of the present application and should not be regarded as limiting the scope of the present application. If the specific conditions are not specified in the examples, the conventional conditions or the conditions recommended by the manufacturer are used. If the manufacturer of the reagent or instrument is not specified, it is a conventional product that can be obtained by purchase.

[0091] Example 1: Construction of recombinant plasmids HA-PR8 / 31 and NA-PR8 / 31

[0092] 1. Amplification and purification of the target fragment

[0093] The primer sequences for amplifying the full-length HA (accession number MZ948851) and the full-length NA (accession number MZ948853) of the H3N2 subtype canine influenza virus strain QIAOKE01 (accession number CGMCC No. 18171) were designed, and a Bsmb I enzyme cutting site (CGTCTC) was added at the 5'-end of the HA primer, and a Bsa I enzyme cutting site (GGTCTC) was added at the 5'-end of the NA primer. The H3N2 canine influenza HA and NA full-length sequence primers were synthesized, and the details are shown in Table 1.

[0094] Table 1: H3N2 canine influenza HA, NA full-length sequence primers

[0095]

[0096]

[0097] Note: The underlined part is the enzyme digestion site

[0098] The H3N2 canine influenza QIAOKE01 strain was used as the parent strain to extract viral nucleic acid, and the reverse transcription product was used as the template. The HA and NA fragments were amplified by using full-length primers and ultra-fidelity Phusion DNA polymerase. The PCR process was performed according to the Phusion enzyme instructions. The reaction system was as follows: cDNA 1 μL, 10 μM forward / reverse primers 2.5 μL each, 10 mM dNTPs 1 μL, 5×Phusion HF buffer 10 μL, Phusion DNA polymerase 1 μL, and dd H2O was added to 50 μL. The PCR reaction parameters were set as follows: 98℃, 30 s→ 98℃, 5-10 s; 55℃, 20 s; 72℃, 1 min 30 s (35 cycles)→ 72℃, 7 min.

[0099] After the PCR reaction, 10 μL of 6×DNA Loading Buffer was added to the PCR product, which was gently mixed and then subjected to 1% agarose gel electrophoresis. After electrophoresis, the target fragment was purified and recovered by using a DNA Gel Extraction Kit.

[0100] 2. Enzymatic digestion and ligation transformation

[0101] The PCR product of the recovered HA fragment was subjected to BsmB I enzyme digestion. The PCR product of the NA fragment was subjected to Bsa I enzyme digestion. The reaction system is shown in Table 2.

[0102] Table 2: BsmBI, BsaI enzyme digestion system

[0103] Ingredient Volume Gel recovery product 2 μg NEB Buffer 3.1 5 μL NEB BsmBI 2 μL ddH2O Make up to 50 μL

[0104] The prepared system was subjected to enzyme digestion at 55℃ in a water bath for 5 h, and then the target fragment was purified by 1% agarose gel electrophoresis and gel recovery.

[0105] The purified enzyme digestion product was ligated with the linearized vector of A / PueaoRico / 8 / 31 (PR8), and the reaction system is shown in Table 3. The above system was placed in a 16℃ metal bath for 12 h to complete the transformation ligation.

[0106] Table 3: Ligation reaction system

[0107] Ingredient Volume Linearized vector 1 μL Insert fragment 5 μL T4 Ligase Buffer 1 μL T4 DNA Ligase 1 μL ddH2O Make up to 10 μL

[0108] 3. Identification of recombinant plasmid

[0109] The growth of colonies in the plate was observed by naked eyes, and a single colony was picked and placed in LB medium containing ampicillin. After 5-6 h of culture at 37°C with shaking at 200 rpm, PCR identification was performed using specific primers. The system was prepared as shown in Table 4.

[0110] Table 4: PCR reaction system of FastPfu DNA enzyme

[0111] Ingredient Volume Bacterial solution 1 μL 10 μM forward primer 1 μL 10 μM reverse primer 1 μL 2.5 mM dNTPs 2 μL 5x FastPfu Buffer 10 μL FastPfu polymerase 1 μL ddH2O Make up to 25 μL

[0112] The PCR reaction parameters were set as follows: 98°C for 2 min, 94°C for 30 s, 55°C for 30 s, 72°C for 180 s (33 cycles), and 72°C for 7 min.

[0113] After the PCR reaction, 10 μL of 6×DNA Loading Buffer was added to the PCR product, which was mixed gently and then subjected to 1% agarose gel electrophoresis. The bacterial liquid identified as positive was subjected to sequencing, and the remaining bacterial liquid was stored at 4°C. The plasmid was extracted after correct sequencing and alignment.

