Method for establishing OXT gene-edited model dog

Abstract

The present invention relates to a method for establishing an OXT gene-edited model dog, and specifically to a method for preparing an OXT gene-knockout disease OXT gene-edited model dog using gene editing technology, as well as the obtained OXT gene-knockout OXT gene-edited model dog and its cells, tissues and organs, making it feasible to use dogs as an animal model for studying social behavior mechanisms.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and specifically relates to a method for establishing an OXT gene-edited model dog, and in particular to a method for preparing an OXT gene-knockout model dog by using gene editing technology. Background Art

[0002] Social cognition is the basis for a series of social interactions (such as mate selection, partner preference, and mother-child intimacy). The role of the neuropeptide oxytocin (OXT) in social behavior is one of the earliest and most important discoveries in the field of social neuroscience. A large number of studies have found that oxytocin plays an important role in social cognition and emotional behaviors such as human trust, empathy, emotion recognition, autistic traits, and social information processing. OXT deficiency leads to weakened social memory and communication behavior, overeating, and is an important cause of obesity. Related studies have applied oxytocin to the treatment of schizophrenia, anxiety, depression, and post-traumatic stress disorder. Oxytocin is an important regulator of social cognitive processes, and further research is needed to analyze the regulatory mechanism of oxytocin on social perception, cognition, and interpersonal behavior.

[0003] The oxytocin system may have played an important role in the domestication of dogs from wolves. Dogs have evolved unique human-mimicking social skills that enable them to communicate and cooperate effectively with humans. The human-like communication style of dogs, including mutual gaze, may have been acquired during domestication. Genomic differences in the region surrounding the oxytocin receptor (OXTR) gene have previously been associated with differences in communication skills in dogs. Intranasal oxytocin treatment, OXTR polymorphisms, and their interactions are associated with cross-species social cognition in dogs and humans. Comparative studies of brain function between dogs and humans have important scientific value in revealing the mechanisms of human social emotional communication.

[0004] The rodent models currently widely used in the study of social behavior mechanisms have evolved apart from humans as early as 100 million years ago, and there are huge differences between rodents and humans in brain structure and function. The results of the previous mouse model phenotypic analysis showed that the social memory ability of mice was defective after the OXT gene was deleted, but the spatial memory and behavioral inhibition ability were intact. Non-human primates are ideal modeling animals for the study of social behavior mechanisms, but this model also has certain limitations, such as high difficulty in development technology and slow reproduction. At the same time, the significant individual differences of non-human primates, animal ethics and animal protection issues restrict the widespread application of this type of model, and there is currently no non-human primate model available for the study of this gene. Therefore, it is necessary to develop new animal models for the study of social behavior mechanisms and drug development. Summary of the invention

[0005] The present invention provides a method for establishing an OXT gene-edited model dog with OXT (neuropeptide oxytocin) gene knockout by gene editing technology. The present invention also relates to the established OXT gene knockout OXT gene-edited model dog and its cells and tissues.

[0006] In a first aspect, the present invention provides a method for establishing an OXT gene-edited model dog, the method comprising obtaining an OXT gene-knockout canine fertilized egg or canine somatic cell using gene editing technology.

[0007] In some embodiments, the gene editing technology is selected from BE3 single-base editing technology, CRISPR, TALEN and ZFN, preferably CRISPR / Cas9.

[0008] In some embodiments, the method comprises the steps of:

[0009] (1) Determine the target site based on the sequences of exon 1 and exon 2 of the canine OXT gene;

[0010] (2) synthesizing the sgRNA sequence according to the targeting site determined in step (1), and then connecting the synthesized sequence to the backbone vector to construct an sgRNA targeting vector;

[0011] (3) Obtaining in vitro transcription products of sgRNA and CRISPR / Cas9 respectively through in vitro transcription;

[0012] (4) Introducing the sgRNA obtained in step (3) and the in vitro transcription product of CRISPR / Cas9 into canine fertilized eggs or canine somatic cells to obtain canine fertilized eggs or canine somatic cells with OXT gene knockout.

[0013] In some embodiments, three targeting sites are determined based on exon 3 of the OXT gene sequence.

