Method for heterologous synthesis of γ-polyglutamic acid in plants to improve plant stress resistance and yield

Abstract

The present invention discloses a method for heterologous synthesis of γ-polyglutamic acid in plants to improve plant stress resistance and yield. Three key enzyme genes PgsA, PgsB, and PgsC for synthesizing γ-PGA are cloned from strains producing γ-PGA, and the codon-optimized PgsA, PgsB, and PgsC gene sequences are resynthesized according to the codon preference in the plant, and the vector pU130-bar containing the bar gene screening marker is connected to obtain the plant expression vector PGA001, which is transferred into the plant through Agrobacterium-mediated transfer to obtain a new transgenic plant strain producing γ-polyglutamic acid. Experiments have confirmed that the new strain of transgenic corn obtained by the method of the present invention can not only improve the drought resistance of corn, but also improve the salt resistance, and can also significantly increase the biomass of corn under drought stress conditions and normal growth conditions. The above results indicate that the method of the present invention is a green, efficient, and sustainable effective way to solve the problem of stable yield or less yield reduction of crops under drought, water shortage, and saline-alkali stress, and can be widely used in plant drought resistance, salt-tolerant molecular breeding and new variety cultivation.

Description

Technical Field

[0001] The invention relates to a method for improving plant stress resistance and yield, in particular to a method for improving plant stress resistance and yield by heterologous synthesis of gamma-polyglutamic acid in plants, and belongs to the technical fields of genetic engineering, genetic breeding and synthetic biology. Background Art

[0002] Using modern biological technology to cultivate new varieties of high-quality, high-yield crops that are drought-resistant and salt-resistant is of great strategic significance and is an important choice for increasing crop yields, ensuring food security and sustainable agricultural development. Developing high-quality genes that are resistant to stress and high-yield and transforming crops through genetic engineering is an effective way to avoid yield reduction under adverse conditions.

[0003] Plant genetic modification technology is widely used, mainly in the areas of insect resistance, herbicide resistance, stress resistance and yield increase.

[0004] At present, most of the research on transgenic drought-resistant crops in the world comes from some genes related to the synthesis of osmotic regulating substances, transcription factors, genes related to stress resistance signal transduction pathways, etc., as well as some water channel protein genes, chaperone protein genes, genes related to enzymes in the ABA synthesis pathway, etc. For example, in 2007, Qin et al. overexpressed the transcription factor ZmDREB2A in corn and significantly improved the ability of corn to resist drought and high temperature; in 2010, Zhang et al. transferred the transcription factor TsCBF1 from salt mustard into corn to improve the drought resistance of corn; the enzymes GSMT2, DMT2, and betA in the synthesis pathway of osmotic regulating substances betaine from bacteria were transferred into corn to improve the drought resistance of corn; the HAV1 gene from the LEA protein family of barley was introduced into corn to significantly improve the drought resistance of corn; ZmCIPK2, as a protein kinase in the signal pathway that responds to adversity, can significantly improve the drought resistance of corn after being overexpressed in corn; heterologous expression of the Arabidopsis thaliana LOS5 gene in corn can significantly increase the ABA content and drought resistance in corn.

[0005] Research reports show that salt stress signaling pathways can be mainly divided into osmotic and ion balance signaling pathways, cell damage and repair, and growth regulation processes. So far, many key stress resistance genes involved in the synthesis of osmotic protective substances, ion balance, active oxygen scavenging, and transcription factors have been cloned, and these genes have improved the stress resistance of transgenic plants to varying degrees. For example, after the CMO (choline monooxygenase) gene for synthesizing betaine was transferred into tobacco, the salt resistance of tobacco could be significantly improved (Wu et al., 2010); overexpression of Arabidopsis AtSOS1 significantly improved the salt tolerance of transgenic plants (Qiu et al., 2002; Shi et al., 2003); overexpression of Arabidopsis tonoplast Na + / H+ The antiporter (AtNHX1) gene can significantly improve the salt resistance of transgenic Arabidopsis and tomato (Zhang and Blumwald, 2001; Zhang et al., 2001); overexpression of Arabidopsis ANAC019, ANAC055 and ANAC072 / RD26 can significantly improve the salt resistance of transgenic plants; overexpression of Arabidopsis H + -PPase gene AtAVP1 increases the salt tolerance and drought resistance of transgenic cotton (Pasapula et al., 2011); transgenic corn with TsVP gene can significantly improve the drought and salt resistance of corn (Wei et al., 2008). The above research results show that although many plant salt tolerance genes have been cloned and expressed, they are still mainly concentrated in model plants such as Arabidopsis, tobacco and tomato, and have not been widely used in crops.

[0006] Most of the transgenic stress-resistant corns reported so far are transgenic for single functional genes. Although they have improved some stress resistance of corn, there are few or no reports of increasing corn yield at the same time under normal growth conditions. Therefore, screening genes that can enhance crop stress resistance and maintain high yield under both normal and stress conditions has become a focus.

[0007] γ-poly glutamic acid (γ-PGA) is a microbial fermentation product first discovered in natto. γ-PGA is formed by dehydration condensation of L-glutamic acid and D-glutamic acid. Its molecules are linear, contain a large number of amide bonds and free carboxyl groups, and are anionic polymers. The finished product is a white, odorless powdered solid. Because γ-PGA has good ductility, flexibility, biocompatibility, adhesion, stability, moisture retention, water absorption, oxygen barrier, film-forming properties and biodegradability, it is a biodegradable polymer material with great development potential. It is widely used in medicine, food, cosmetics, feed, agriculture, environmental protection and other fields. It is a recognized green chemical product with great development potential.

[0008] In the field of agriculture, a large number of studies have found that γ-PGA can be used as a synergist for pesticides and fertilizers to promote crop growth under low nutrient conditions, which is beneficial to improving seed vitality and germination rate, and promoting the growth and development of plumules and radicles; γ-PGA can also improve the physical and chemical and adsorption properties of the soil, thereby promoting the absorption of nutrients by plants; because γ-PGA has strong adsorption properties, it can be used as an adsorbent or chelating agent, and has a significant chelating effect on toxic heavy metal ions in the soil, preventing crops from absorbing too much toxic heavy metals from the soil; γ-PGA can also increase the biomass of plant roots, thereby enhancing the absorption of nitrogen, phosphorus, and potassium by plants and promoting plant growth. In addition, γ-PGA as a water retaining agent can significantly improve the drought resistance of crops. Because γ-PGA contains a large number of hydrophilic groups in its molecules, it has strong water absorption and water retention, which determines its important value in the field of agricultural water conservation.

[0009] As a new type of green polymer biomaterial, although γ-PGA has broad application prospects, the relatively high cost of producing γ-PGA by microbial fermentation also limits its large-scale application in agricultural production. At the same time, as a polymer biomaterial, its ecological and environmental effects of long-term use in soil also lack systematic and comprehensive research and evaluation.

[0010] Based on the prior art, the applicant cloned the key gene in the process of synthesizing γ-polyglutamic acid from microorganisms, used synthetic biology and genetic engineering technology, and transferred it into plants using corn as an implementation case to evaluate the expression of heterologous γ-polyglutamic acid synthesis genes in corn and the effects on corn drought resistance, salt tolerance, yield and the improvement effect on other traits, and established a method for heterologous synthesis of γ-polyglutamic acid in plants to improve plant stress resistance and yield. The transgenic corn producing γ-polyglutamic acid obtained not only significantly improved the drought resistance of corn, but also significantly improved the salt resistance of corn, and can also significantly increase the biomass of corn under drought and normal growth conditions. The present invention also measured the quality of transgenic corn kernels and found that the synthesis of γ-PGA in corn can also increase the starch content and amylose content in corn kernels. After searching, there is no report on heterologous synthesis of γ-polyglutamic acid in crops and studying its effects on crop drought resistance, salt tolerance, yield and quality. Summary of the invention

[0011] In view of the shortcomings of the prior art, the problem to be solved by the present invention is to provide a method for heterologously synthesizing γ-polyglutamic acid in plants to improve plant stress resistance and yield.

[0012] The method for heterologously synthesizing γ-polyglutamic acid in plants to improve plant stress resistance and yield of the present invention comprises the following steps:

[0013] (1) Cloning of genes for synthesizing γ-polyglutamic acid: Three key enzyme genes PgsA, PgsB, and PgsC for synthesizing γ-PGA were cloned from a strain producing γ-polyglutamic acid; wherein the GenBank ID of gene PgsA is AIA08848.1, and its amino acid sequence is shown in SEQ ID NO.1; the Genebank ID of gene PgsB is AIA08846.1, and its amino acid sequence is shown in SEQ ID NO.2; the Genebank ID of gene PgsC is AIA08847.1, and its amino acid sequence is shown in SEQ ID NO.3;

[0014] (2) Codon optimization: According to the amino acid sequences of PgsA, PgsB, and PgsC genes, the optimized sequences are finally determined through codon preference analysis in corn or other transgenic plants and combined with CpG dinucleotides content, GC content, mRNA secondary structure, Cryptic splicing sites, Premature PolyA sites, Internal chisites and ribosomal binding sites, Negative CpG islands, RNA instability motif (ARE), Repeat sequences (direct repeat, reverse repeat, and Dyad repeat), and Restriction sites that may interfere with cloning. The optimized PgsA, PgsB, and PgsC genes are artificially synthesized from scratch based on the sequences.