[0114] Results: After the JM109 competent cells were transformed with the ligated and purified HA and NA and the PR8 / 31 vector, the bacteria were identified correctly, and the plasmid was extracted and identified to obtain a fragment consistent with the expected purpose, as shown in Figure 1 . Sequence identification showed that the HA and NA sequences of the parent strain QIAOKE01 were consistent, and there was no amino acid site mutation. The PR8 / 31 system recombinant plasmid of the canine influenza virus H3, N2 gene was successfully constructed and was named HA-PR8 / 31 and NA-PR8 / 31, respectively, which were used in Example 2 below.

[0115] Example 2: Rescue of recombinant H3N2 CIVs virus strains

[0116] 1. Cell recovery

[0117] The 293T and MDCK cells stored in a liquid nitrogen tank were taken out and quickly placed in a 37°C water bath for thawing. The cell cryotube was gently shaken to quickly melt, and then centrifuged at 1500 rpm for 10 min. The cell supernatant was discarded, and 2 mL of serum-free DMEM culture solution was gently resuspended. The cells were inoculated into a T25 cell culture bottle (293T used a polylysine-coated cell bottle), and 5 ml of DMEM (10% FBS) culture medium was added. The mixture was mixed gently and placed horizontally in a 37°C, 5% CO2 incubator. After 12 h of culture, the cell morphology was observed, and the cell culture solution was replaced and the cells were further cultured to form a monolayer.

[0118] 2. Transfection

[0119] Newly recovered 293T cells were passaged at 72 hours of culture, and re-digested at 24 hours after passage, and transferred to a 6-well plate coated with polylysine. After 12 hours of continued culture, the transfection operation was performed, and the specific scheme was as follows: the plasmids 32HA-PR8 / 31 and 32NA-PR8 / 31 prepared in Example 1 were mixed with the backbone plasmids pHH21-NS, pHH21-PB1, pHH21-PB2, pHH21-M, pHH21-NP, and pHH21-PA in the PR8 / 31 system, and four auxiliary plasmids pCAGGS-NP, pCAGGS-PA, pCAGGS-PB1, and pCAGGS-PB2, and a HAT plasmid, and the transfection plasmids were added to a centrifuge tube containing P3000 (2 μL / μg DNA) and Lipofectamine 3000 transfection reagent 18.9 μl, and gently mixed for 5-6 times, and left to stand at room temperature for 30 min. The mixed solution was slowly added to the 293T 6-well plate, and the plate was gently shaken 2-3 times, and placed in a 5% CO2 incubator at 37°C for 72 h, and the supernatant was aspirated and added to a prepared 96-well V-shaped hemagglutination plate, and hemagglutination was determined. The transfected 293T cells were obtained.

[0120] Characteristics of recombinant H3N2 CIVs vaccine strain candidate:

[0121] The plasmids 32HA-PR8 / 31 and 32NA-PR8 / 31 constructed in Example 1 using the QIAOKE01 epidemic strain as the donor were mixed with the other six gene fragment plasmids (pHH21-NS, pHH21-PB1, pHH21-PB2, pHH21-M, pHH21-NP, and pHH21-PA) in the PR8 / 31 system, four auxiliary plasmids (pCAGGS-NP, pCAGGS-PA, pCAGGS-PB1, and pCAGGS-PB2), and a HAT plasmid, and co-transfected 293T cells, and the hemagglutination titer was determined to be 2 5 after 72 hours. The supernatant was inoculated on MDCK cells, and typical cytopathic effects such as Figure 2A and Figure 2B were observed after 72 h of culture. The supernatant was taken for RT-PCR product electrophoresis to obtain the target gene fragment, as shown in Figure 3 . All the gene fragments were sequenced and analyzed for site mutations. The HA titer was determined to be 512, and the virus content was determined to be 10 7.50 TCID50 / ml.

[0122] Phosphotungstic acid negative staining electron microscopy observation of the recombinant canine influenza virus 32Q-PR8 strain showed that the morphology was complete, the size was about 100 nm, and it was a typical orthomyxovirus-like particle with round or polymorphic shape, and had filopodia, as shown in Figure 4 .

[0123] The recombinant H3N2 canine influenza virus vaccine candidate strain was successfully rescued using QIAOKE01 as the parent strain and PR8 / 31 as the backbone, and was named A / Canine / Qiaoke32Q-PR8 / 2019(H3N2), abbreviated as 32Q-PR8. The canine influenza virus H3N2 subtype recombinant vaccine strain 32Q-PR8 was deposited with the China General Microbiological Culture Collection Center (CGMCC) on June 24, 2021, and the deposit number is CGMCC No. 21899. The address of the depositing unit is No. 1, Beichen West Road, Yard 3, Beijing Chaoyang District, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China.

[0124] Antigenic difference comparison:

[0125] Using the standard serum of ferrets, the antigenic difference comparison between the recombinant canine influenza virus 32Q-PR8 strain and the parent virus QIAOKE01 strain showed that the HI antibody titers were both 1:2048, and there was no difference between the two, as shown in Table 5.

