Pathogen-specific nucleic acid genes and methods of acquisition and detection

By using whole-genome sequencing and CRISPR/Cas12a system to design pathogen-specific nucleic acid fragments, combined with PCR amplification and fluorescence detection, the problems of long detection time and false positives and false negatives in traditional pathogen detection have been solved, enabling rapid and accurate identification of Serratia marcescens.

CN115725608BActive Publication Date: 2025-10-21NANJING UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211392578.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-08
Publication Date
2025-10-21
Estimated Expiration
2042-11-08

AI Technical Summary

Technical Problem

Traditional pathogen detection methods are time-consuming and prone to false negatives and false positives, failing to meet the clinical need for rapid and accurate diagnosis, especially for pathogens such as Serratia marcescens.

Method used

By employing pathogen-specific nucleic acid gene acquisition methods, and through whole-genome sequence analysis and the CRISPR/Cas12a system, pathogen-specific nucleic acid fragments were designed, and combined with PCR amplification and fluorescence detection technologies, rapid identification of Serratia marcescens was achieved.

Benefits of technology

It enables rapid identification of Serratia marcescens with a high positive detection rate and a short detection cycle (less than 3 hours), improving the accuracy and efficiency of clinical diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115725608B_ABST
    Figure CN115725608B_ABST
Patent Text Reader

Abstract

The application discloses a pathogen-specific nucleic acid gene and an acquisition and detection method, acquires a whole genome sequence, establishes a database for the acquired whole genome sequence and carries out multi-sequence alignment analysis, and the obtained overlapping sequence is an intraspecific common sequence of the bacteria; acquires interspecific specific sequences; the intraspecific common sequence of each kind of bacteria is sequentially subjected to three times of BLAST alignment with the intraspecific common sequence of all bacteria, the genome sequence of all bacteria and the genome sequence of human beings, then the sequence without overlapping is taken as the interspecific specific sequence, and the interspecific specific sequence is the pathogen-specific nucleic acid gene; and the repeated sequences in the pathogen-specific nucleic acid gene are covered. The application can be used for rapidly identifying the pathogen, and has high positive detection rate and short detection period when applied in the clinic.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a pathogen-specific nucleic acid gene and an acquisition and detection method thereof, belonging to the technical field of pathogen detection. Background Art

[0002] Identifying pathogens from patient body fluid samples based on colony culture is a traditional pathogen detection method and is currently the gold standard for clinical microbiology testing. This method requires the collection of patient body fluid samples through aseptic operation, and then transferring them to aerobic or anaerobic sterile culture bottles for pathogen enrichment culture, followed by inoculation into flat culture dishes, and finally picking single clones for staining and microscopic observation, differential growth experiments on selective culture media, or various biochemical tests. The pathogens in patient samples are identified based on their phenotypic and physiological characteristics. Traditional culture methods are not only time-consuming (usually 2-5 days are required to obtain pathogenic information), but also because of the harsh growth conditions required by certain anaerobic pathogens, traditional culture methods cannot culture the target pathogens, resulting in false negative test results. In addition, during the bacterial culture and isolation process, contamination may be introduced due to operational problems, resulting in false positive results, which can lead to misdiagnosis and misuse of antimicrobial drugs.

[0003] Among the major pathogenic Enterobacteriaceae, Serratia marcescens is one of the least studied pathogens to date. For a long time, researchers believed that Serratia marcescens was a non-pathogenic or opportunistic pathogen, primarily affecting immunocompromised neonates, children, and the elderly. Currently, Serratia marcescens is known to cause respiratory, urinary, bloodstream, and ocular infections, with the trachea, bronchi, and urinary tract being the most common reservoirs. It is also frequently detected in the digestive tract of children. In immunocompromised individuals, it can also cause various infections, including lung, intracranial, and sepsis. Over the past 20 years, Serratia marcescens has caused a series of outbreaks in neonatal wards and adult ICU patients in developed countries. Italian researchers have found that pneumonia and sepsis are the most serious complications of Serratia marcescens infection in children, with a mortality rate as high as 7%. Blood and sputum are the primary sources of clinical isolation of Serratia marcescens, suggesting that clinicians should pay close attention to the complications of infection with this pathogen. Departments like the ICU and neurology departments urgently need to quickly and accurately obtain pathogen information so they can promptly and appropriately initiate antimicrobial therapy to improve patients' clinical manifestations and increase cure rates. However, current clinical pathogen detection technology—traditional culture methods—is far from meeting the needs of clinical diagnosis and treatment. Summary of the Invention

[0004] Purpose of the invention: In order to overcome the deficiencies in the prior art, the present invention provides a pathogen-specific nucleic acid gene and a method for obtaining and detecting the gene.