[0015] (3) Construction of plant expression vector: The codon-optimized PgsA, PgsB, and PgsC genes were connected to the plant expression vector pU130-bar containing the bar gene selection marker to obtain a plant expression vector containing the target gene, which was named plant expression vector PGA001;

[0016] (4) Obtaining transgenic plants with improved plant stress resistance and yield;

[0017] Features:

[0018] The γ-polyglutamic acid-producing strain in step (1) is Bacillus licheniformis or Bacillus amyloliquefaciens;

[0019] The nucleotide sequence of the PgsA gene after codon optimization in step (2) is shown in SEQ ID NO.4; the nucleotide sequence of the PgsB gene after codon optimization is shown in SEQ ID NO.5; the nucleotide sequence of the PgsC gene after codon optimization is shown in SEQ ID NO.6;

[0020] The nucleotide sequence of the plant expression vector PGA001 in step (3) is shown in SEQ ID NO.7; the functional elements of the expression vector are described as follows:

[0021]

[0022]

[0023] The transgenic plant with improved plant stress resistance and yield in step (4) is transgenic corn, and the method for obtaining the transgenic corn is:

[0024] 1) Preparation of Agrobacterium strain containing plant expression vector PGA001

[0025] Select EH105 Agrobacterium as the transformation strain, add 3 μl of the plasmid containing the PGA001 expression vector to 50 μl of the competent cells of the Agrobacterium, ice bath for 30 minutes, quick-freeze with liquid nitrogen for 5 minutes, and water bath at 37°C for 5 minutes; then add 800-1000 μl of YEP liquid culture medium, shake and culture at 25-28°C and 180-250rpm for 3 hours; take out the bacterial liquid and spread it on the solid YEP culture medium containing rifampicin and kanamycin, place it at 25-28°C in the dark and invert for 3-4 days, take the colony for colony PCR verification, and sequence it, and save the Agrobacterium with correct sequencing for transformation;

[0026] 2) Callus preparation

[0027] The corn inbred line KN5585 was selected as the recipient inbred line, and the ears 10-12 days after pollination were taken, the husks were removed, and the ears were treated with 70% alcohol for 5-6 minutes in a sterile workbench, and then washed with sterile water for 4-5 times, and 1.5-2 mm immature embryos were peeled off, and the scutellum was placed on the immature embryo induction medium with the scutellum facing upward, and callus was induced at 28° C. in the dark; after 2-3 weeks, embryonic callus with a faster growth rate, soft texture, loose and fragile, and bright color was selected from the induced callus, and transferred to the subculture medium for subculture, and the subculture was performed every 2 weeks for Agrobacterium infection;

[0028] 3) Agrobacterium infection

[0029] Pick a single colony of Agrobacterium containing the PGA001 expression vector, add it to 5-6 mL of YEP (Kan) medium, and culture it overnight; centrifuge it at 5000-6000 rpm for 5-10 min at room temperature to collect the bacteria; suspend the bacteria in an infection solution containing acetosyringone (AS) and adjust the OD 600 =0.6-0.8, mix well and set aside; activate the prepared infection solution at 25-28°C and 180rpm on a shaker for 1-2 hours for infection; collect the embryonic callus of corn and put it into a sterile triangular flask, then pour the infection solution, break up the large callus pieces and shake well to make the callus fully contact with Agrobacterium, and infect for 15-20 minutes; take out the callus, absorb the excess bacterial solution on filter paper, and then inoculate it on the co-cultivation medium and culture it in the dark at 19-22°C for 3 days;

[0030] 4) Resume culture

[0031] Use sterile water containing antibiotics to rinse the surface of the callus 3-5 times. When the added water is no longer turbid, pour out the liquid, transfer the callus to a plate covered with filter paper, blow dry the surface water of the callus in a clean bench, transfer to recovery medium, and culture in the dark at 28°C for 7-10 days;

[0032] 5) Screening and culture

[0033] After the culture is resumed, the transformed callus is transferred to a screening medium supplemented with glufosinate ammonium, and the screening culture is carried out for two weeks. Then, a new screening medium is replaced and the culture is carried out in the dark at 25-28° C. for 15-20 days. The callus is broken up and transferred to a new screening medium for further screening. A total of 2 rounds of screening are carried out and the culture is carried out for 30-40 days.

[0034] 6) Differentiation and rooting

[0035] The resistant callus was transferred to a differentiation medium and cultured in the dark at 25-28°C for 7-10 days, then transferred to a light incubator at 25-28°C and cultured until the regenerated buds grew to 3-5 cm, and then transferred to a rooting medium;

[0036] 7) Self-pollination and harvesting after hardening and transplanting

[0037] After a large number of strong roots have grown, the seedlings are hardened for 2-3 days. After the root culture medium is washed, the seedlings are transplanted into sterilized nutrient soil. After 7 days of indoor hardening, the seedlings are transplanted to the field. During this period, young leaves are taken for PAT / bar protein rapid detection test strips, and transgenic positive corn is self-pollinated to harvest seeds. After obtaining the T1 generation of transgenic corn plants, two generations of strict self-pollination are carried out to finally obtain a transgenic corn homozygous strain.

[0038] The culture medium involved in the above-mentioned transgenic corn method is as follows:

[0039]

[0040] The present invention also provides a plant expression vector that can heterologously synthesize γ-polyglutamic acid in plants and improve plant stress resistance and yield, characterized in that: the plant expression vector is named plant expression vector PGA001, and its nucleotide sequence is shown in SEQ ID NO.7.

[0041] The invention also discloses a method for improving plant stress resistance and yield by utilizing heterologous synthesis of gamma-polyglutamic acid in plants and the obtained plant transgenic strain.

[0042] Wherein: the transgenic plant strain is preferably a homozygous transgenic corn strain; the stress resistance refers to drought resistance and salt resistance.

[0043] (5) Detection of genetically modified corn:

[0044] The detection methods include PAT / bar protein rapid test strips (Artron, see the instructions for detailed steps), PCR, RT-PCR, and product γ-PGA content detection. Among them, the detection of γ-PGA content is carried out with reference to the NY / T 3039-2016 method.

[0045] The corn plants were dried under vacuum at 60°C, ground, and 10 g of the uniformly mixed sample was weighed. The contents of free glutamic acid in the sample after hydrolysis with hydrochloric acid and before hydrolysis were determined respectively. The difference between the two was the content of polyglutamic acid.

[0046] The results showed that the three genes PgsA, PgsB, and PgsC had been successfully transferred into maize ( Figure 1 ), and successfully detected γ-PGA in corn (Table 1).

[0047] (6) Phenotypic identification of transgenic corn:

[0048] Transgenic positive maize lines were selected for identification of their phenotypes throughout the development period, yield determination, and seed quality (starch content and amylose content).

[0049] The results showed that the transgenic positive corn lines had better germination rate, higher plant height, and more developed root system, indicating that the synthesis of γ-PGA in corn can promote the growth of corn and increase the yield of corn under normal conditions, mainly by increasing the number of kernels per ear, kernel weight per ear, and 100-kernel weight (Table 3). It can also improve the quality of corn kernels, mainly the starch content and amylose content (Table 4).

[0050] (7) Testing of drought resistance and salt resistance of transgenic corn at the germination and seedling stages:

[0051] Drought resistance testing of transgenic corn: Transgenic positive corn and negative control corn were subjected to drought stress treatment, and their phenotypes were studied and analyzed. The drought treatment was divided into PEG simulated drought treatment and water shortage drought stress treatment.

[0052] The PEG simulated drought treatment was mainly selected in the germination stage and the three-leaf stage. The maize culture medium was Hogland nutrient solution (Haibo Biotechnology). The concentrations of PEG6000 selected for drought stress treatment in the germination stage were 14% and 18%, respectively. The concentration of PEG6000 selected for simulated drought treatment in the seedling stage was 18%. The seedling stage drought treatment adopted potted water cut-off treatment, and physiological and biochemical indicators such as free proline, soluble sugar, chlorophyll and ABA content were measured.

[0053] In the seedling resistance test, the corn seeds were first surface disinfected and then germinated. The sprouted seedlings were then inserted into a nutrient solution (Hogland corn nutrient solution) for culture. When the plants reached the three-leaf stage, they were transferred to a nutrient solution containing 200 mmol / L NaCl or 18% PEG, respectively, to observe phenotypic changes and conduct biomass measurements.

[0054] Drought test: Select transgenic corn T3 seeds and wild-type KN5585 seeds of uniform size and sow them in small plastic flower pots of uniform size, and the trays are filled with an equal amount of fertile soil with uniform texture. Half of each tray is sown with transgenic materials and the other half is sown with wild-type materials, 2 seeds each, and 3 trays are planted for each strain. Water normally until the seedlings grow to the 3-leaf stage, and then carry out drought stress treatment, that is, stop watering after a one-time watering, and resume watering until the wild-type plants die. Observe the growth of transgenic strains under drought conditions and the survival rate and recovery rate after resuming watering. The field drought treatment (implemented at the Sanya South Breeding Base) selected the method of water cut-off treatment before flowering. The specific implementation method is: cut off water for 15 days, re-water once, and then cut off water for 15 days until harvest, and measure the stress resistance phenotype and yield.

[0055] The results showed that the transgenic positive corn could still germinate well under PEG treatment, while the germination of the negative control corn was significantly inhibited ( Figure 3 ). The results of the field drought and water shortage test showed that the transgenic positive corn also showed good drought resistance under field drought conditions.

[0056] The study of transgenic corn salt resistance includes the germination stage and the seedling stage: different concentrations of NaCl solution were selected for salt stress treatment of corn in the germination stage. The seeds of transgenic positive materials and negative control materials were selected, and after surface disinfection, they were germinated on filter paper containing 150mM NaCl and 200mM NaCl solutions, and the germination was observed; the seedling stage salt resistance test adopted the solution stress treatment method: the surface of corn seeds was disinfected to germinate and then transferred to nutrient solution (Hogland corn nutrient solution) for cultivation, and the corn cultured to the three-leaf stage was moved to the nutrient solution containing 200mM NaCl for cultivation, and the phenotypic changes were statistically analyzed.

[0057] The results showed that the germination of transgenic corn seeds was better than that of negative control corn under both low and high concentration NaCl stress conditions ( Figure 7-Figure 8 ), indicating that transgenic corn has better salt resistance during the germination period. The results of the hydroponic salt resistance test at the seedling stage also showed that the transgenic positive corn has obvious salt resistance.

[0058] (8) Yield analysis of transgenic corn under normal and drought conditions

[0059] Yield analysis was conducted under field conditions, divided into normal irrigation conditions and drought water-cut conditions. Normal irrigation conditions were to keep the transgenic corn and the control inbred lines growing under normal natural growth conditions; the drought test mainly adopted the method of water-cut treatment before flowering, and the specific implementation method was: water-cut for 15 days, re-watering once, and then water-cut for another 15 days until harvest, and the yield and yield-related traits (ear morphology, ear length, ear weight, number of grains per ear, ear weight, 100-grain weight, etc.) were measured.

[0060] The results showed that under drought conditions, the yield of transgenic positive corn increased significantly. Compared with the yield under normal irrigation conditions, the transgenic corn was less affected by drought, while the yield of negative control corn decreased significantly under drought conditions.

[0061] The present invention discloses a method for heterologously synthesizing γ-polyglutamic acid in plants to improve plant stress resistance and yield, and also discloses a transgenic plant strain obtained by using the method for heterologously synthesizing γ-polyglutamic acid in plants to improve plant stress resistance and yield, preferably a homozygous transgenic corn strain. Experiments have confirmed that the transgenic corn producing γ-polyglutamic acid not only significantly improves the drought resistance of corn, but also significantly improves the salt resistance of corn, and significantly increases the biomass of corn under normal growth conditions. The beneficial effects of the present invention are: (1) creatively realizing the synthesis of γ-polyglutamic acid in plants, and proving that γ-polyglutamic acid can be produced in the obtained transgenic corn. (2) Evaluation of the expression of heterologous γ-polyglutamic acid synthesis genes in corn and their effects on drought resistance, salt tolerance, yield and improvement of other traits showed that the transgenic plants obtained by the method of the present invention showed obvious drought resistance, salt tolerance and yield improvement, proving that the method of the present invention is a green, efficient and sustainable way to achieve stable yield or reduce yield reduction of crops under drought, water shortage and saline-alkali stress, and can be widely used in molecular breeding of drought resistance and salt tolerance of plants and crops and breeding of new varieties, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 Schematic diagram of plant expression vector map and detection of transgenic corn.