[0126] Table 5: Antigenic difference comparison

[0127] 32Q-PR8 recombinant virus QIAOKE01 parental virus Standard ferret serum 1:2048 1:2048

[0128] The results show that the recombinant H3N2 canine influenza virus strain 32Q-PR8 rescued using PR8 / 31 as the backbone has no antigenic difference with the new H3N2 canine influenza virus strain prevalent in China, and can be used as a vaccine candidate strain.

[0129] Example 3: Culture and identification of recombinant H3N2 CIVs vaccine candidate strains

[0130] 1. Culture of recombinant H3N2 CIVs vaccine candidate strain

[0131] The supernatant with hemagglutination positivity of the transfected 293T cells of Example 2 was inoculated into MDCK cells, and 5 ml of DMEM (2% FBS) medium containing TPCK trypsin at a final concentration of 0.2 μg / ml was added. It was placed horizontally in a 37°C, 5% CO2 incubator and cultured for 72 h. The supernatant was collected and determined for TCID50, and the rest was aliquoted for use.

[0132] 2. Gene identification

[0133] After reverse transcription of the viral nucleic acid extracted from the above MDCK culture, PCR amplification was performed using the NP, PA, PB1, PB2, M and NS amplification primers in the PR8 / 31 system (Table 6) and the designed HA and NA primers (Table 1), and the HA and NA sequences were sequenced for sequence comparison.

[0134] Table 6: Partial amplification primers

[0135]

[0136]

[0137] The target gene fragments were amplified by RT-PCR, obtained by gel electrophoresis, and all the gene fragments were sequenced and compared. The results showed that there was no nucleotide site mutation.

[0138] 3. Morphological observation

[0139] 20 μl of the identified recombinant canine influenza virus suspension was taken on a copper mesh, and the excess virus suspension was carefully removed. After negative staining with 2% phosphotungstic acid, the virus morphology was observed under a transmission electron microscope.

[0140] Results: The typical orthomyxovirus-like virus particles with a size of about 100 nm and round or polymorphic processes were observed.

[0141] Example 4: Preparation of purified virus liquid that can be used for recombinant H3N2 CIVs vaccine

[0142] 1. Resuscitation and culture of MDCK suspension

[0143] The MDCK cells cultured in Example 3 were rapidly thawed from the liquid nitrogen tank at 37°C, centrifuged at 1500 rpm for 5 min, and the supernatant was discarded. The cells were gently suspended in warm serum-free medium (CD-MDCK244 medium), and the cell suspension was transferred to a cell flask. The cells were cultured at 37°C, 5% CO2, Do 60%, and 120 rpm (the cell culture parameters were adjusted several times, and finally the cells were cultured under these conditions). After 48 hours of cell growth, the cell density and cell viability were counted. When subculturing, the cells were diluted to 1.5 x 10 6 cells / mL with warm fresh medium, and the cells were cultured on a shaker.

[0144] 3. Genetic stability of recombinant canine influenza virus 32Q-PR8 vaccine candidate strain in vitro

[0145] The cell inoculation density was 1.5 x 10 6 cells / mL, the culture parameters were set to 37°C, 120 rpm, Do 60%, pH 7.0, the virus was inoculated at the optimal multiplicity of infection (MOI), and the virus was harvested at the optimal time. The virus was subcultured for 5 generations, and the hemagglutination, virus titer, antigenicity difference comparison, and gene identification were determined.

[0146] The hemagglutination titer was 2048, and the TCID50 was 10 10.5 / ml. The antigen difference comparison was performed using the standard serum of ferret, and the results showed that the virus seed of 5 generations had no antigen difference. The virus nucleic acid extraction was performed on each generation of virus seed, and the HA and NA genes were determined, and no amino acid gene sequence mutation was found by sequence alignment (Table 7). The results showed that there was no antigen difference compared with the parent virus QIAOKE01, and the original seed batch of the candidate vaccine was established.