[0005] Technical solution: To achieve the above purpose, the technical solution adopted by the present invention is:

[0006] A method for obtaining pathogen-specific nucleic acid genes, comprising the following steps:

[0007] Step 1: Obtain the whole genome sequence: Obtain the whole genome sequence of common microorganisms.

[0008] Step 2: Obtain the intraspecific common sequence of the same bacteria: Establish a database for the obtained whole genome sequences and perform multiple sequence alignment analysis. First, use a sequence with high sequencing quality in the whole genome sequence of a certain bacterium as the target sequence, and perform two-sequence alignment with the whole genome sequences of other strains belonging to the same bacteria to obtain pairwise common sequences. Then, perform multiple sequence alignment comprehensive analysis on the pairwise common sequences. The resulting overlapping sequences are the intraspecific common sequences of this bacteria.

[0009] Step 3, obtain interspecies specific sequences: perform three BLAST comparisons on the common intraspecies sequences of each bacterium obtained, the common intraspecies sequences of all bacteria, the genome sequences of all bacteria, and the genome sequence of humans, and then use the sequences without overlap as interspecies specific sequences. Interspecies specific sequences are pathogen-specific nucleic acid genes.

[0010] Step 4, remove repetitive sequences: cover up the repetitive sequences in the pathogen-specific nucleic acid genes.

[0011] Preferably: including removing repetitive sequences: covering up repetitive sequences in pathogen-specific nucleic acid genes.

[0012] A pathogen-specific gene of Serratia viscida is obtained by a pathogen-specific nucleic acid gene obtaining method. The nucleotide sequences of the pathogen-specific gene of Serratia viscida are shown in SEQ ID NOs: 4-40 in the sequence listing.

[0013] A recombinant expression vector comprises a pathogen-specific gene of Serratia marcescens.

[0014] A transformant comprises a host cell containing a recombinant expression vector.

[0015] The invention discloses an application of a pathogen-specific gene of Serratia marcescens for detecting the pathogen of Serratia marcescens.

[0016] A method for identifying a pathogen-specific gene of Serratia marcescens comprises the following steps:

[0017] S101, obtaining a sample containing the pathogen Serratia marcescens.

[0018] S102: Detecting the presence or level of a Serratia marcescens pathogen-specific gene in the sample. The corresponding nucleotide sequence of the Serratia marcescens pathogen-specific gene is at least a portion of any one of SEQ ID NOs: 4-40, or a complementary sequence thereof. The presence or level of the Serratia marcescens pathogen-specific gene reflects the presence or level of the pathogen corresponding to the Serratia marcescens pathogen-specific gene in the sample. The nucleic acid molecule is no less than 50 nucleotides in length.

[0019] Preferably, the method for detecting the presence or content of the Serratia marcescens pathogen-specific gene in the sample comprises: performing an amplification reaction on the Serratia marcescens pathogen-specific gene, and determining the presence or content of the Serratia marcescens pathogen-specific gene by detecting the presence or amount of the amplification product. The amplification reaction is a PCR amplification reaction.

[0020] Preferably, in the amplification reaction, the primers for amplifying the pathogen-specific gene of Serratia marcescens are the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 in the sequence listing.

[0021] Preferably, the amplification product detection is performed using the trans-cleavage activity of a Crispr / Cas family nuclease, and the target sequence of the crRNA used in combination with the Crispr / Cas family nuclease is as shown in SEQ ID NO: 3 in the sequence listing. The Crispr / Cas family nuclease is Cas12 or the Crispr / Cas family nuclease is LbCas12.

[0022] A kit for detecting pathogens in a sample, comprising

[0023] 1) primers for amplifying pathogen-specific nucleic acid fragments in the sample to generate amplification products; and

[0024] 2) a Crispr / Cas family nuclease with trans-cleavage activity, a crRNA with at least a portion of the sequence of the amplified product as a target sequence, and a single-stranded DNA reporter molecule with a fluorescent group and a quencher group at the 5' and 3' ends, respectively, wherein

[0025] The pathogen-specific nucleic acid fragment corresponding to Serratia marcescens is selected from at least a portion of any sequence in SEQ ID NO: 4-40, or a complementary sequence thereof

[0026] In some embodiments, the kit further comprises the above-mentioned nucleic acid fragment used as a positive standard.