[0014] Preferably, the sgRNA and its complementary sequence include the following sequence:

[0015] S1 site: ACCCGCTGTGACCAGCCATGCGG (SEQ ID NO: 2), complementary sequence: CCGCATGGCTGGTCACAGCGGGT (SEQ ID NO: 3);

[0016] S2 site: GCAGTTCTGGATGTAGCAGGCGG (SEQ ID NO: 4), complementary sequence: CCGCCTGCTACATCCAGAACTGC (SEQ ID NO: 5);

[0017] S3 site: TTCGGGCCCAGCATCTGCTGCGG (SEQ ID NO: 6), and the complementary sequence is: CCGCAGCAGATGCTGGGCCCGAA (SEQ ID NO: 7).

[0018] In some embodiments, the canine somatic cells are from the following tissues or organs: fetal tissue, skin, muscle, ear, mammary gland, fallopian tube, ovary, blood, urine, fat, bone marrow, blood vessels and luminal endothelium.

[0019] In some embodiments, the canine somatic cell is selected from the group consisting of fetal fibroblasts, skin cells, epithelial cells, ear cells, fibroblasts, endothelial cells, muscle cells, mammary cells, fallopian tube cells, ovarian cells, cumulus cells, neural cells, and osteoblasts.

[0020] In some embodiments, the method further comprises transplanting the obtained OXT gene knockout canine fertilized egg into the fallopian tube of a recipient female dog, thereby preparing an OXT gene-edited model dog.

[0021] In some embodiments, the method further comprises transplanting the nucleus of the obtained OXT gene knockout canine somatic cell into a canine enucleated oocyte, and then transplanting the canine enucleated oocyte after nuclear transplantation into the fallopian tube of a recipient female dog, thereby preparing an OXT gene-edited model dog.

[0022] In some embodiments, the present invention utilizes gene editing technology to select a targeting site sequence according to the exons of the canine OXT gene sequence, and constructs an sgRNA targeting vector and a CRISPR / Cas9 expression vector according to the targeting site sequence. After the vector is verified to be effective, it is transcribed into mRNA in vitro, and then the mRNA is injected into a canine fertilized egg by cytoplasmic injection. The canine fertilized egg is then transplanted into one oviduct of a female dog whose bilateral oviducts have been flushed with embryos, thereby preparing an OXT gene knockout OXT gene editing model dog.

[0023] In a second aspect, the present invention provides canine somatic cells, tissues or organs of an OXT gene-edited model dog obtained by the method of the first aspect.

[0024] In some embodiments, the canine somatic cell, tissue or organ comprises at least one of the sequences shown in SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15 and SEQ ID NO:17.

[0025] In a third aspect, the present invention provides a targeting vector for canine OXT gene knockout, wherein the targeting vector is composed of an sgRNA sequence designed for the targeting site sequence in exon 1 and exon 2 of the canine OXT gene and a backbone vector.

[0026] In some embodiments, the sgRNA and its complementary sequence include the following sequence:

[0027] S1 site: ACCCGCTGTGACCAGCCATGCGG (SEQ ID NO: 2), complementary sequence: CCGCATGGCTGGTCACAGCGGGT (SEQ ID NO: 3);

[0028] S2 site: GCAGTTCTGGATGTAGCAGGCGG (SEQ ID NO: 4), complementary sequence: CCGCCTGCTACATCCAGAACTGC (SEQ ID NO: 5);

[0029] S3 site: TTCGGGCCCAGCATCTGCTGCGG (SEQ ID NO: 6), and the complementary sequence is: CCGCAGCAGATGCTGGGCCCGAA (SEQ ID NO: 7).

[0030] In a fourth aspect, the present invention provides a primer pair, the sequence of the primer pair is as follows:

[0031] Forward primer: GTAACCCTTCCCCCAGATGC (SEQ ID NO: 8); and

[0032] Reverse primer: CTCCCTCCCATTTCCGACAC (SEQ ID NO: 9).

[0033] In a fifth aspect, the present invention provides a kit comprising a primer pair, the sequence of which is as follows:

[0034] Forward primer: GTAACCCTTCCCCCAGATGC (SEQ ID NO: 8); and

[0035] Reverse primer: CTCCCTCCCATTTCCGACAC (SEQ ID NO: 9).

[0036] In the sixth aspect, the present invention provides the use of the primer pair described in the fourth aspect or the kit described in the fifth aspect in detecting an OXT gene-edited model dog having a genomic sequence comprising at least one sequence fragment of the sequences shown in SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15 and SEQ ID NO:17.