[0147] Table 7: In vitro genetic stability detection of 32Q-PR8 strain candidate vaccine

[0148]

[0149] 4. Inactivation of recombinant canine influenza virus 32Q-PR8

[0150] The product prepared in step 1 of the present example was centrifuged at 8000 rpm to obtain a clear virus liquid, which was divided into 500 ml / bottle. The pH value was adjusted to 7.0 using 7.5% (w / v) NaHCO3, β-propiolactone was added, and the ratio of β-propiolactone: virus liquid (v / v) was 1:1500. After mixing, it was placed at 4°C for inactivation. Samples were taken at 24 hours, hydrolyzed at 37°C for 2 hours, and then inactivation test and HA titer detection were performed. For inactivation test, 0.1 ml samples were taken from the upper, middle and lower parts and inoculated into 9-day-old SPF chicken embryos, each sample was inoculated into 3 chicken embryos, which were continuously transmitted for 3 generations, and the hemagglutination was determined. If hemagglutination occurs, it is determined that the sample is not completely inactivated. If the allantoic fluid of 3 embryos has no hemagglutination, it is determined that the inactivation is complete. After inactivation, antigen difference comparison was performed. Before inactivation of 32Q-PR8 virus liquid, after inactivation of 32Q-PR8 virus liquid, and QK32 epidemic strain (QIAOKE01), HI hemagglutination inhibition test was performed on the standard antigen to compare the antigen difference.

[0151] After inactivation, the virus morphology did not change, such as Figure 5 Before and after inactivation, there was no antigen difference with QK32 epidemic strain, and the results of HI hemagglutination inhibition were both 1024. The results showed that the β-propiolactone inactivated virus had complete morphology and no antigen difference, and could be used for vaccine preparation.

[0152] 5. Concentration and purification of recombinant canine influenza virus 32Q-PR8

[0153] Concentration: The virus liquid after inactivation was centrifuged at 5000 rpm for 10 min to remove the precipitate, and the clear virus liquid was concentrated 24 times using a membrane with a molecular weight cut-off of 300 KDa. The HA titer was determined.

[0154] Purification: The barrel 4FF column material was mixed and then suctioned out, placed in a 0.2 μm negative pressure filter for suction filtration, the ethanol was removed, 10 times of clear PBS buffer (10 mmol / L, pH 7.2) was added for washing, finally the 4FF column material was resuspended with PBS buffer (10 mmol / L, pH 7.2), loaded into a beaker and placed in an ultrasonic cleaner for 10-15 minutes for removing bubbles. The glass column tube (Φ4 cm x 100 cm) was fixed vertically, a glass rod was used for drainage, the column material was mixed and then poured along the glass rod into the glass column tube, a cover was added, connected with the purification system pipeline, PBS buffer (10 mmol / L, pH 7.2) was added in the mobile phase bottle, and the balance was started. The balance liquid flow rate was set to 2 ml / min, the balance was started, the column material was gradually compacted with the flow of the balance liquid, the sample addition position knob on the column tube was adjusted so that the sample addition hole was close to the upper edge of the column material. Continue to balance, when the effluent pH value and OD280 value were stable for 20 minutes, the sample was ready to be added. When the sample was added, the sample suction tube was inserted into the virus concentrate liquid surface, 50 ml of inactivated virus liquid was opened for sample addition, and 0.64 cm / min was used as the flow rate of the purified influenza virus concentrate. The HA titer after purification was determined.

[0155] The concentration was performed 24 times using a 300 KDa membrane bag, and the hemagglutination titer was 16384. Purification was performed using a 4FF column material at 0.64 cm / min, and the HA titer after purification was 8192. The purified virus liquid obtained was used for the preparation of vaccines in the following experiments.

[0156] Example 5: Optimal immunization mode of recombinant canine influenza virus 32Q-PR8

[0157] 1. Screening of optimal immunization adjuvant and immunization route

[0158] The purified virus liquid prepared in Example 4 was diluted to 256 HAUs / 0.1 ml, mixed with aluminum hydroxide adjuvant or ISA 201 adjuvant at a volume ratio of 1:1 to prepare an immunization antigen, and the total concentration was 128 HAUs / 0.1 ml.

[0159] The 25 mice were divided into 5 groups, 5 mice in each group, group A was immunized with aluminum hydroxide adjuvant vaccine by muscle, group B was immunized with ISA 201 adjuvant vaccine by muscle, group C was immunized with aluminum hydroxide adjuvant vaccine by subcutaneous, group D was immunized with ISA 201 vaccine by subcutaneous, the immunization dose was 0.1 ml, and group E was a blank control group. Blood was collected before immunization, 7, 14, 21, 28, 35 and 42 days after immunization, and serum was separated for HI antibody detection, and the combination of the highest and stable antibody was selected to determine the optimal immunization adjuvant and immunization route.

[0160] Using 128 HAUs as the immunization dose, the average HI antibody level in all immunization groups was 1:4 on day 7 post-immunization. Differences in antibody levels emerged on day 14 post-immunization: Group A (intramuscular immunization with aluminum hydroxide adjuvant vaccine) and Group C (subcutaneous immunization with aluminum hydroxide adjuvant vaccine) had higher levels than Group B (intramuscular immunization with ISA 201 adjuvant vaccine) and Group D (subcutaneous immunization with ISA 201 adjuvant vaccine). On day 21 post-immunization, Group C (subcutaneous immunization with aluminum hydroxide adjuvant vaccine) had a higher HI antibody level than the other groups, reaching 128. Compared to Group A, Group C had a better antibody level with the same adjuvant, reaching 1:1024. Similarly, Group B was significantly higher than Group D. Although Group D reached a HI antibody level of 1:1024 on day 35, it dropped to 512 on day 42, indicating insufficient antibody stability (see Table 8). Therefore, subcutaneous injection is more effective than intramuscular injection, and aluminum hydroxide adjuvant produces more stable antibody levels.