[0027] In some embodiments, the Crispr / Cas family protein is LbCas12.

[0028] In some embodiments, the primers for amplifying the pathogen-specific nucleic acid fragment of Serratia marcescens include the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0029] In some embodiments, the primers for amplifying the pathogen-specific nucleic acid fragment of Serratia marcescens include the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2, and the target sequence of the crRNA includes the sequence shown in SEQ ID NO: 3.

[0030] In some embodiments, the sample is sputum or bronchoalveolar lavage fluid from a patient with severe pneumonia.

[0031] In some embodiments, the kit is used to isolate Serratia marcescens in the sample.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The present invention can be used to quickly identify pathogens, has a high positive detection rate and a short detection cycle (e.g., less than 3 hours) when used clinically. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Flowchart of the method for obtaining pathogen-specific nucleic acid fragments described herein.

[0035] Figure 2 Schematic diagram showing the trans-cleavage activity of Cas12a.

[0036] Figure 3 The figure shows the electrophoresis results of the amplified products after conventional PCR amplification of DNA templates of various common clinical pathogens using primer pairs SEQ ID NO: 1 and SEQ ID NO: 2 targeting Serratia marcescens.

[0037] Figure 4 The fluorescence signal results of detecting different amplification products using LbCas12a and crRNA are shown. DETAILED DESCRIPTION

[0038] The present invention is further illustrated below with reference to the accompanying drawings and specific embodiments. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. After reading the present invention, modifications of various equivalent forms of the present invention made by those skilled in the art all fall within the scope defined by the claims attached to this application.

[0039] "Pathogen-specific nucleic acid fragments," also known as pathogen-specific or pathogen-specific nucleic acid fragments (usually DNA sequences, but can also include RNA sequences), refer to DNA sequences that are commonly found in the genomes of strains belonging to the same taxonomic group of pathogens, but are absent from the genomes of other pathogens. This refers to DNA sequences that are shared within a species but specific to different species. Pathogen-specific DNA sequences can be used to accurately detect and identify bacterial species.

[0040] In some embodiments, the pathogen-specific DNA sequence is obtained by the following steps (see Figure 1 ):

[0041] 1) Obtain whole genome sequences: Obtain whole genome sequences of hundreds of common microorganisms from public databases such as NCBI;

[0042] 2) Obtaining intraspecific common sequences of the same bacterial species: A database is established for the obtained whole-genome sequences and multiple sequence alignment analysis is performed. First, a sequence with high accuracy (high sequencing quality) in the whole-genome sequence of a certain bacteria is used as the target sequence. Pairwise sequence alignment is performed with the whole-genome sequences of other strains of the same bacterial species to obtain pairwise common sequences. Then, a comprehensive multiple sequence alignment analysis is performed on the pairwise common sequences. The resulting overlapping sequences are the intraspecific common sequences of the bacterial species;

[0043] 3) Obtaining interspecies-specific sequences: Perform three BLAST comparisons of the obtained intraspecies common sequence of each bacterial species with the intraspecies common sequence of all bacteria, the genome sequence of all bacteria (excluding self-alignment during comparison), and the human genome (hg19) sequence. Sequences without overlap are then used as interspecies-specific sequences. Interspecies-specific sequences are the unique DNA sequences of pathogens.

[0044] 4) Remove repeated sequences: Use tools such as RepeatMasker to cover up repeated sequences.

[0045] In this way, we obtained multiple specific nucleic acid fragments of various bacteria, among which the nucleotide sequences of Serratia marcescens are shown in SEQ ID NOs: 4-40, respectively.

[0046] After obtaining the sequences of these pathogen-specific nucleic acid fragments, they can be conveniently used to detect various pathogens in patients or patient samples. For example, the presence of a specific pathogen-specific nucleic acid fragment can be used to indicate that the patient or patient sample contains the specific pathogen; the amount of a specific pathogen-specific nucleic acid fragment can be used to indicate the amount of the specific pathogen in the patient or patient sample. The sequences of these pathogen-specific nucleic acid fragments themselves can also be included in some detection kits, for example, as positive controls. It is understood that during the detection process, the full-length specific nucleic acid fragments for Serratia marcescens provided herein (SEQ ID NOs: 4-40) can be detected; or, alternatively, only partial fragments thereof, such as fragments of 50, 60, 80, 100, or more nucleotides in length, can be detected. Similarly, the pathogen-specific nucleic acid fragments included in the kit can also be full-length fragments or partial fragments (e.g., fragments of 50, 60, 80, 100, or more nucleotides in length). In some preferred embodiments, the pathogen-specific nucleic acid fragments are at least 60 nucleotides in length.