[0063] Among them, A: schematic diagram of the plant expression vector PGA001; B: rapid detection of PAT / bar protein in transgenic corn, CK: negative control inbred line KN5585; 1-9: transgenic positive corn lines; C: PCR detection results of transgenic corn bar gene; M: DNA marker; CK: negative control inbred line KN5585; 1-9, 12, 13, 15: transgenic positive corn lines; D: RT-PCR detection results of PgsA, PgsB, PgsC genes in transgenic corn; T1, T2, T5: transgenic positive corn lines.

[0064] Figure 2 Shown are the phenotypes of transgenic positive corn and negative control corn inbred lines under normal growth conditions.

[0065] Among them, A: the situation of transgenic positive corn and negative control corn inbred line after germination for 30 hours under normal conditions; CK: negative control inbred line KN5585, T: transgenic positive corn line; B: the situation of transgenic positive corn and negative control corn inbred line after germination for 48 hours under normal conditions; CK: negative control inbred line KN5585, T: transgenic positive corn line; C: root development of transgenic positive corn and negative control corn; CK: negative control inbred line KN5585, T1, T2, T5: transgenic positive corn line; D: seedling growth of transgenic positive corn and negative control corn under potted conditions; CK: negative control inbred line KN5585, T: transgenic positive corn line; E: seedling growth of transgenic positive corn and negative control corn under potted conditions; F: fruit phenotype of transgenic positive corn and negative control corn; CK: negative control inbred line KN5585, T1, T2, T5: transgenic positive corn line; T5, T6: transgenic positive corn lines.

[0066] Figure 3 Shown is the drought resistance test of transgenic corn and wild-type control corn inbred lines during the germination period.

[0067] Figure 4 Shown are the PEG simulated drought test on transgenic positive plants and negative control corn.

[0068] Among them, A: PEG simulated drought comparison test of transgenic positive (endogenously synthesized γ-PGA) corn, exogenously treated γ-PGA and untreated negative control corn; B: comparison of fresh weight of aboveground part of transgenic positive (endogenously synthesized γ-PGA) corn, exogenously treated γ-PGA and untreated negative control corn under normal conditions and PEG treatment conditions; C: comparison of fresh weight of underground part of transgenic positive (endogenously synthesized γ-PGA) corn, exogenously treated γ-PGA and untreated negative control corn under normal conditions and PEG treatment conditions.

[0069] Figure 5 This paper shows a potted drought and water shortage experiment on transgenic corn.

[0070] Among them, A: the bar gene test strip test results of transgenic positive plants and negative control inbred lines; B: the drought and water shortage test results of transgenic positive corn pot plants.

[0071] Figure 6 Drought and water shortage test and yield analysis of transgenic positive corn under field conditions.

[0072] Among them, A: phenotypes of transgenic positive corn and negative control corn after 8 days of water deprivation at the seedling stage; B: phenotypes of transgenic positive corn and negative control corn after 8 days of drought and water deprivation before flowering; C: yield analysis of transgenic positive corn and negative control corn under drought conditions; Among them, CK: negative control inbred line KN5585; T1, T2, T5, T6, T8, T9, T12, T13: transgenic positive corn lines.

[0073] Figure 7 Shown is the salt resistance test of transgenic corn and wild-type control corn inbred lines during the germination period.

[0074] Figure 8 Shown is the salt resistance test of transgenic positive lines and negative control plants at the seedling stage.

[0075] Among them, CK: negative control inbred line KN5585; T1, T2, T5: transgenic positive inbred line KN5585.

[0076] Fig. 9 Shown is a comparative experiment on drought and salt resistance of transgenic positive (endogenously synthesized γ-PGA) corn and wild-type control corn treated with exogenous γ-PGA.

[0077] Among them, A: Comparative test on salt resistance of transgenic positive (endogenously synthesized γ-PGA) corn and wild-type control corn treated with exogenous γ-PGA; B: Comparison of fresh weight of aboveground part of transgenic positive (endogenously synthesized γ-PGA) corn, wild-type control corn treated with exogenous γ-PGA and wild-type control corn under normal conditions and salt stress treatment conditions; C: Comparison of fresh weight of underground part of transgenic positive (endogenously synthesized γ-PGA) corn, wild-type control corn treated with exogenous γ-PGA and wild-type control corn under normal conditions and salt stress treatment conditions; Among them, CK: negative control inbred line KN5585; T1, T2: transgenic positive inbred lines.

[0078] Fig.10 Schematic diagram of the plant expression vector pU130-bar. DETAILED DESCRIPTION

[0079] The present invention is described in detail below in conjunction with specific drawings and embodiments. The examples described below are only preferred embodiments of the present invention. It should be noted that the following description is only for the purpose of explaining the present invention and is not intended to limit the present invention in any form. Any simple modification, equivalent changes and modifications made to the embodiments according to the technical essence of the present invention are within the scope of the technical solution of the present invention.

[0080] In the following examples, the materials, reagents, etc. used were obtained from commercial sources unless otherwise specified.

[0081] Example 1: Obtaining the amino acid sequences of pgsA, pgsB, and pgsC

[0082] Three key enzyme genes PgsA, PgsB, and PgsC for synthesizing γ-PGA were cloned from the γ-polyglutamic acid-producing strain Bacillus licheniformis by a known method; among them, the GenBank ID of gene PgsA is AIA08848.1, and its amino acid sequence is shown in SEQ ID NO.1; the Genebank ID of gene PgsB is AIA08846.1, and its amino acid sequence is shown in SEQ ID NO.2; the Genebank ID of gene PgsC is AIA08847.1, and its amino acid sequence is shown in SEQ ID NO.3.

[0083] Example 2: Codon Optimization

[0084] According to the amino acid sequences of the obtained PgsA, PgsB, and PgsC genes, the optimized sequences are finally determined by analyzing the codon preference in corn or other plants to be genetically modified and combining the CpG dinucleotides content, GC content, mRNA secondary structure, Cryptic splicing sites, Premature PolyA sites, Internal chisites and ribosomal binding sites, Negative CpG islands, RNA instability motif (ARE), Repeat sequences (direct repeat, reverse repeat, and Dyad repeat), Restriction sites that may interfere with cloning, etc., and the optimized PgsA, PgsB, and PgsC genes are artificially synthesized from scratch based on the sequences; wherein the codon-optimized PgsA gene nucleotide sequence is shown in SEQ ID NO.4; the codon-optimized PgsB gene nucleotide sequence is shown in SEQ ID NO.5; the codon-optimized PgsC gene nucleotide sequence is shown in SEQ ID NO.6.

[0085] Example 3: Construction of plant expression vector

[0086] The codon-optimized PgsA, PgsB, and PgsC genes were linked into the plant expression vector pU130-bar containing the bar gene selection marker (vector map as shown in Fig.10 As shown in the figure), a plant expression vector containing the target gene was obtained and named as plant expression vector PGA001. The vector map is shown in the figure Figure 1 As shown; wherein the nucleotide sequence of the plant expression vector PGA001 is shown as SEQ ID NO.7; the functional elements of the expression vector are described as:

[0087]

[0088]

[0089] The plant expression vector PGA001 was constructed using a multi-fragment recombinase method, and the specific construction steps are:

[0090] 1 μg of vector pU130-bar was digested with restriction endonucleases Hindlll and Spel, reacted at 37°C for 1±0.2 hours, and the digested vector product was recovered using a DC301 kit (commercially available PCR gel recovery kit).

[0091] The PCR products of pgsA, pgsB, and pgsC after codon optimization in Example 2, 35S+pgsA+Tnos, 35S+pgsB+Tnos, and 35S+pgsC+Tnos, were directly synthesized by a biological company.

[0092] Then, the recombination was performed. The recombination connection system was as follows: 3 μl of the synthetic PCR products pgsA+pgsB+pgsC respectively; 3 μl of the vector product cut by enzymes; 2 μl of recombinase; 4 μl of recombination buffer; 2 μl of H2O. After 30 min at 37°C, store on ice or at 4°C.

[0093] Then transform E. coli DH5α: 10 μl of the above ligation product + 100 μl of E. coli competent cells.

[0094] After taking the competent DH5α out of the refrigerator, quickly put it on ice. After 5 minutes, wait for the bacterial block to dissolve and add the ligation product. Let it stand on ice for 25 minutes, heat shock at 42℃ for 45 seconds, let it stand on ice for 2 minutes (do not shake), add 100μl LB without antibiotics, shake at 37℃, 200rpm for 1 hour, spread on the plate, and plate with LB+K + , cultured at 37°C for one day.

[0095] Then colony PCR was performed, and the detection primers were:

[0096] QC-F:GCGGCCGAGCCCCTCATCGAGAA

[0097] QC-R:GATCAGGCCCGGCACGATGATG

[0098] Positive colonies were selected for sequencing, and plasmids with correct sequencing results were used to transform Agrobacterium.

[0099] Example 4: Obtaining transgenic corn producing γ-PGA

[0100] (1) Obtaining embryonic callus from maize

[0101] The corn inbred line KN5585 was selected as the recipient inbred line. The ears 10-12 days after pollination were taken, the husks were removed, and the ears were treated with 70% alcohol for 5 minutes on a sterile workbench, and then rinsed with sterile water for 4-5 times. The 1.5-2 mm immature embryos were peeled off and placed on an induction medium (MS + 1 mg / L2,4-D + 1.38 g / L L-proline + 0.5 g / L hydrolyzed casein + 30 g / L sucrose + 7 g / L agar, pH 5.8) with the scutellum facing up, and callus was induced at 28°C in the dark. After 2-3 weeks, select the embryonic callus with faster growth rate, soft texture, loose and fragile, and bright color from the induced callus tissue, transfer it to the subculture medium (MS + 1mg / L2,4-D + 0.69g / L L-proline + 0.5g / L hydrolyzed casein + 30g / L sucrose + 7g / L agar, pH5.8) for subculture every 2 weeks for Agrobacterium infection.