[0161] The results showed that the optimal route of immunization was subcutaneous injection, and the optimal adjuvant was aluminum hydroxide.

[0162] Table 8: Evaluation of the Immunotherapy Effect of 32Q-PR8

[0163]

[0164]

[0165] 2. Screening of immunization doses

[0166] The purified viral stock solution was diluted to 512, 256, 128, and 64 g, respectively, and mixed with the optimal adjuvant at a 1:1 ratio for later use. The resulting immunization injection solution contained 256, 128, 64, and 32 HAUs. Twenty-five mice were randomly divided into five groups: Group F received the vaccine prepared with the optimal adjuvant at an antigen titer of 256 via the optimal route; Group H received the vaccine prepared with the optimal adjuvant at an antigen titer of 128 via the optimal route; Group I received the vaccine prepared with the optimal adjuvant at an antigen titer of 64 via the optimal route; and Group J received the vaccine prepared with the optimal adjuvant at an antigen titer of 32 via the optimal route. Group K served as the control group and was not immunized. Venous blood was collected from five mice in each group before immunization and at 7, 14, 21, 28, 35, and 42 days after immunization, and serum was separated for HI antibody titer detection.

[0167] The antibody levels of the F group and the H group were higher, and the antibody levels of the two groups reached 1:1024 on the 28th day after immunization. The antibody level of the H group remained at this level until the 35th day, and the antibody level of the F group reached 1:2048 on the 42nd day. The antibody levels of the I group and the J group were lower. See Table 9. Thus, the F group with an immunization dose of 256 HAUs can produce higher antibody levels, and the H group with an immunization dose of 128 is only inferior to the F group, and the antibody level is relatively stable (see Table 9).

[0168] Table 9: Antibody level detection after immunization

[0169]

[0170] The results show that the mice immunized with an immunization dose of 256 HAUs can obtain stable HI antibodies.

[0171] Example 6: Evaluation of immunoprotection of recombinant canine influenza virus 32Q-PR8

[0172] 1. Optimal immunization dose of mice for protection against challenge

[0173] Thirteen SPF 16-18g BALB / c mice were taken:

[0174] The first group was the immunization group, and five mice were injected with 256 HAUs of purified virus with a volume of 0.1 ml.

[0175] The second group was the challenge group, and five mice were injected with PBS (10mm pH 7.0-7.2) mixed with aluminum hydroxide adjuvant at a volume ratio of 1:1, and the injection volume was 0.1 ml.

[0176] The third group was the blank control group, and three mice were taken.

[0177] According to the optimal antibody level time, the challenge protection experiment was studied, and 10x MLD50 AMCQK7 mouse adapted virulent virus (preserved number CGMCC NO. 18171, obtained by QIAOKE01 in mice) was used for immunoprotection challenge, and the inoculation amount was 50 μl, and the observation was continued for 14 days.

[0178] According to the optimal immunization adjuvant, immunization method and immunization dose, and the antibody level monitoring results of the above experiment, the challenge protection experiment was studied on the 28th day after immunization, the first group was 256 HAUs and aluminum hydroxide adjuvant, and the second group was PBS and aluminum hydroxide adjuvant. On the 2nd day after challenge, the second group of mice had loose hair, and on the 4th day after challenge, one mouse died, and on the 5th day, three mice died, and on the 6th day after challenge, all the mice in the second group died, while all the mice in the immunization group were alive, and the survival curve was drawn. Figure 6 andFigure 7 .

[0179] Results showed that mice immunized with 256 HAUs were completely resistant to the challenge of H3N2 mouse-adapted virulent strain.

[0180] 2. Optimal immunization dose and protection of dogs

[0181] According to the immune effect of mice, referring to the optimal adjuvant and immunization route, the minimum immunization dose and efficacy of dogs were studied.

[0182] Twenty-five beagles were selected and divided into five groups, with five in each group. The grouping is shown in Table 10.

[0183] Table 10: Immunization grouping and inoculation dose of 32Q-PR8 strain

[0184]

[0185]

[0186] On day 28 after immunization, venous blood was collected, serum was separated, and the HI antibody titer in the serum against canine influenza virus H3N2 subtype was determined. Ten 6.0 EID50 / ml QIAOKE01 strain was used for nasal infection, with an infection amount of 1.0 ml. After infection, each group of dogs was isolated and fed. Observation was conducted for 7 days, and clinical manifestations such as cough, runny nose, dyspnea, and elevated body temperature were recorded daily. Deep nasal swabs were taken daily starting from the second day after infection, and virus titration was performed. The correlation between HI antibody titer and protection after infection was analyzed.