[0047] Nucleic acid amplification

[0048] The application of nucleic acid amplification technology has revolutionized the diagnosis of microbial pathogens and is currently a commonly used molecular biology technique in the detection and identification of pathogenic microorganisms. In the 1980s, a variety of DNA amplification technologies emerged, including polymerase chain reaction (PCR), ligase chain reaction (LCR), and isothermal amplification.

[0049] The discovery and application of heat-resistant DNA polymerases has made PCR the most commonly used DNA amplification technique. The principle of PCR for detecting pathogenic microorganisms is to use specific oligonucleotide chains as primers and a target nucleic acid containing the sequence to be amplified as a template. By continuously varying the temperature, exponential amplification of double-stranded DNA is achieved, thereby obtaining a large number of target DNA fragments (i.e., amplified products) for subsequent identification. The advantages of this technology lie in its high sensitivity and ease of operation. It can detect extremely small amounts of pathogens and is crucial for detecting pathogens with long growth cycles, demanding culture conditions, or atypical biochemical reaction characteristics.

[0050] LCR is another in vitro amplification technique developed after the advent of PCR. It utilizes a thermostable DNA ligase and four primers: two adjacent forward primers and two reverse primers that are complementary to each other. A gap typically exists between the two adjacent primers, which serves as a template for DNA ligase ligation. DNA ligase is highly specific and intolerant of base mismatches, making this technique frequently used for SNP detection.

[0051] Isothermal amplification of nucleic acids is a simple technique that can quickly and efficiently accumulate nucleic acid sequences at a constant temperature. Since the early 1990s, a variety of isothermal amplification techniques have been developed as alternatives to PCR. Compared with PCR technology, isothermal amplification technology does not require a complex thermal cycling process (therefore, it can reduce amplification costs) and only achieves the amplification reaction at a specific temperature. Commonly used isothermal amplification techniques in the art include: Nuclear Acid Sequence-Based Amplification (NASBA), Strand Displacement Amplification (SDA), Recombinase Polymerase Amplification (RPA), Helicase-dependent Isothermal DNA Amplification (HDA), Loop-mediated Isothermal Amplification (LAMP), Rolling Circle Amplification (RCA), etc. These isothermal amplification techniques are well known to those skilled in the art and will not be described in detail here.

[0052] In some embodiments herein, the nucleic acid in the sample can be amplified before detecting pathogen-specific nucleic acid fragments to increase the sensitivity of detection.

[0053] CRISPR / Cas gene editing system and trans-cleavage activity of Cas12a

[0054] The CRISPR / Cas system has the potential to target nucleic acid molecules, and gene-editing tools based on this system have been increasingly developed and utilized. Currently, gene-editing tools based on the CRISPR / Cas9 and CRISPR / Cas12a systems are the most widely used. Their working principles are briefly described as follows: First, leveraging the targeting function of RNA molecules, the Cas protein directs the cleavage of the double-stranded DNA of the target gene, disrupting the integrity of the DNA strand. Subsequently, the corresponding DNA repair systems within the cell are activated, primarily including NHEJ and HDR repair mechanisms, completing the destruction or targeted modification of the target gene.

[0055] Compared to previous gene editing tools, CRISPR / Cas-based gene editing technology has considerable advantages: its composition is simple, consisting of only a Cas protein and sgRNA (for Cas12a, only crRNA is required). Therefore, editing different sites only requires replacing different sgRNAs (or only replacing the sequence of the seed region that binds to the target nucleic acid). By designing multiple pairs of sgRNAs, multiple gene sites can be edited simultaneously, making it possible to study the function of multi-copy genes.