[0102] (2) Preparation of Agrobacterium containing plant expression vector

[0103] EH105 Agrobacterium was selected as the transformation strain, and 3 μl of the plasmid containing the PGA001 expression vector was added to 50 μl EHA105 commercial Agrobacterium competent cells (Bomed), and the cells were placed in an ice bath for 30 minutes, quick-frozen in liquid nitrogen for 5 minutes, and then placed in a 37°C water bath for 5 minutes; 800 μl of YEP liquid culture medium was added, and the cells were cultured at 28°C and 250 rpm for 3 hours; the bacterial liquid was spread on a solid YEP culture medium containing rifampicin and kanamycin, and the cells were cultured in an inverted manner at 28°C in the dark for 3-4 days, and colonies were taken for colony PCR verification and sequencing, and the Agrobacterium with correct sequencing was preserved for transformation;

[0104] (3) Agrobacterium infection and co-cultivation

[0105] A single colony of Agrobacterium containing the PGA001 expression vector was picked up, added to 5 mL of YEP (Kan) medium, and cultured overnight; centrifuged at 6000 rpm for 5 min at room temperature to collect the bacteria; the bacteria were suspended in an infection solution (MS + 1 mg / L 2,4-D + 68.5 g / L sucrose + 36 g / L glucose + 100 mM AS, pH 5.2) containing 100 mM acetosyringone (AS) and the OD 600 =0.6-0.8, mix well and set aside; activate the prepared infection solution in a 25°C shaker at 180rpm for 1 hour for infection; collect the embryonic callus of corn and put it into a sterile conical flask, pour the infection solution in, break up the large callus blocks, shake well to make the callus fully contact with Agrobacterium, and infect for 15 minutes; take out the callus, absorb the excess bacterial solution on filter paper, and then inoculate it into co-cultivation medium (MS+1mg / L 2,4-D+100mM AS+0.5g / L MES+20g / L sucrose+7.5g / L agar, pH5.2), and culture it in the dark at 22°C for 3 days.

[0106] (4) Recovery culture and screening of resistant callus

[0107] Use sterile water containing antibiotics to rinse the surface of the callus 3-5 times, and when the added water is no longer turbid, pour out the liquid, transfer the callus to a plate covered with filter paper, and blow dry the surface water of the callus in a clean bench. Transfer to recovery medium (MS+1mg / L2,4-D+0.69g / L L-proline+0.5g / L hydrolyzed casein+20g / L sucrose+250mg / L cephalosporin+7.5g / L agar, pH5.8), and culture in the dark at 28℃ for 7-10 days. After resuming the culture, the transformed callus was transferred to a screening medium (MS + 1 mg / L 2,4-D + 0.69 g / L L-proline + 0.5 g / L hydrolyzed casein + 20 g / L sucrose + 250 mg / L cephalosporin + 10 mg / L PPT + 7.5 g / L agar, pH 5.8) supplemented with glufosinate (PPT), and the screening culture was started for two weeks. Then, a new screening medium was replaced and cultured in the dark at 25-28°C for 15 days. The callus was broken up and transferred to a new screening medium for further screening, and a total of 2 rounds of screening were performed.

[0108] (5) Differentiation and rooting of resistant callus

[0109] The resistant callus was transferred to differentiation medium (MS+0.5mg / L6-BA+0.5g / LMES+10 mg / LPPT+250-300mg / L cephalosporin+20g / L sucrose+7g / L agar, pH5.8), cultured in the dark at 25-28℃ for 7-10 days, then transferred to a light incubator at 25-28℃ for culture, and transferred to rooting medium (MS+20g / L sucrose+7g / L agar, pH5.8) when the regenerated buds grow to 3-5cm. After a large number of strong roots grow, harden the seedlings for 2-3 days, wash the root culture medium and transplant it into sterilized nutrient soil. After 7 days of indoor hardening, transplant it to the field (cover the flower pots with a film to increase humidity during hardening).

[0110] (6) The young leaves of the surviving transgenic seedlings were tested with PAT / bar protein rapid test strips (Artron), and the transgenic positive corn was self-pollinated to harvest seeds. After obtaining the T1 generation transgenic corn plants, two generations of strict self-pollination were performed to finally obtain the transgenic corn homozygous lines.

[0111] Example 5: Detection of genetically modified corn

[0112] GMO detection methods include PAT / bar protein rapid test strip detection, PCR detection, RT-PCR detection, and product γ-PGA content detection.

[0113] The PAT / bar protein rapid test strip (Artron) was tested according to the instructions of the kit; PCR and RT-PCR were tested according to the method described in (Xie Guangning. Effects of maize ubiquitin receptors ZmDA1 and ZmDAR1 on grain development [D]. Shandong University, 2017.). The γ-PGA content of the product was tested according to the NY / T 3039-2016 method.

[0114] The corn plants were dried under vacuum at 60°C, ground and 10 g of the uniformly mixed sample was weighed and the contents of free glutamic acid in the sample after hydrolysis with hydrochloric acid and before hydrolysis were determined respectively. The difference between the two was the content of polyglutamic acid.

[0115] The test results are shown in Figure 1 and Table 1.

[0116] Table 1. Content of γ-PGA in transgenic corn materials (mg / 100g dry weight)

[0117]

[0118] From the above results, it can be seen that the three genes PgsA, PgsB, and PgsC have been successfully introduced into corn (Figure 1), and γ-PGA has been successfully detected in the transgenic corn.

[0119] Example 6: Phenotypic identification of transgenic corn

[0120] Transgenic positive corn lines were selected to identify the phenotypes of their entire development period (germination stage, seedling stage, jointing stage, etc.) and seeds.

[0121] The test results are shown in Figure 2 Table 3. The phenotypes of transgenic positive corn and negative control corn under normal growth conditions were observed to determine the effect of heterologous synthesis of γ-PGA in corn on corn growth and development. The results are as follows Figure 2 shown.

[0122] The results showed that the transgenic positive corn lines had better germination rate, higher plant height, and more developed root system, indicating that the synthesis of γ-PGA in corn can promote the growth of corn; the inventors also evaluated its yield under normal irrigation conditions and found that the synthesis of γ-PGA in corn can increase the yield of corn under normal growth conditions, mainly by increasing the number of kernels per ear, kernel weight per ear, and 100-kernel weight (Table 3).

[0123] Example 7 Identification of stress resistance of transgenic corn

[0124] Testing the Drought Resistance of Transgenic Maize

[0125] Transgenic positive corn and negative control corn were subjected to drought stress treatments, and their phenotypes were studied. Drought treatments were divided into PEG-simulated drought treatment and water-cut drought stress treatment.

[0126] The PEG simulated drought treatment mainly selected the germination stage and the three-leaf stage. The corn culture medium selected Hogland nutrient solution (Haibo Biological). The concentrations of PEG6000 selected for drought stress treatment during the germination stage were 14% and 18%, respectively. The seeds of transgenic materials and control materials were disinfected on the surface, and germinated on filter paper containing 0mmol / L, 12% PEG, and 14% PEG solutions, respectively. The germination rate was counted and the growth potential was observed. The concentration of PEG6000 selected for simulated drought treatment during the seedling stage was 18%; the seedling drought treatment adopted potted water cut-off treatment, and physiological and biochemical indicators such as free proline, soluble sugar, chlorophyll content and ABA content were measured. The field drought treatment was implemented at the Sanya South Breeding Base. The method of water cut-off treatment before flowering was selected. The specific implementation method was: water cut-off for 15 days, re-watering once, and water cut-off for another 15 days until harvest, and the stress resistance phenotype and yield were measured.

[0127] The determination methods of free proline, soluble sugar, chlorophyll and ABA content were based on (Wang B, Li Z, Ran Q, et al. ZmNF-YB16 Overexpression Improves Drought Resistance and Yield by Enhancing Photosynthesis and the Antioxidant Capacity of Maize Plants[J]. Frontiers in Plant Science, 2018, 9: 709; Li Z, Liu C, Zhang Y, et al. The bHLHfamily member ZmPTF1 regulates drought tolerance in maize by promoting root development and ABA synthesis[J]. Journal of Experimental Botany, 2019(19): 19.).

[0128] The results of drought resistance analysis are shown in Figure 3-Figure 5 .

[0129] The results showed that the transgenic positive corn could still germinate well under PEG treatment, while the germination of the negative control corn was significantly inhibited ( Figure 3 In the PEG simulated drought treatment test at the seedling stage, the inventors applied 50 mg / L γ-PGA to a portion of the transgenic negative control corn, and cultured the other portion as a control under 18% PEG solution treatment at the same time as the transgenic positive corn. The results showed that under the 18% PEG solution treatment condition, the growth of the negative control corn was significantly inhibited, while the growth of the transgenic positive corn and the exogenous γ-PGA treatment group was significantly better than the control material ( Figure 4 A). The inventors conducted statistics on the fresh weight of the aboveground and underground parts of the transgenic positive corn lines, the negative corn plants with exogenous γ-PGA and the negative control lines after 18% PEG treatment for 5 days, and found that the biomass of the transgenic positive corn lines under PEG treatment was significantly higher than that of the negative control corn, and even slightly higher than that of the corn group with exogenous γ-PGA ( Figure 4 B-4C). This indicates that the heterologous synthesis of γ-PGA in corn can achieve the effect of exogenous application of γ-PGA to improve the drought resistance of corn. This shows that the improved stress resistance of transgenic corn is due to its production of γ-PGA.

[0130] The inventors also conducted a potted water-cut-off experiment on transgenic positive corn and negative control corn at the three-leaf stage. It was found that under early drought stress conditions, transgenic positive corn showed better growth than transgenic negative control corn. After 8 days of water-cut-off treatment, the negative control corn almost wilted and died. When watering was resumed, the transgenic positive corn could still quickly resume growth, while the control corn almost all died ( Figure 5 ). The contents of ABA, soluble sugar, proline and chlorophyll in leaves treated with water deprivation for 6 days were measured. The results showed that under drought stress conditions, heterologous synthesis of γ-PGA in corn can significantly increase the contents of ABA, soluble sugar, proline and chlorophyll in corn leaves, thereby improving the drought resistance of corn (Table 2).

[0131] Table 2 Effects of drought treatment on ABA, soluble sugar, proline and chlorophyll contents in transgenic positive corn and negative control corn

[0132]

[0133] The results of the field drought and water shortage test are shown in Figure 6 The results showed that under field drought conditions, transgenic positive corn also showed good drought resistance.

[0134] The study of transgenic corn salt resistance includes the germination stage and the seedling stage: different concentrations of NaCl solution were selected for salt stress treatment of corn in the germination stage. After the surface of the seeds of transgenic positive materials and negative control materials were sterilized, they were germinated on filter paper containing 150mM NaCl and 200mM NaCl solutions, and the germination was observed; the seedling stage salt resistance test adopted solution stress treatment: the surface of corn seeds was sterilized to germinate and then transferred to nutrient solution (Hogland corn nutrient solution) for cultivation, and the corn cultured to the three-leaf stage was transferred to the nutrient solution containing 200mM NaCl for cultivation, and the phenotypic changes were statistically analyzed.