[0187] After immunization, no abnormal reactions of spirit, appetite, drinking desire, body temperature, and allergic reactions occurred in each group of dogs, and no adverse reactions occurred at the injection site. On day 28 after immunization, venous blood was collected from all dogs to obtain serum for HI antibody level determination. The results are shown in Figure 8 Table 11, the HI antibody titer of the A-PBS group was <1:2, the HI antibody titer of the B-640 group was 1:16-1:32, the HI antibody titer of the C-1280 group was 1:32-1:64, the neutralizing antibody titer of the D-2560 group was (1:64)-(1:128), and the neutralizing antibody titer of the E-5120 group was (1:128)-(1:512).

[0188] Ten 6.0 EID50 / ml QIAOKE01 strain was used for post-immunization infection protection. Five dogs in the A-PBS group (infection group) all showed moderate respiratory symptoms, including elevated body temperature, runny nose, cough, and sneezing. The high fever persisted until the fifth day, and then gradually recovered, but occasional coughs were still observed. The average virus shedding on the second day after infection was 5.5 log 10 EID50 / ml, and 2 dogs still had low virus isolated from swabs with an average of 1.25 log 10 EID 50 / ml. The B-640 immunized group and C-1280 immunized group also showed symptoms of fever, runny nose and cough after the protective challenge. The reference A-PBS group had relatively less clinical symptoms and less virus shedding. The D-2560 group and E-5120 group had low fever on the second day after challenge, and then returned to normal levels without showing any respiratory symptoms. The virus shedding of the two groups was significantly reduced, with the highest virus shedding of 2.06 log 10 EID 50 / ml, and no virus shedding on the fourth day after challenge. The body temperature changes of the A-PBS group, B-640 group, C-1280 group, D-2560 group, and E-5120 group are shown in Figure 9 , and the virus shedding of the A-PBS group, B-640 group, C-1280 group, D-2560 group, and E-5120 group are shown in Figure 10 .

[0189] According to the antibody levels and the incidence of disease, the antibody correlation was compared. When the HI antibody titer was below 1:32, although the virus shedding was reduced, the challenged dogs still showed respiratory symptoms. When the HI antibody titer was higher than 1:64, the dogs could be completely protected against the challenge of 106.0 EID50 / ml virus, with a protection rate of 80%. When the HI antibody titer was 1:256, the dogs could completely resist the challenge of 106.0 EID50 / ml virus with a protection rate of 100% (Table 11).

[0190] Table 11: Correlation analysis of HI antibody titer and challenge protection

[0191] HI antibody titer Number of cases of disease Protection rate (%) 1:2 5 / 5 0 1:16 2 / 2 0 1:32 4 / 4 0 1:64 1 / 5 80 1:128 0 / 6 100 1:256 0 / 1 100 1:512 0 / 2 100

[0192] Note: The body temperature is higher than 39.6℃, or the virus shedding lasts for more than 3 days.

[0193] The results show that immunization with an immunogen content of 2560 HAUs can produce higher antibodies 28 days after immunization, and can completely protect 10 6.0 EID50 / ml QIAOKE01 epidemic strain infection.

[0194] Example 7: Detection of safety

[0195] 1. Results of mouse single-dose repeated inoculation safety test

[0196] Five mice were selected and injected subcutaneously on the back with the vaccine prepared with 1x optimal dose for mice (256 HAUs) (the purified virus solution of Example 4 or its dilution was prepared with aluminum hydroxide adjuvant at a volume ratio of 1:1, the same below). The second injection was performed on the same site 21 days later. The clinical symptoms and the ulceration of the skin at the injection site were observed daily, and the injection site was dissected 14 days later to observe the histopathological changes.

[0197] 2. Results of safety test of single super-dose inoculation of mice

[0198] Five mice were selected and injected subcutaneously on the back with the vaccine prepared with 10x optimal dose for mice. The clinical symptoms and the ulceration of the skin at the injection site were observed daily, and the injection site was dissected 14 days later to observe the histopathological changes.

[0199] 3. Results of safety test of single-dose repeated inoculation of dogs

[0200] Three beagle dogs were selected and injected subcutaneously on the neck back (the site cannot be scratched) with the vaccine prepared with 1x optimal dose for dogs (2560 HAUs). The second injection was performed on the same site 21 days later. The clinical symptoms and the ulceration of the skin at the injection site were observed daily, and the injection site was dissected 14 days after the last injection to observe the histopathological changes.