[0037] The role of the neuropeptide oxytocin (OXT) in social behavior is one of the earliest and most important discoveries in the field of social neuroscience. A large number of studies have found that oxytocin plays an important role in social cognition and emotional behaviors such as human trust, empathy, emotion recognition, autistic traits, and social information processing. Related studies have applied oxytocin to the treatment of schizophrenia, anxiety, depression, and post-traumatic stress disorder. The oxytocin system may play an important role in the domestication of dogs from wolves. Dogs have evolved unique human-simulating social skills that enable them to communicate and cooperate effectively with humans. Dogs' human-like communication methods, including mutual gaze, may have been acquired during the domestication process. Comparative studies of dog and human brain function have important scientific value in revealing the mechanism of human social emotional communication.

[0038] The present invention obtains canine OXT gene knockout model dogs by using CRISPR / Cas9, realizes effective editing of OXT gene in the genome, and enriches the biological sample library of canine disease models. In addition, in terms of social behavior mechanism research, gene-edited dog models can more accurately simulate human diseases than rat models. The development of OXT gene-edited dogs will provide a reliable large animal model for studying the mechanism of action of OXT gene products, and the pathogenesis and early intervention of social behavior mechanism research. The establishment of OXT gene-edited dogs not only enriches the biological sample library of disease animal models, but also provides the possibility for the development of related social behavior mechanism research canine models. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 A schematic diagram of the canine OXT gene targeting site sequence according to the present application is shown.

[0040] Figure 2 The PCR identification results of the newborn puppies numbered 220201 to 220220 in Example 1 of the present application are shown.

[0041] Figure 3 The sequencing results of the OXT gene of the OXT gene-edited dog numbered 220205 in Example 1 of the present application are shown.

[0042] Figure 4The OXT gene sequencing results of the OXT gene-edited dog numbered 220206 and the wild-type dog cells according to Example 1 of the present application are shown.

[0043] Figure 5 The OXT gene sequencing results of the OXT gene-edited dog numbered 220208 and the wild-type dog cells according to Example 1 of the present application are shown.

[0044] Figure 6 The OXT gene sequencing results of the OXT gene-edited dog numbered 220216 and the wild-type dog cells in Example 1 of the present application are shown.

[0045] Figure 7 The OXT gene sequencing results of the OXT gene-edited dog numbered 220217 and the wild-type dog cells according to Example 1 of the present application are shown.

[0046] Figure 8 The results of the reunion phase of the mother-infant separation experiment of the OXT gene-edited dogs and wild-type dogs of the present application are shown.

[0047] Fig. 9 The results of the separation phase of the mother-fetus separation experiment between the OXT gene-edited dogs and wild-type dogs of the present application are shown. DETAILED DESCRIPTION

[0048] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments and drawings. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation to the present invention. In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0049] Example:

[0050] 1. Construction and identification of targeting vector

[0051] The canine OXT gene was searched in Genbank, and the target site was designed based on exon 1 and exon 2. The sequence of the target site was the sequence shown in SEQ ID NO: 1:

[0052]

[0053] Three sgRNAs were designed for this target site (see Figure 1 ), specifically:

[0054] S1 site: ACCCGCTGTGACCAGCCATGCGG (SEQ ID NO: 2), complementary sequence: CCGCATGGCTGGTCACAGCGGGT (SEQ ID NO: 3)

[0055] S2 site: GCAGTTCTGGATGTAGCAGGCGG (SEQ ID NO: 4), complementary sequence: CCGCCTGCTACATCCAGAACTGC (SEQ ID NO: 5)

[0056] S3 site: TTCGGGCCCAGCATCTGCTGCGG (SEQ ID NO: 6), and the complementary sequence is: CCGCAGCAGATGCTGGGCCCGAA (SEQ ID NO: 7).

[0057] The vector plasmid px330 was digested to linearize, 1% agarose gel electrophoresis was performed, and the gel was cut and recovered to determine the concentration. According to the system with a molar ratio of 1:3 between the linearized vector and the OXT gene targeting sgRNA, T4 DNA ligase was used to connect overnight at 16°C. The ligation product was transformed into an ampicillin-resistant LB plate for screening, colony PCR was used to identify positive clones, and the shake bacteria were inoculated and the plasmid was extracted using a plasmid extraction kit. 10 μL of the recombinant plasmid was taken and handed over to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. Snapgene analysis was then used to compare the sequencing results, and the plasmid with the correct sequencing comparison was saved for later use.