[0135] The results of salt resistance analysis are shown in Figure 7-Figure 8 The results showed that the germination of transgenic corn seeds was better than that of the negative control corn, regardless of whether it was under low or high concentration NaCl conditions, indicating that transgenic corn had better salt resistance during the germination period. The results of the hydroponic salt resistance test at the seedling stage also showed that transgenic positive corn had obvious salt resistance.

[0136] Comparison of salt and drought resistance between transgenic positive (endogenous synthesis of γ-PGA) corn and wild-type control corn treated with exogenous γ-PGA: The comparison test of drought and salt resistance between transgenic positive (endogenous synthesis of γ-PGA) corn and wild-type inbred lines treated with exogenous γ-PGA adopts the method of solution stress treatment. First, the surface of corn seeds is disinfected and germinated, and then the sprouted seedlings are inserted into the nutrient solution (Hogland corn nutrient solution) for cultivation. When the plants grow to the three-leaf stage, the treatment begins. The transgenic corn lines are transferred to the nutrient solution containing 18% PEG or 200mmol / LNaCl for treatment, and the control corn inbred lines are transferred to the nutrient solution containing 20mg / Lγ-PGA, 18% PEG, 18% PEG+20mg / Lγ-PGA, 200mmol / L NaCl, 200mmol / L NaCl+20mg / Lγ-PGA for treatment. The wild-type corn and transgenic positive corn lines without any treatment are used as controls. The phenotypic changes are observed during the period, and the biomass is finally measured.

[0137] Results Fig. 9 The results showed that the drought and salt resistance of the transgenic corn lines were comparable to those of the wild-type corn treated with exogenous γ-PGA, and even better than that of the wild-type corn with exogenous γ-PGA. This indicates that the transgenic PgsA, PgsB, and PgsC genes have a better effect in improving the drought and salt resistance of corn by endogenously synthesizing γ-PGA in corn.

[0138] Example 8: Yield analysis of transgenic corn under normal and drought conditions

[0139] The transgenic positive corn plants and transgenic negative control corn plants planted in the field were subjected to drought treatment before flowering. The specific implementation method was to cut off water for 15 days and then re-water, then cut off water for another 15 days and then re-water. Finally, the yield was counted.

[0140] Results Figure 2 F. Figure 6 C. Table 3.

[0141] The results showed that under drought conditions, the yield of transgenic positive corn increased significantly. Compared with the yield under normal irrigation conditions, the transgenic corn was less affected by drought, while the yield of negative control corn decreased significantly under drought conditions.

[0142] Table 3. Yield statistics of transgenic positive corn and negative control corn under normal irrigation conditions and drought conditions

[0143]

[0144] Example 9: Detection of starch and amylose content in transgenic positive corn and negative control corn seeds

[0145] The starch and amylose contents in transgenic positive corn and negative control corn seeds were determined according to the method (Xie Guangning. Effects of maize ubiquitin receptors ZmDA1 and ZmDAR1 on grain development [D]. Shandong University, 2017.).

[0146] The comparison of starch and amylose content in transgenic positive corn and negative control corn seeds found that transgenic corn can significantly increase the starch and amylose content in corn seeds.

[0147] The results are shown in Table 4.

[0148] Table 4. Starch and amylose content in transgenic positive corn and negative control corn seeds

[0149]