[0201] 4. Results of safety test of single super-dose inoculation of dogs

[0202] Three beagle dogs were selected and injected subcutaneously on the neck back (the site cannot be scratched) with the vaccine prepared with 10x optimal dose for dogs. The clinical symptoms and the ulceration of the skin at the injection site were observed daily, and the injection site was dissected 14 days later to observe the histopathological changes.

[0203] Results show that:

[0204] The safety test of mice showed that the mice inoculated with single-dose repeated inoculation and single super-dose inoculation did not have any clinical reaction, no movement disorder, and no abnormality in the subcutaneous tissue of the injection site;

[0205] The safety test of beagle dogs showed that the dogs inoculated with single-dose repeated inoculation and single super-dose inoculation did not have abnormal mental state, food appetite, and defecation, did not have vomiting and allergic reaction, and the injection site showed redness, ulceration, and no lump and foreign body sensation at the injection site.

[0206] Example 8: Potency test of shelf life

[0207] The preservation period potency test of laboratory products in vaccine production is divided into serological method and immunization challenge method, and one of them can be selected in the procedure operation. Since the correlation between HI antibody titer and challenge protection has been performed in the early stage, the serological method is selected for the preservation period potency test. The inactivated purified antigen of 32Q-PR8 strain is prepared into the immunization vaccine with HAUs of 2560 / ml in the proportion of 1:1 using aluminum hydroxide gel as the adjuvant, and is stored at 2-8°C for 1, 3, 6, 9, 12 and 15 months. The state of the vaccine is observed to see if there is mold, and 10 16-18g BALB / c mice are immunized with 0.1ml of the aluminum hydroxide gel adjuvant vaccine each by subcutaneous injection. The blood is collected 21 days later, the serum is separated, and the HI titer of the serum of each group of immunized mice is determined.

[0208] On the 28th day after immunization, the blood is collected from the eye orbit of the group mice, the serum is separated, and the HI hemagglutination titer of each group at 1, 3, 6, 9 and 12 months is not lower than 1:128, and the HI hemagglutination titer of two of the group at 15 months is 1:64. See Table 12.

[0209] Table 12: Test results of the preservation period of the recombinant influenza virus inactivated vaccine (32Q-PR8 strain) at 2-8°C

[0210]

[0211] The results show that the preservation period of the vaccine prepared with aluminum hydroxide at 2-8°C is 12 months.

[0212] Example 9: Detection of immune duration in dogs

[0213] The immunization group is divided into two groups, each with 15 animals.

[0214] 1. Immunization of target animals

[0215] According to the steps in Example 6, the target animal test dogs are immunized with the vaccine containing 2560 HAUs of immunogen by subcutaneous injection, and are divided into two groups. The first group is the control group F-PBS (PH=7.0) + aluminum hydroxide adjuvant, and the second group is the immunization group 2560 HAU S + aluminum hydroxide adjuvant, and the influence on challenge protection, each group has 15 animals, is injected subcutaneously. The venous blood is collected to determine the HI antibody titer before immunization on the 0th day and after immunization on the 14th, 21st, 30th, 60th, 90th, 120th, 150th and 180th days. The antibody growth curve is drawn as shown in Figure 11 .

[0216] The results show that on the 14th day after immunization, all the immunized dogs are positive, and the HI can be as high as 128. On the 30th day after immunization, it reaches the peak and continues until the 60th day after immunization. It starts to decrease on the 90th day after immunization, and until the 180th day after immunization, it is still between (1:64) and (1:128).

[0217] 2. Evaluation of immune protection

[0218] Five dogs from each of three groups were randomly selected at 120, 150, and 180 days of age, and each group was inoculated with QIAOKE01 strain virus solution (10 mg / L) via intranasal administration. 6.0 EID 50 The viral load was 1 ml ( / ml). Clinical manifestations and body temperature were recorded daily. Nasal swabs were taken on the second day after challenge to measure viral titer. The patients were observed for 7 days, and the incidence rate in each group was statistically analyzed.

[0219] The body temperature changes after virus challenge in Groups 1, 2, and 3 are as follows: Figure 12 As shown, the virus shedding status after infection in Groups 1, 2, and 3 is as follows: Figure 13 As shown.