[0056] In the past two years, studies have found that Cas12a not only has cis-cutting activity for targeted DNA cleavage, but also has trans-cutting activity for non-specific cleavage of any single-stranded DNA (see Figure 2 ). After the Cas12a-crRNA complex binds to the target DNA of the reverse complementary pairing of crRNA, the trans-cleavage activity of Cas12a is stimulated, resulting in the indiscriminate cutting of any single-stranded DNA molecule near Cas12a (i.e., no sequence specificity). Therefore, when a single-stranded reporter DNA molecule is present, the trans-cleavage activity of Cas12a can be used to detect the target DNA molecule. The detection process, for example, includes: first, exponentially amplifying the target DNA in the sample to be tested using techniques such as PCR or RPA to improve the sensitivity of detection; then, the amplified product is detected using Cas12a, crRNA, and single-stranded reporter DNA. If a DNA sequence corresponding to the seed region of crRNA is present in the amplified product (a PAM sequence, such as TTTA, is also present in the 5' upstream), the trans-cleavage activity of Cas12a is stimulated to cut the reporter DNA, and a fluorescent signal is generated.

[0057] In some embodiments, the crRNA used in conjunction with Cas12 crRNA consists of a 21nt backbone region and a 20-24nt seed region (seed region / spacer) for recognizing the target sequence. In a more specific embodiment, the sequence of the crRNA synthesized by in vitro transcription is: 5'-AAUUUCUACUAAGUGUAGAUCAGGUAAGGCGCCUCGGGUG-3' (SEQ ID NO: 41). In some embodiments, the corresponding crRNA can be obtained by in vitro transcription using T7 RNA polymerase using DNA as a template, and pure crRNA can be obtained by purification.

[0058] One end of the single-stranded reporter DNA molecule is modified with a fluorescent group and one end is modified with a quencher group. Due to the presence of the quencher group, the complete single-stranded reporter DNA molecule does not produce a fluorescent signal. When the trans-cleavage activity of Cas12a is stimulated, the single-stranded reporter DNA molecule is cut, so that the quencher group is separated from the fluorescent group to produce a fluorescent signal. The presence or intensity of the fluorescent signal indicates the presence or amount of the amplified product or the amplified product.

[0059] In this study, we first used bioinformatics methods to obtain species-specific DNA sequences for Serratia marcescens, and based on these sequences, designed and synthesized specific crRNA for targeting and identifying the pathogen. Next, we used Escherichia coli prokaryotes to express and purify the LbCas12a protein from Lachnospiraceae bacterium, and verified that the protein has cis- and trans-cleavage activity. Subsequently, using single-stranded reporter DNA, LbCas12a protein and specific crRNA, assisted by PCR amplification technology, we developed a CRISPR / Cas12a-based pathogen detection method and verified its accuracy and specificity. Ultimately, the CRISPR / Cas12a-based pathogen detection tool achieved rapid detection of clinical samples from patients with severe pneumonia within 3 hours. The CRISPR / Cas12a-based pathogen detection method provided in this article is expected to become a new rapid clinical pathogen detection method, providing important technical support for improving the diagnosis and treatment of severe pneumonia.

[0060] In some embodiments herein, the trans-cleavage activity of Cas12a is used to detect pathogen-specific nucleic acid fragments or their amplified products. Since crRNA is required to complementarily pair with the target DNA, this detection method further increases the specificity of the detection.

[0061] The present invention is further illustrated below by means of specific examples.

[0062] Example 1 Specificity Verification of CRISPR / Cas-Based Pathogen Detection Method

[0063] The pathogens used for testing all came from the Intensive Care Unit of Gulou Hospital. They were isolated and cultured from clinical samples of patients with severe pneumonia, and the strain types were determined by the Microbiology Laboratory of Gulou Hospital (each pathogen has two groups, each coming from a different patient).

[0064] 1. Specificity test

[0065] To demonstrate the specificity and reliability of the pathogen detection method based on the CRISPR / Cas system, we conducted cross-detection experiments on the amplification primers and the corresponding crRNA.

[0066] 1.1 Primer specificity test

[0067] In order to clarify the specificity of the amplification primers, cross-PCR reactions were performed using the amplification primers for Serratia marcescens and genomic DNA extracted from Serratia marcescens and 11 other common clinical pathogens as templates.

[0068] The forward and reverse primers used in the amplification are:

[0069] SEQ ID NOs: 1 and 2, used for amplification of genomic DNA of Serratia marcescens;

[0070] The target sequence (or seed region) of the crRNA used in conjunction with the above primer pair is shown in SEQ ID NO: 3.

[0071] An example of designing amplification primers and crRNA sequences using a pathogen-specific nucleic acid fragment of Serratia marcescens is shown below, where the sequences corresponding to the upstream and downstream primers (SEQ ID NOs: 1 and 2) are underlined, the target sequence of the crRNA (SEQ ID NO: 3) is underlined, and the PAM sequence is boxed.