[0150] In summary, the present invention provides a method for synthesizing γ-PGA in plants for the first time by using synthetic biology and genetic engineering technology, and successfully detects the synthesis of γ-PGA in transgenic corn, proving that γ-PGA can be heterologously synthesized in plants; and the present invention selects corn, a major food crop, as the test material, and the obtained transgenic corn is confirmed to significantly improve its drought and salt resistance, and significantly increase its yield under drought conditions; the yield under normal irrigation conditions without stress does not decrease, and even slightly increases; the present invention also measures the quality of transgenic corn kernels, and finds that synthesizing γ-PGA in corn can also increase the starch content and amylose content in corn kernels. The above research results suggest that the method of the present invention can be widely used in crop stress resistance molecular breeding, crop biomass improvement, etc., and has important theoretical significance and huge economic value. SEQUENCE LISTING <110> Qilu University of Technology <120> Method for heterologous synthesis of γ-polyglutamic acid in plants to improve plant stress resistance and yield <130> 1 <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 389 <212> PRT <213> Bacillus licheniformis <400> 1 Met Lys Lys Gln Leu Asn Phe Gln Glu Lys Leu Leu Lys Leu Thr Lys 1 5 10 15 Gln Glu Lys Lys Lys Thr Asn Lys His Val Phe Ile Val Leu Pro Val 20 25 30 Ile Phe Cys Leu Met Phe Val Phe Thr Trp Val Gly Ser Ala Lys Thr 35 40 45 Pro Ser Gln Met Asp Lys Lys Glu Asp Ala Lys Leu Thr Ala Thr Phe 50 55 60 Val Gly Asp Ile Met Met Gly Arg Asn Val Glu Lys Val Thr Asn Leu 65 70 75 80 His Gly Ser Glu Ser Val Phe Lys Asn Val Lys Pro Tyr Phe Asn Val 85 90 95 Ser Asp Phe Ile Thr Gly Asn Phe Glu Asn Pro Val Thr Asn Ala Lys 100 105 110 Asp Tyr Gln Glu Ala Glu Lys Asn Ile His Leu Gln Thr Asn Gln Glu 115 120 125 Ser Val Glu Thr Leu Lys Lys Leu Asn Phe Ser Val Leu Asn Phe Ala 130 135 140 Asn Asn His Ala Met Asp Tyr Gly Glu Asp Gly Leu Lys Asp Thr Leu 145 150 155 160 Asn Lys Phe Ser Asn Glu Asn Leu Glu Leu Val Gly Ala Gly Asn Asn 165 170 175 Leu Glu Asp Ala Lys Gln His Val Ser Tyr Gln Asn Val Asn Gly Val 180 185 190 Lys Ile Ala Thr Leu Gly Phe Thr Asp Val Tyr Thr Lys Asn Phe Thr 195 200 205 Ala Lys Lys Asn Arg Gly Gly Val Leu Pro Leu Ser Pro Lys Ile Phe 210 215 220 Ile Pro Met Ile Ala Glu Ala Ser Lys Lys Ala Asp Leu Val Leu Val 225 230 235 240 His Val His Trp Gly Gln Glu Tyr Asp Asn Glu Pro Asn Asp Arg Gln 245 250 255 Lys Asp Leu Ala Lys Ala Ile Ala Asp Ala Gly Ala Asp Val Ile Ile 260 265 270 Gly Ala His Pro His Val Leu Glu Pro Ile Glu Val Tyr Asn Gly Thr 275 280 285 Val Ile Phe Tyr Ser Leu Gly Asn Phe Val Phe Asp Gln Gly Trp Ser 290 295 300 Arg Thr Arg Asp Ser Ala Leu Val Gln Tyr His Leu Met Asn Asp Gly 305 310 315 320 Lys Gly Arg Phe Glu Val Thr Pro Leu Asn Ile Arg Glu Ala Thr Pro 325 330 335 Thr Pro Leu Gly Lys Ser Asp Phe Leu Lys Arg Lys Ala Ile Phe Arg 340 345 350 Gln Leu Thr Lys Gly Thr Asn Leu Asp Trp Lys Glu Glu Asn Gly Lys 355 360 365 Leu Thr Phe Glu Val Asp His Ala Asp Lys Leu Lys Asn Asn Lys Asn 370 375 380 Gly Val Val Asn Lys 385 <210> 2 <211> 393 <212> PRT <213> Bacillus licheniformis <400> 2 Met Trp Val Met Leu Leu Ala Cys Val Ile Val Val Gly Ile Gly Ile 1 5 10 15 Tyr Glu Lys Arg Arg His Gln Gln Asn Ile Asp Ala Leu Pro Val Arg 20 25 30 Val Asn Ile Asn Gly Ile Arg Gly Lys Ser Thr Val Thr Arg Leu Thr 35 40 45 Thr Gly Ile Leu Ile Glu Ala Gly Tyr Lys Thr Val Gly Lys Thr Thr 50 55 60 Gly Thr Asp Ala Arg Met Ile Tyr Trp Asp Thr Pro Glu Glu Lys Pro 65 70 75 80 Ile Lys Arg Lys Pro Gln Gly Pro Asn Ile Gly Glu Gln Lys Glu Val 85 90 95 Met Lys Glu Thr Val Glu Arg Gly Ala Asn Ala Ile Val Ser Glu Cys 100 105 110 Met Ala Val Asn Pro Asp Tyr Gln Ile Ile Phe Gln Glu Glu Leu Leu 115 120 125 Gln Ala Asn Ile Gly Val Ile Val Asn Val Leu Glu Asp His Met Asp 130 135 140 Val Met Gly Pro Thr Leu Asp Glu Ile Ala Glu Ala Phe Thr Ala Thr 145 150 155 160 Ile Pro Tyr Asn Gly His Leu Val Ile Thr Asp Ser Glu Tyr Thr Asp 165 170 175 Phe Phe Lys Gln Ile Ala Lys Glu Arg Asn Thr Lys Val Ile Val Ala 180 185 190 Asp Asn Ser Lys Ile Thr Asp Glu Tyr Leu Arg Gln Phe Glu Tyr Met 195 200 205 Val Phe Pro Asp Asn Ala Ser Leu Ala Leu Gly Val Ala Gln Ala Leu 210 215 220 Gly Ile Asp Glu Glu Thr Ala Phe Lys Gly Met Leu Asn Ala Pro Pro 225 230 235 240 Asp Pro Gly Ala Met Arg Ile Leu Pro Leu Met Asn Ala Lys Asn Pro 245 250 255 Gly His Phe Val Asn Gly Phe Ala Ala Asn Asp Ala Ala Ser Thr Leu 260 265 270 Asn Ile Trp Lys Arg Val Lys Glu Ile Gly Tyr Pro Thr Asp Gln Pro 275 280 285 Ile Val Ile Met Asn Cys Arg Ala Asp Arg Val Asp Arg Thr Gln Gln 290 295 300 Phe Ala Glu Asp Val Leu Pro Tyr Ile Glu Ala Ser Glu Leu Val Leu 305 310 315 320 Ile Gly Glu Thr Thr Glu Pro Ile Val Lys Ala Tyr Glu Ala Gly Lys 325 330 335 Ile Pro Ala Asp Lys Leu Phe Asp Phe Glu His Lys Ser Thr Glu Glu 340 345 350 Ile Met Phe Met Leu Lys Asn Lys Leu Glu Gly Arg Val Ile Tyr Gly 355 360 365 Val Gly Asn Ile His Gly Ala Ala Glu Pro Leu Ile Glu Lys Ile Gln 370 375 380 Asp Tyr Lys Ile Lys Gln Leu Val Ser 385 390 <210> 3 <211> 149 <212> PRT <213> Bacillus licheniformis <400> 3 Met Phe Gly Ser Asp Leu Tyr Ile Ala Leu Ile Leu Gly Val Leu Leu 1 5 10 15 Ser Leu Ile Phe Ala Glu Lys Thr Gly Ile Val Pro Ala Gly Leu Val 20 25 30 Val Pro Gly Tyr Leu Gly Leu Val Phe Asn Gln Pro Ile Phe Met Leu 35 40 45 Leu Val Leu Phe Val Ser Leu Leu Thr Tyr Val Ile Val Lys Phe Gly 50 55 60 Leu Ser Lys Ile Met Ile Leu Tyr Gly Arg Arg Lys Phe Ala Ala Met 65 70 75 80 Leu Ile Thr Gly Ile Leu Leu Lys Ile Gly Phe Asp Phe Ile Tyr Pro 85 90 95 Val Met Pro Phe Glu Ile Ala Glu Phe Arg Gly Ile Gly Ile Ile Val 100 105 110 Pro Gly Leu Ile Ala Asn Thr Ile Gln Arg Gln Gly Leu Thr Ile Thr 115 120 125 Leu Gly Ser Thr Leu Leu Leu Ser Gly Ala Thr Phe Val Ile Met Tyr 130 135 140 Ala Tyr Tyr Leu Ile 145 <210> 4 <211> 1170 <212> DNA <213> unknown <220> <223> Synthetic <400> 4 atgaagaagc agctcaactt ccaggagaag ctcctgaagc tgaccaagca ggagaagaag 60 aagaccaaca agcacgtctt catcgtgctc ccggtcatct tctgcctgat gttcgtgttc 120 acctgggtgg gctcggctaa gaccccaagc cagatggaca agaaggagga cgcgaagctc 180 accgccacgt tcgtcggcga catcatgatg ggccgcaacg tggagaaggt caccaacctg 240 cacggctccg agagcgtgtt caagaacgtc aagccgtact tcaacgtgtc cgacttcatc 300 accggcaact tcgagaaccc cgtcacgaac gcgaaggact accaggaggc cgagaagaac 360 atccacctcc agaccaacca ggagtccgtg gagacgctca agaagctgaa cttcagcgtc 420 ctgaacttcg cgaacaacca cgccatggac tacggcgagg acggcctcaa ggacaccctg 480 540. aacaagttct ccaacgagaa cctcgagctg gtggggcgccg gcaacaacct cgaggacgcc aagcagcacg tcagctacca gaacgtgac ggcgtcaaga tcgcgaccct gggcttcacg gacgtgtaca ccaagaactt caccgccaag aagaaccgcg gcggcgtcct ccccctgtcc cccaagatct tcatcccgat gatcgccgag gcgagcaaga aggcggacct cgtgctggtc 720 cacgtgcact ggggccagga gtacgacaac gagcccaacg acaggcagaa ggacctcgct aaggccatcg cggacgccgg cgcggacgtg atcatcggcg cccaccccca cgtcctggag 840 cccatcgagg tgtacaacgg caccgtcatc ttctactccc tgggcaactt cgtgttcgac900 cagggctggt ccaggaccag ggacagcgcc ctcgtccagt accacctgat gaacgacggc 960 aagggcaggt tcgaggtgac cccgctgac atcagggagg ccacgcccac gcccctcggc 1020 aagagcgact tcctgaagcg caaggccatc ttcaggcagc tcaccaaggg cacgaacctg gactggaagg aggagaacgg caagctcacg ttcgaggtgg accacgccga caagctgaag aacaacaaga acggcgtggt aacaagtag 1170 <210> 5 <211> 1182 <212> DNA <213> unknown <220> <223> synthetic <400> 5 atgtgggtca tgctcctggc ctgcgtgatc gtggtcggca tcggcatcta cgagaagcgc 60 aggcaccagc agaacatcga cgcgctcccc gtgagggtca acatcaacgg catccgcggc 120 aagtccaccg tgacgaggct caccacgggc atcctgatcg aggccggcta caagacggtg 180 ggcaagacca ccggcaccga cgcccgcatg atctactggg acaccccgga ggagaagccc 240 atcaagcgga agccccaggg cccaaacatc ggcgagcaga aggaggtcat gaaggagacg 300 gtggagaggg gcgccaacgc gatcgtctcc gagtgcatgg ccgtgaaccc ggactaccag 360 atcatcttcc aggaggagct cctgcaggcg aacatcggcg tgatcgtcaa cgtgctcgag 420 gaccacatgg acgtgatggg cccaaccctg gacgagatcg cggaggcgtt caccgccacg 480 atcccgtaca acggccacct cgtcatcacc gacagcgagt acacggactt cttcaagcag 540 atcgccaagg agcgcaacac caaggtcatc gtggcggaca actccaagat cacggacgag 600 tacctgaggc agttcgagta catggtgttc ccggacaacg ctagcctggc cctgggcgtg 660 gctcaggccc tgggcatcga cgaggagacc gccttcaagg gcatgctgaa cgccccgcca 720 gaccccggcg ccatgcgcat cctccccctg atgaacgcga agaaccccgg cacttcgtg 780 aacggcttcg ctgccaacga cgctgcctcc acctgaaca tctggaagag ggtcaaggag 840 atcggctacc cgacggacca gcccatcgtc atcatgaact gcagggcgga ccgggtggac 900 aggacccagc agttcgcgga ggacgtcctc cctacatcg aggcgtccga gctcgtgctg 960 atcggcgaga ccacggagcc catcgtcaag gcttacgagg ccggcaagat ccccgctgac 1020 aagctgtcg acttcgagca caagagcacg gaggagatca tgttcatgct caagaacaag 1080 ctggagggga gggtcatcta cggcgtgggc aacatccacg gcgcggccga gcccctcatc 1140 gagaagatcc aggactacaa gatcaagcag ctggtgagct ag 1182 <210> 6 <211> 450 <212> DNA <213> unknown <400> 6 atgttcggct ccgacctgta catcgccctg atcctcggcg tgctcctgag cctcatcttc 60 gccgagaaga cgggcatcgt ccccgccggc ctggtggtc ccggctacct gggcctcgtg 120 ttcaaccagc