[0220] The results showed that on day 1 after viral challenge, the control group experienced a fever of 39.9-41℃ and began to exhibit moderate respiratory symptoms such as runny nose, cough, and sneezing. On day 2, the fever remained around 40℃, and rapid breathing appeared. Although the fever began to decrease on day 3, all dogs still exhibited coughing. The average viral shedding on day 2 was 5.4 log [missing value]. 10 EID 50 / ml, 4.95 log on day 3. 10 EID 50 / ml, 3.75 log on day 4. 10 EID 50 / ml, 1.9 log on day 5. 10 EID 50 / ml, and even after 6 days, a low amount of virus was still isolated from the swab of one dog, with an average value of 1.25 log. 10 EID 50 / ml. Part 1 group (120 days) protection against viral challenge: On day 2 of challenge, all dogs showed no respiratory symptoms, and the average viral shedding was 1.15 log. 10 EID 50 / ml, and by day 3, there was no further viral shedding. In Part 2 group (150 days), all dogs showed no abnormalities in eating or drinking after viral challenge. Their body temperature slightly increased on day 2 of challenge but quickly returned to normal. The average viral shedding was 1.55 log [unclear - likely a unit of measurement]. 10 EID 50 / ml. In Part 3 group (180 days), one dog exhibited coughing, sneezing, and excessive thirst after viral challenge, with a body temperature rising to 40.5℃. The remaining dogs only showed elevated body temperature and increased thirst; their average viral shedding on day 2 was 2.2 log. 10 EID 50dogs that exhibited respiratory symptoms excreted 3.75 and remained at 2.2 log 10 EID 50 The dog was determined to be in the state of onset at 4.5 log EID / ml.

[0221] While the specific embodiments of the application have been described in detail, those skilled in the art will appreciate that various modifications and alternatives to those details could be developed in light of the overall teachings of the disclosure. The foregoing is intended to cover all modifications and alternatives within the scope and spirit of the application. The scope of the application is to be determined by the following claims and any equivalents thereto.

Claims

1. A recombinant canine influenza vaccine strain, which was deposited on June 24, 2021, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 21899.

2. A canine influenza virus liquid, which is prepared from the canine influenza vaccine strain of claim 1 by the following steps: (1) The canine influenza vaccine strain described in claim 1 is cultured to obtain a viral fluid; (2) Inactivate the virus solution to obtain an inactivated virus solution; or, inactivate the virus solution to obtain an inactivated virus solution, and concentrate the inactivated virus solution to obtain a concentrated solution; (3) Purify the inactivated virus solution or its concentrate to obtain purified virus solution; in, In step (1), the canine influenza vaccine strain is cultured in suspension MDCK cells; In step (2), β-propiolactone is used for inactivation.

3. The canine influenza virus solution according to claim 2, wherein, In step (1), the culture conditions are 37℃, 5% CO2, 60% Do, 120 rpm, and culture for 48-72 hours.

4. The canine influenza virus solution according to claim 2, wherein, In step (2), The ratio of β-propiolactone to viral fluid (v / v) is 1:1500.

5. The canine influenza virus solution according to claim 2, wherein, In step (2), β-propiolactone is mixed with the virus solution and then inactivated at 4°C.

6. The canine influenza virus solution according to claim 2, wherein, In step (2), the inactivated virus solution is concentrated using a 300 kDa membrane to obtain a concentrated solution.

7. The canine influenza virus solution according to claim 6, wherein, The inactivated virus solution was concentrated 20-30 times using a 300 kDa membrane to obtain the concentrated solution.

8. The canine influenza virus solution according to claim 6, wherein, The inactivated virus solution was concentrated 24 times using a 300 kDa membrane to obtain the concentrated solution.

9. The canine influenza virus solution according to any one of claims 2 to 8, wherein, In step (3), 4FF is used as the column chromatography medium for purification.

10. The canine influenza virus solution according to any one of claims 2 to 8, wherein, The purified HA valence is greater than or equal to 8192.

11. A canine influenza virus vaccine composition comprising canine influenza virus liquid as described in any one of claims 2 to 10, and one or more vaccinologically acceptable excipients.

12. The canine influenza virus vaccine composition according to claim 11, wherein, The excipient is aluminum hydroxide adjuvant.

13. The canine influenza virus vaccine composition according to claim 11, wherein, The canine influenza virus vaccine composition is a canine influenza virus vaccine preparation.

14. The canine influenza virus vaccine composition according to claim 13, wherein, The unit dose of the canine influenza virus vaccine composition is 2560 HAUs-5120 HAUs.

15. Use of the canine influenza vaccine strain of claim 1 in the preparation of an H3N2 canine influenza virus vaccine.

16. The use according to claim 15, wherein, The canine influenza virus vaccine mentioned is an inactivated vaccine.

17. The use according to claim 15, wherein, The immunization dose for dogs is 2560 HAUs / dog - 5120 HAUs / dog.

18. The use according to claim 15, wherein, The canine influenza virus vaccine is administered subcutaneously.

Citation Information

Patent Citations

  • Recombinant canine influenza virus strain and preparation method thereof as well as vaccine prepared from recombinant canine influenza virus strain

    CN103881983A

  • H3N2 subtype canine influenza virus mouse adaptive virulent strain and application thereof

    CN110468109A