[0072]

[0073] Using I-5 TM PCR using Master Mix (TsingKe)

[0074] TIANSeq HiFi Amplification Mix PCR reaction system:

[0075]

[0076] PCR reaction conditions:

[0077]

[0078] Corresponding positive and negative controls were set for PCR amplification, using the genomic DNA of the target pathogen and water as the amplification templates respectively.

[0079] After the PCR reaction is completed, add the appropriate volume of 6× Gel Loading Dye (NEB), mix well, and then detect by agarose electrophoresis. The specificity of the primers can be determined by the presence of a clear bright band of the target DNA size on the gel image.

[0080] 1.2 crRNA specificity test

[0081] LbCas12a and the crRNA designed for pathogen-specific DNA sequences were used to detect the PCR products amplified by the corresponding primers, and 3 replicates were set for each sample.

[0082] Reaction system:

[0083]

[0084]

[0085] The structure and sequence of the ssDNA-reporter are: 5'-FAM-TTATT-BHQ1-3'.

[0086] The reaction solution was added to a 384-well plate and incubated at 37°C for 30–45 min. After the reaction, the fluorescence value of each well was measured using an enzyme reader (Infinite M200 Pro Multi-function Microplate Reader, Austria Tecan) with the following parameters:

[0087]

[0088] 2. Experimental Results

[0089] 2.1 Primer specificity test results

[0090] like Figure 3 As shown, only a small amount of non-specific miscellaneous bands were present in individual non-target pathogens. However, a large amount of target DNA products could be amplified when the corresponding pathogen genomic DNA was used as a template, indicating that the primers for amplifying Serratia viscidosa had good specificity.

[0091] 2.2 crRNA specificity test results

[0092] The PCR reaction solution after amplification of the above corresponding primers was detected using LbCas12a and crRNA for Serratia viscidosa. Figure 4 The fluorescence results showed that the detection system of the pathogen Serratia marcescens only produced obvious fluorescence signals when the genomic DNA of the pathogen Serratia marcescens was used as a template for PCR amplification of the amplified product, while the fluorescence signal intensity of the other non-target pathogens was consistent with that of the negative control, indicating that the combination with crRNA makes this detection method extremely specific.

[0093] Example 2: Detecting clinical samples from patients with severe pneumonia using the CRISPR / Cas system

[0094] 1. Experimental Operation

[0095] Twelve clinical samples (sputum or bronchoalveolar lavage fluid) were collected from the Intensive Care Unit of Gulou Hospital and compared with the pathogen types identified by the Department of Microbiology of Gulou Hospital using traditional culture and isolation methods.

[0096] 1.1 Kit method for extracting DNA from clinical samples

[0097] Extraction of DNA from clinical samples refers to Quick-DNA / RNA TM The procedure was performed according to the product manual of Pathogen Miniprep Kit (ZYMORESEARCH). The operation steps are briefly described as follows: (The centrifugation speed was 16,000 × g)

[0098] a) Pipette 50-200 μL of sample, add 800 μL of DNA / RNA Shield reagent, and vortex for 60 seconds.

[0099] b) Centrifuge at 16,000 × g for 1 min and remove 200 μL of the supernatant.

[0100] c) Add 2 μl of Proteinase K reagent to 200 μl of supernatant and mix well.

[0101] d) Add 1 ml of Pathogen DNA / RNA buffer, mix well, and let stand at room temperature for 5 minutes.

[0102] e) Transfer the above solution to a DNA binding column (already placed in a recovery tube), centrifuge for 30 seconds, and discard the column solution.

[0103] f) Add 500 μl of Pathogen DNA / RNA Wash buffer to the column, centrifuge for 30 seconds, and discard the column buffer. Repeat this step once.

[0104] g) Add 500 μl of ethanol (95-100%) to the column and centrifuge at 16,000 × g for 1 min to ensure that the ethanol is completely removed. Discard the recovery tube and place the DNA binding column in a DNase-free 1.5 ml centrifuge tube.

[0105] h) Pipette 50 μl of double-distilled water at 65°C into the column matrix, let it rest for 2-5 minutes, centrifuge at 16,000 × g for 1 minute, and collect the eluate.

[0106] i) Measure the DNA concentration and store in a -20°C freezer.