cgatcttcat gctcctggtg ctcttcgtct ccctcctgac ctacgtgatc 180 gtcaagttcg gcctgagcaa gatcatgatc ctctacggcc gcaggaagtt cgccgcgatg 240 ctgatcacgg gcatcctcct gaagatcggc ttcgacttca tctacccggt catgcccttc 300 gagatcgccg agttccgcgg catcggcatc atcgtgccgg gcctgatcgc gaacacgatc 360 cagaggcagg gcctgaccat caccctgggc tccaccctcc tgctctcggg cgctaccttc 420 gtcatcatgt acgcgtacta cctcatctag 450 <210> 7 <211> 13793 <212> DNA <213> unknown <400> 7 aattgacgct tagacaactt aataacacat tgcggacgtt tttaatgtac tgaattaacg 60 ccgaattaat tcgggggatc tggattttag tactggattt tggttttagg aattagaaat 120 tttattgata gaagtatttt acaaatacaa atacatacta agggtttctt atatgctcaa 180 cacatgagcg aaaccctata ggaaccctaa ttcccttatc tgggaactac tcacacatta 240 ttatggagaa actcgaaatt cgagctcagt caaatctcgg tgacgggcag gaccggacgg 300 ggcggtaccg gcaggctgaa gtccagctgc cagaaaccca cgtcatgcca gttcccgtgc 360 ttgaagccgg ccgcccgcag catgccgcgg ggggcatatc cgagcgcctc gtgcatgcgc 420 acgctcgggt cgttgggcag cccgatgaca gcgaccacgc tcttgaagcc ctgtgcctcc 480 agggacttca gcaggtgggt gtagagcgtg gagcccagtc ccgtccgctg gtggcggggg 540 gagacgtaca cggtcgactc ggccgtccag tcgtaggcgt tgcgtgcctt ccaggggccc 600 gcgtaggcga tgccggcgac ctcgccgtcc acctcggcga cgagccaggg atagcgctcc 660 cgcagacgga cgaggtcgtc cgtccactcc tgcggttcct gcggctcggt acggaagttg 720 accgtgcttg tctcgatgta gtggttgacg atggtgcaga ccgccggcat gtccgcctcg 780 gtggcacggc ggatgtcggc cgggcgtcgt tctgggctca tggtagactc gatcctctag 840 agtcgacctg cagaagtaac accaaacaac agggtgagca tcgacaaaag aaacagtacc 900 aagcaaataa atagcgtatg aaggcagggc taaaaaaatc cacatatagc tgctgcatat 960 gccatcatcc aagtatatca agatcaaaat aattataaaa catacttgtt tattataata 1020 gataggtact caaggttaga gcatatgaat agatgctgca tatgccatca tgtatatgca 1080 tcagtaaaac ccacatcaac atgtatacct atcctagatc gatatttcca tccatcttaa 1140 actcgtaact atgaagatgt atgacacaca catacagttc caaaattaat aaatacacca 1200 ggtagttga aacagtattc tactccgatc tagaacgaat gaacgaccgc ccaaccacac 1260 cacatcatca caaccaagcg aaaaaagc atctctgtat atgcatcagt aaaacccgca 1320 tcaacatgta tacctatcct agatcgatat ttccatccat catcttcaat tcgtaactat 1380 gaatatgtat ggcacacaca tacagatcca aaattaataa atccaccagg tagtttgaaa 1440 cagaattcta ctccgatcta gaacgaccgc ccaaccagac cacatcatca caaccaagac 1500 aaaaaaaagc atgaaaagat gacccgacaa acaagtgcac ggcatatatt gaaataaagg 1560 aaaagggcaa accaaaccct atgcaacgaa acaaaaaaaa tcatgaaatc gatcccgtct 1620 gcggaacggc tagagccatc ccaggattcc ccaaagagaa acactggcaa gttagcaatc 1680 agaacgtgtc tgacgtacag gtcgcatccg tgtacgaacg ctagcagcac ggatctaaca 1740 caacacgga tcacacaca acatgacag aagtagaact accgggccct aaccatggac 1800 cggaacgccg atcgagaa ggtagagagg ggggggggga ggacgagcgg cgtaccttga 1860 agcggaggtg ccgacgggtg gatttggggg agatctggtt gtgtgtgtgt gcgctccgaa 1920 cacacgagg ttgggaag agggtgtgga gggggtgtct attack gcggggcgagg 1980 aagggaaagc gaaggagcgg tgggaagga atccccgta gctgccggtg ccgtgagagg 2040 agggaggc cgcctgccgt gccggctcac gtctgccgct ccgccacgca atttctggat 2100 gccgacagcg gagcaagtcc aacggtggag cggaacctc gagaggggtc cagaggcagc 2160 gabagagatg ccgtgccgtc tgcttcgctt ggcccgacgc gacgctgctg gttcgctggt 2220 tggtgtccgt tagactcgtc gacggcgttt aacaggctgg cattatctac tcgaaacaag 2280 aaaaatgttt ccttagtttt tttaatttct taaagggtat tgtttaatt tttagtcact 2340 ttattttatt ctattatta tctaaattat taaaaaaaaaaaaa gagttttagt 2400 tttctttatt taggcttaa atagaata atagatagta ctaaaaaaat tagctcttaa 2460 aaaccattaa ccctaaaccc taaatggatg tactaaaa atggatgag tattatatag 2520 gtgaagctat ttgcaaaaa aaaggagaac acatgcacac taaaagata aactgtaga 2580 gtcctgttgt caaatactc aattgtcctt tagaccatgt ctaactgttc atttatatga 2640 ttctctaaaa cactgatatt attgtagtac tatagattat attattcgta gagtaaagtt 2700 taaatatatg tataaata gataaactgc acttcaaca agtgtgaca aaaaaatatg 2760 tggtaattt ttataactta gatagcaat gctcattatc tctagagagg ggcacgaccg 2820 ggtcacgctg cactgcaggc atgctgagac tttcaacaa agggtatatat ccggaaacct 2880 cctcggattc cattgcccag ctatctgtca ctttattgtg agatagtgg aaaggaagg 2940 tggctcctac aaatgccatc attgcgataa aggaaggcc atcgttgaag atgcctctgc 3000 cgacagtggt cccaaagatg gacccccacc cacgaggagc atcgtggaaa aagagacgt 3060 tccacacg tctcaacg agtggattg atgtgatatc tccacacg agtgtg 3120 cgcacaatcc cactatcctt cgcagaccc ttcctctata taggaagtt cattcattt 3180 ggagagaaca ggatcatgaa gaagcagctc aacttccagg agaagctcct gaagctgacc 3240 aagcaggaga agaagaagac caacaagcac gtcttcatcg tgctcccggt catcttctgc 3300 ctgatgttcg tgttcacctg ggtgggctcg gctaagaccc caagccagat ggacaagaag 3360 gaggacgcga agctcaccgc cacgttcgtc ggcgacatca tgatgggccg caacgtggag 3420 aaggtcacca acctgcacgg ctccgagagc gtgttcaaga acgtcaagcc gtacttcaac 3480 gtgtccgact tcatcaccgg caacttcgag aaccccgtca cgaacgcgaa ggactaccag 3540 gaggccgaga agaacatcca cctccagacc aaccaggagt ccgtggagac gctcaagaag 3600 ctgaacttca gcgtcctgaa cttcgcgaac aaccacgcca tggactacgg cgaggacggc 3660 ctcaaggaca ccctgaacaa gttctccaac gagaacctcg agctggtggg cgccggcaac 3720 aacctcgagg acgccaagca gcacgtcagc taccagaacg tgaacggcgt caagatcgcg 3780 accctgggct tcacggacgt gtacaccaag aacttcaccg ccaagaagaa ccgcggcggc 3840 gtcctccccc tgtcccccaa gatcttcatc ccgatgatcg ccgaggcgag caagaaggcg 3900 gacctcgtgc tggtccacgt gcactggggc caggagtacg acaacgagcc caacgacagg 3960 cagaaggacc tcgctaaggc catcgcggac gccggcgcgg acgtgatcat cggcgcccac 4020 ccccacgtcc tggagcccat cgaggtgtac aacggcaccg tcatcttcta ctccctgggc 4080 aacttcgtgt tcgaccaggg ctggtccagg accagggaca gcgccctcgt ccagtaccac 4140 ctgatgaacg acggcaaggg caggttcgag gtgaccccgc tgaacatcag ggaggccacg 4200 cccacgcccc tcggcaagag cgacttcctg aagcgcaagg ccatcttcag gcagctcacc 4260 aagggcacga acctggactg gaaggaggag aacggcaagc tcacgttcga ggtggaccac 4320 gccgacaagc tgaagaacaa caagaacggc gtggtcaaca agtaggatcg ttcaaacatt 4380 tggcaataaa gtttcttaag attgaatcct gttgccggtc ttgcgatgat tatcatataa 4440 tttctgttga attacgttaa gcatgtaata attaacatgt aatgcatgac gttatttatg 4500 agatgggttt ttatgattag agtcccgcaa ttatacattt aatacgcgat agaaaacaaa 4560 atatagcgcg caaactagga taaattatcg cgcgcggtgt catctatgtt actagatcgg 4620 atcctgagac ttttcaacaa agggtatatat ccggaacct cctcggattc cattgcccag 4680 ctatctgtca ctttattgtg aagatagtgg aaaaggaagg tggctcctac aaatgccatc 4740 attgcgataa aggaaggcc atcgttgaag atgcctctgc cgacagtggt cccaagatg 4800 gacccccacc cacgaggagc atcgtggaaa aagagacgt tccaccacg tctcaagc 4860 aagtggattg atgtgatatc tccactgacg tagggatga cgcacaatcc cactacctt 4920 cgcaagaccc ttcctctata taggaagtt cattcattt ggagagaca atgtgggtca 4980 tgctcctggc ctgcgtgatc gtggtcggca tcggcatcta cgagaagcgc aggcaccagc 5040 agaacatcga cgcgctcccc gtgagggtca acatcaacgg catccgcggc aagtccaccg 5100 tgacgaggct caccacggggc atcctgatcg aggccggcta caacggtg ggcaagacca 5160 ccggcaccga cgcccgcatg atctactggg acaccccgga ggagaagccc atcagcgga 5220 agccccagggg cccaacacatc ggcgagcaga aggaggtcat gaggagacg gtggagaggg 5280 gcgccaacgc gatcgtctcc gagtgcatgg ccgtgaaccc ggactaccag atcatctcc 5340 aggaggagct cctgcaggcg aacatcggcg tgatcgtcaa cgtgctcgag gaccacatgg 5400 acgtgatggg cccaaccctg gacgagatcg cggaggcgtt caccgccacg atcccgtaca 5460 acggccacct cgtcatcacc gacagcgagt acacggactt cttcaagcag atcgccaagg 5520 agcgcaacac caaggtcatc gtggcggaca actccaagat cacggacgag tacctgaggc 5580 agttcgagta catggtgttc ccggacaacg ctagcctggc cctgggcgtg gctcaggccc 5640 tgggcatcga cgaggagacc gccttcaagg gcatgctgaa cgccccgcca gaccccggcg 5700 ccatgcgcat cctccccctg atgaacgcga agaaccccgg ccacttcgtg aacggcttcg 5760 ctgccaacga cgctgcctcc accctgaaca tctggaagag ggtcaaggag atcggctacc 5820 cgacggacca gcccatcgtc atcatgaact gcagggcgga ccgggtggac aggacccagc 5880 agttcgcgga ggacgtcctc ccctacatcg aggcgtccga gctcgtgctg atcggcgaga 5940 ccacggagcc catcgtcaag gcttacgagg ccggcaagat ccccgctgac aagctgttcg 6000 acttcgagca caagagcacg gaggagatca tgttcatgct caagaacaag ctggagggga 6060 gggtcatcta cggcgtgggc aacatccacg gcgcggccga gcccctcatc gagaagatcc 6120 aggactacaa gatcaagcag ctggtgagct aggatcgttc aaacatttgg caataaagtt 6180 tcttaagatt gaatcctgtt gccggtcttg cgatgattat catataattt ctgttgaatt 6240 acgttaagca tgtaataatt aacatgtaat gcatgacgtt atttatgaga tgggttttta 6300 tgattagagt cccgcaatta tacatttaat acgcgataga aaacaaaata tagcgcgcaa 6360 actaggataa attatcgcgc gcggtgtcat ctatgttact agatcaagct ttgagacttt 6420 tcaacaaagg gtaatatccg gaaacctcct cggattccat tgcccagcta tctgtcactt 6480 tattgtgaag atagtggaaa aggaaggtgg ctcctacaaa tgccatcatt gcgataaagg 6540 aaaggccatc gttgaagatg cctctgccga cagtggtccc aaagatggac ccccacccac 6600 gaggagcatc gtggaaaaag aagacgttcc aaccacgtct tcaaagcaag tggattgatg 6660 tgatatctcc actgacgtaa gggatgacgc acaatcccac tatccttcgc aagacccttc 6720 ctctatataa ggaagttcat ttcatttgga gagaacaatg ttcggctccg acctgtacat 6780 cgccctgatc ctcggcgtgc tcctgagcct catcttcgcc gagaagacgg gcatcgtccc 6840 cgccggcctg gtggtccccg gctacctggg cctcgtgttc aaccagccga tcttcatgct 6900 cctggtgctc ttcgtctccc tcctgaccta cgtgatcgtc aagttcggcc tgagcaagat 6960 catgatcctc tacggccgca ggaagttcgc cgcgatgctg atcacgggca tcctcctgaa 7020 gatcggcttc gacttcatct acccggtcat gcccttcgag atcgccgagt tccgcggcat 7080 cggcatcatc gtgccgggcc tgatcgcgaa cacgatccag aggcagggcc tgaccatcac 7140 cctgggctcc accctcctgc tctcgggcgc taccttcgtc atcatgtacg cgtactacct 7200 catctagggt gaccgatcgt tcaaacattt ggcaataaag tttcttaaga ttgaatcctg 7260 ttgccggtct tgcgatgatt atkatataat ttctgttgaa ttacgttaag catgtaataa 