[0107] 1.2 PCR reaction to amplify target sequence

[0108] PCR amplification was performed using the extracted total DNA from clinical samples as templates using a pair of primers described in Example 1. The template used in the positive control group was genomic DNA of Serratia marcescens, and the template used in the negative control group was water.

[0109] The PCR reaction system and reaction conditions were the same as in Example 1.

[0110] 1.3 Cas12a detection

[0111] Unpurified PCR reaction stock solution was detected using LbCas12a, crRNA, and ssDNA-reporter. For each sample to be tested, three replicates were set up.

[0112] The detection reaction system and reaction conditions are the same as those in Example 1.

[0113] 2. Experimental Results

[0114] Total DNA from 12 clinical samples of severe pneumonia patients was amplified by PCR using a pair of amplification primers. The corresponding PCR reaction solutions were then detected using single-stranded reporter DNA, LbCas12a, and specific crRNA of Serratia marcescens. The detection results based on fluorescence signal determination are shown in Table 1 and compared with traditional culture methods.

[0115] Table 1 Comparison of the detection results of Serratia marcescens in 12 bronchoalveolar lavage fluid clinical samples

[0116]

[0117] As shown in the table, CRISPR / Cas12a detection detected Serratia marcescens in clinical samples 1, 5, 8, and 10, while the remaining samples were negative. Clinical culture results revealed the presence of Serratia marcescens in samples 1, 5, and 8. Five of the 12 samples were submitted for next-generation sequencing (NGS). Serratia marcescens was detected in clinical samples 5, 8, and 10, while samples 2 and 4 were negative. Notably, NGS revealed a small amount of Serratia marcescens in sample 10, which was not detected by clinical culture. However, our developed PCR-CRISPR / Cas12a combined detection technique tested positive.

[0118] In summary, compared to traditional detection methods that rely on pathogen isolation and culture, the CRISPR / Cas12a-based pathogen detection tool developed in this study demonstrated excellent detection results, especially for samples with low bacterial loads, such as sample 10, and shortened the traditional detection cycle from several days to less than 4 hours. This preliminarily confirms that this detection method can be used as a potential detection tool for rapid diagnosis of the presence of Serratia marcescens in clinical samples. In addition to Serratia marcescens, based on the specific nucleic acid fragments of numerous pathogens provided in this article, similar methods can be used to identify pathogenic microorganisms of various other infectious diseases.

[0119] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A reagent for detecting a pathogen-specific gene of Serratia marcescens, characterized in that: The reagent includes an upstream primer, a downstream primer and crRNA, wherein: the upstream primer is: GGTTTCGACAAACGGCAAGG; the downstream primer is: GCACACTGATCCGGGGAAA; the target sequence of crRNA is: CACCCGAGGCTCCTTACCTG.

2. Use of a reagent for detecting a pathogen-specific gene of Serratia marcescens as claimed in claim 1 in preparing a detection kit, characterized in that: The following steps are involved: S101, obtaining a sample with the pathogen Serratia marcescens; S102, detecting whether the pathogen-specific gene of Serratia marcescens is present in the sample or detecting the content of the pathogen-specific gene of Serratia marcescens in the sample.

3. The application according to claim 2, characterized in that: The method for detecting whether the pathogen-specific gene of Serratia viscidosa exists in the sample or detecting the content of the pathogen-specific gene of Serratia viscidosa in the sample is: performing an amplification reaction on the pathogen-specific gene of Serratia viscidosa, and determining the presence or content of the pathogen-specific gene of Serratia viscidosa by detecting the presence or quantity of the amplification product.

4. The application according to claim 3, characterized in that: In the amplification reaction, the primers for amplifying the pathogen-specific gene of Serratia marcescens are as shown in SEQ ID NO: 1 and SEQ ID NO: 2 in the sequence listing.

5. The application according to claim 4, characterized in that: The amplification product detection is performed using the trans-cleavage activity of the Crispr / Cas family nuclease, and the target sequence of the crRNA used in combination with the Crispr / Cas family nuclease is as shown in SEQ ID NO: 3 in the sequence listing.

6. A kit for detecting the pathogen Serratia marcescens in a sample, characterized in that The invention comprises the reagent for detecting the pathogen-specific gene of Serratia marcescens according to claim 1.

Citation Information

Patent Citations

  • Detection primer and fluorescence quantitative PCR (polymerase chain reaction) detection method of serratia marcescens

    CN107523622A

  • Pathogen specific nucleic acid fragment and application thereof

    WO2022057854A1