7320 ttaacatgta atgcatgacg ttatttatga gatgggtttt tatgattaga gtcccgcaat 7380 tatacattta atacgcgata gaaaacaaaa tatagcgcgc aaactaggat aaattatcgc 7440 gcgcggtgtc atctatgtta ctagatcgcg tttaaactat cagtgtttga caggatatat 7500 tggcgggtaa acctaagaga aaagagcgtt tattagaata atcggatatt taaaagggcg 7560 tgaaaaggtt tatccgttcg tccatttgta tgtgcatgcc aaccacaggg ttcccctcgg 7620 gatcaaagta ctttgatcca acccctccgc tgctatagtg cagtcggctt ctgacgttca 7680 gtgcagccgt cttctgaaaa cgacatgtcg cacaagtcct aagttacgcg acaggctgcc 7740 gccctgccct tttcctggcg ttttcttgtc gcgtgtttta gtcgcataaa gtagaatact 7800 tgcgactaga accggagaca ttacgccatg aacaagagcg ccgccgctgg cctgctgggc 7860 tatgcccgcg tcagcaccga cgaccaggac ttgaccaacc aacgggccga actgcacgcg 7920 gccggctgca ccaagctggtt ttccgagaag atcaccggca ccaggcgcga ccgccccggag 7980 ctggccagga tgcttgacca cctacgccct ggcgacgttg tgacagtgac caggctagac 8040 cgcctggccc gcagcacccg cgacctactg gacattgccg agcgcatcca ggaggccggc 8100 gcgggcctgc gtagcctggc agagccgtgg gccgacacca ccacgccggc cggccgcatg 8160 gtgttgaccg tgttcgccgg cattgccgag ttcgagcgtt ccctaatcat cgaccgcacc 8220 cggagcgggc gcgaggccgc caaggcccga ggcgtgaagt ttggcccccg ccctaccctc 8280 accccggcac agatcgcgca cgcccgcgag ctgatcgacc aggaaggccg caccgtgaaa 8340 gaggcggctg cactgcttgg cgtgcatcgc tcgaccctgt accgcgcact tgagcgcagc 8400 gaggaagtga cgcccaccga ggccaggcgg cgcggtgcct tccgtgagga cgcattgacc 8460 gaggccgacg ccctggcggc cgccgagaat gaacgccaag aggaacaagc atgaaaccgc 8520 accaggacgg ccaggacgaa ccgtttttca ttaccgaaga gatcgaggcg gagatgatcg 8580 cggccgggta cgtgttcgag ccgcccgcgc acgtctcaac cgtgcggctg catgaaatcc 8640 tggccggttt gtctgatgcc aagctggcgg cctggccggc cagcttggcc gctgaagaaa 8700 ccgagcgccg ccgtctaaaa aggtgatgtg tatttgagta aaacagcttg cgtcatgcgg 8760 tcgctgcgta tatgatgcga tgagtaaata aacaaatacg caaggggaac gcatgaaggt 8820 tatcgctgta cttaaccaga aaggcgggtc aggcaagacg accatcgcaa cccatctagc 8880 ccgcgccctg caactcgccg gggccgatgt tctgttagtc gattccgatc cccagggcag 8940 tgcccgcgat tgggcggccg tgcgggaaga tcaaccgcta accgttgtcg gcatcgaccg 9000 cccgacgatt gaccgcgacg tgaaggccat cggccggcgc gacttcgtag tgatcgacgg 9060 agcgccccag gcggcggact tgctgtgtc cgcgatcaag gcagccgact tcgtgctgat 9120 tccggtgcag ccaagccctt acgacatatg ggccaccgcc gacctggtgg agctggttaa 9180 gcagcgcatt gaggtcacgg atggaaggct acaagcggcc tttgtcgtgt cgcgggcgat 9240 caaaggcacg cgcatcggcg gtgaggttgc cgaggcgctg gccgggtacg agctgcccat 9300 tcttgagtcc cgtatcacgc agcgcgtgag ctacccaggc actgccgccg ccggcacaac 9360 cgttcttgaa tcagaacccg agggcgacgc tgcccgcgag gtccaggcgc tggccgctga 9420 aattaaatca aaactcattt gagttaatga ggtaaagaga aaatgagcaa aagcacaaac 9480 acgctaagtg ccggccgtcc gagcgcacgc agcagcaagg ctgcaacgtt ggccagcctg 9540 gcagacacgc cagccatgaa gcgggtcaac tttcagttgc cggcggagga tcacaccaag 9600 ctgaagatgt acgcggtacg ccaaggcaag accattaccg agctgctatc tgaatacatc 9660 gcgcagctac agagtaat gagcaatga aatgagt nationaltt tagcggcta 9720 aggaggcggc atggaaatc aagacaacc agcaccgac gccgtggaat gccccatgtg 9780 tggaggaacg ggcggttggc caggcgtaag cggctggtt gcctgccggc cctgcaatgg 9840 cactggaacc cccaagcccg aggaatcggc gtgagcggtc gcaaccacc cggcccggta 9900 caaatcggcg cggcgctggg tgatgacctg gtggagaagt tgaggccgc gcaggccgcc 9960 cagcggcaac gcatcgaggc agaagcacgc cccggtgaat cgtggcaagc ggccgctgat 10020 cgaatccgca aagaatcccg gcaacccg gcagccggtg cgccgtcgat taggaagccg 10080 cccaagggcg acgagcacc agatttc gttccgatgc tctatgacgt gggcaccccgc 10140 gatagtcgca gcatcatgga cgtggccgtt tccgtctgt cgaagcgtga ccgacgagct 10200 ggcgaggtga tccgctacga gcttccagac gggcacgtag aggttccgc agggccggcc 10260 ggcatggcca gtgtgtggga ttacgacctg gtactgatgg cggtttccca tctaccgaa 10320 tccatgaacc gataccggga agggaaggga gandaagcccg gccgcgtgtt ccgtccacac 10380 gttgcggacg tactcaagtt ctgccggcga gccgatggcg gaagcagaa agacgacctg 10440 gtagaaacct gcattcggtt aaacaccacg cacgttgcca tgcagcgtac gaagaggcc 10500 aagaacggcc gcctggtgac ggtatccgag ggtgaagcct tgattagccg ctacaagatc 10560 gtaaagagcg aaaccgggcg gccggagtac atcgagatcg agctagctga ttggatgtac 10620 cgcgagatca cagaaggcaa gaacccggac gtgctgacgg ttcaccccga ttactttttg 10680 atcgatcccg gcatcggccg ttttctctac cgcctggcac gccgcgccgc aggcaaggca 10740 gaagccagat ggttgttcaa gacgatctac gaacgcagtg gcagcgccgg agagttcaag 10800 aagttctgtt tcaccgtgcg caagctgatc gggtcaaatg acctgccgga gtacgatttg 10860 aaggaggagg cggggcaggc tggcccgatc ctagtcatgc gctaccgcaa cctgatcgag 10920 ggcgaagcat ccgccggttc ctaatgtacg gagcagatgc tagggcaaat tgccctagca 10980 ggggaaaaag gtcgaaaagg tctctttcct gtggatagca cgtacattgg gaacccaaag 11040 ccgtacattg ggaaccggaa cccgtacatt gggaacccaa agccgtacat tgggaaccgg 11100 tcacacatgt aagtgactga tataaaagag aaaaaaggcg atttttccgc ctaaaactct 11160 ttaaaactta ttaaaactct taaaacccgc ctggcctgtg cataactgtc tggccagcgc 11220 acagccgaag agctgcaaaa agcgcctacc cttcggtcgc tgcgctccct acgccccgcc 11280 gcttcgcgtc ggcctatcgc ggccgctggc cgctcaaaaa tggctggcct acggccaggc 11340 aatctaccag ggcgcggaca agccgcgccg tcgccactcg accgccggcg cccacatcaa 11400 ggcaccctgc ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca tgcagctccc 11460 ggagacggtc acagcttgtc tgtaagcgga tgccgggagc agacaagccc gtcagggcgc 11520 gtcagcgggt gttggcgggt gtcggggcgc agccatgacc cagtcacgta gcgatagcgg 11580 agtgtatact ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccatatg 11640 cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct 11700 tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 11760 tcaaaggcgg tatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 11820 gcaaaaggcc agcaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 11880 aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 11940 ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 12000 gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 12060 cttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 12120 ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 12180 cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 12240 attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 12300 ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 12360 aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggtttttt 12420 gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt 12480 tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgcat 12540 tctaggtact aaaacaattc atccagtaaa atataatatt ttattttctc ccaatcaggc 12600 ttgatcccca gtaagtcaaa aaatagctcg acatactgtt cttccccgat atcctccctg 12660 atcgaccgga cgcagaaggc aatgtcatac cacttgtccg ccctgccgct tctcccaaga 12720 tcaataaagc cacttacttt gccatctttc acaaagatgt tgctgtctcc caggtcgccg 12780 tgggaaaaga caagttcctc ttcgggcttt tccgtcttta aaaaatcata cagctcgcgc 12840 ggatctttaa atggagtgtc ttcttcccag ttttcgcaat ccacatcggc cagatcgtta 12900 ttcagtaagt aatccaattc ggctaagcgg ctgtctaagc tattcgtata gggacaatcc 12960 gatatgtcga tggagtgaaa gagcctgatg cactccgcat acagctcgat aatcttttca 13020 gggctttgtt catcttcata ctcttccgag caaaggacgc catcggcctc actcatgagc 13080 agattgctcc agccatcatg ccgttcaaag tgcaggacct ttggaacagg cagctttcct 13140 tccagccata gcatcatgtc cttttcccgt tccacatcat aggtggtccc tttataccgg 13200 ctgtccgtca tttttaaata taggttttca ttttctccca ccagcttata taccttagca 13260 ggagacattc cttccgtatc ttttacgcag cggtattttt cgatcagttt tttcaattcc 13320 ggtgatattc tcattttagc catttattat ttccttcctc ttttctacag tatttaaaga 13380 taccccaaga agctaattat aacaagacga actccaattc actgttcctt gcattctaaa 13440 accttaaata ccagaaaaca gctttttcaa agttgttttc aaagttggcg tataacatag 13500 tatcgacgga gccgattttg aaaccgcggt gatcacaggc agcaacgctc tgtcatcgtt 13560 acaatcaaca tgctaccctc cgcgagatca tccgtgtttc aaacccggca gcttagttgc 13620 cgttcttccg aatagcatcg gtaacatgag caaagtctgc cgccttacaa cggctctccc 13680 gctgacgccg tcccggactg atgggctgcc tgtatcgagt ggtgattttg tgccgagctg 13740 ccggtcgggg agctgttggc tggctggtgg caggatatat tgtggtgtaa aca 13793

Claims

1. The application of heterologous synthesis of γ-polyglutamic acid in corn to increase the content of amylose in corn grains and simultaneously improve any one of drought resistance, salt resistance and yield, characterized in that: The method for heterologously synthesizing γ-polyglutamic acid in corn is to express the three protein combinations shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 in corn.

2. The use according to claim 1, characterized in that: The method for heterologously synthesizing γ-polyglutamic acid in corn is to express the vector of the sequence shown in SEQ ID NO.7 in corn.

3. The use according to claim 2, characterized in that: The method for heterologously synthesizing γ-polyglutamic acid in corn is to infect corn embryonic callus with Agrobacterium containing the sequence vector shown in SEQ ID NO.7, and obtain corn expressing the sequence vector shown in SEQ ID NO.

7.

4. The use according to any one of claims 1 to 3, characterized in that: The method for improving drought resistance is to increase the contents of ABA, soluble sugar, proline and chlorophyll in corn leaves; the method for improving yield is to increase the number of kernels per ear, kernel weight per ear and 100-kernel weight of corn.

5. The use according to any one of claims 1 to 3, characterized in that: The corn is the KN5585 inbred line.

Images