[0058] 2. Cytoplasmic injection of canine fertilized eggs and embryo transplantation

[0059] First, the CRISPR / Cas9 plasmid was linearized. The reaction system was: 30 μg plasmid, 5 μL restriction endonuclease AflII; 10 μL 10× Buffer and ddH 2 O, the total volume is 100μL. Then add 100μL phenol: chloroform: isoamyl alcohol (25:24:1) to purify the linearized plasmid DNA, centrifuge at 12000g for 5min; pipette 50μl supernatant into a 1.5ml centrifuge tube without RNase, add 1 / 10 volume of sodium acetate and 3 times volume of anhydrous ethanol to precipitate the plasmid DNA, centrifuge at 12000g for 5min; discard the supernatant, try to discard the remaining supernatant, add 150μL 70% ethanol to wash the plasmid, centrifuge at 12000g for 5min; dry in air for 3-5min, wash with 15μL RNase-free ddH 2 Dissolve the DNA in 4% O and determine the concentration.

[0060] In vitro transcription kit method (thermofisher mMESSAGE T7 Ultra Kit):

[0061] The in vitro transcription system was: 1 μg linearized plasmid DNA, 10 μL 2×NTP / CAP, 2 μL 10×Buffer, 2 μL RNA synthase and ddH 2 O, total volume 20μL. After mixing, incubate at 37℃ for 1hr; add 1μL TURBO DNase to digest the plasmid template and incubate at 37℃ for 30min. Then add 20μL in vitro transcription product, 20μL 10× Reaction Buffer, 10μL ATP (10mM), 2.5μL RNase inhibitor, 2μL Poly(A) polymerase and nuclease-free ddH 2 O to prepare a total volume of 100μL in vitro transcribed mRNA plus polyA system, and incubate at 37℃ for 1hr. After incubation, add 350μL binding buffer to the reaction system and mix by pipetting; then add 250μL anhydrous ethanol and mix evenly; then transfer the sample to the mRNA purification column and centrifuge at 10000g for 1min at room temperature; discard the filtrate, reinstall the column, rinse the column with 500μL elution solution, and centrifuge at 10000g for 1min at room temperature; repeat the rinse once, discard the filtrate, and centrifuge the empty column for 1min to elute impurities such as proteins; then put the column into a new centrifuge tube, add 50μL RNA elution solution to the center of the column, cover the lid and incubate at 65℃ for 10min, and centrifuge at 10000g for 1min at room temperature; detect RNA quality and concentration.

[0062] The CRISPR sgRNA in vitro transcription product and Cas9 mRNA were mixed to a final concentration of 50 ng / μL for sgRNA and 200 ng / μL for Cas9, and stored at -80°C for cytoplasmic injection.

[0063] The in vitro transcription products of Cas9 mRNA and three sgRNAs were mixed in a ratio of 4:1 and injected into the fertilized eggs of dogs. A total of 10 embryo transfers were performed, with 63 embryos transferred to 10 recipients and 28 puppies born (see Table 1 for details).

[0064] The specific operation includes: a total of 10 naturally estrus beagle female dogs were used as fertilized egg donors and embryo transplant recipients for experiments. Blood was collected from all female dogs to test the progesterone concentration in the serum. When the progesterone concentration reached 4-7ng / mL, it could be determined as the ovulation period. Natural mating was performed 48h after ovulation, and then the fertilized embryos were flushed out. A total of 63 fertilized eggs were obtained from 10 female dogs. After collecting the fertilized eggs, the cumulus granulosa cells were removed using TCM199 medium containing 0.1% hyaluronidase, and then placed in a microdrop of HEPES-buffered TCM199 medium (HM, GIBCO11150), and then placed on an inverted microscope equipped with a micromanipulator. A mixture of the sgRNA RNA and Cas9 mRNA prepared above at a volume ratio of 4:1 was drawn with a microinjection needle and then injected into the cytoplasm of the fertilized egg. The oviduct was flushed with 10 mL of HEPES-buffered TCM199 medium (HM, GIBCO11150) containing 10% fetal bovine serum. The oviduct flushing fluid flowed out from the injection needle at the fimbria of the oviduct and was collected in a 10 mL centrifuge tube. After the cytoplasmic injection was completed, the embryos were placed in an embryo transfer tube, and the embryos in the embryo transfer tube were injected from the fimbria into the oviduct on the side with less bleeding during the embryo flushing. A total of 28 puppies were finally born.

[0065] After the puppies were born, ear and tail tissues of newborn puppies were collected for identification. After the tissue blocks were cut into pieces in a centrifuge tube, proteinase K was added to the solution and lysed in a water bath at 56°C for 1-3 hours. Then 700μL of Genomic Lysis Buffer was pipetted with a pipette, added to the lysis system, mixed evenly by inversion, and centrifuged at 10,000g for 1 minute. The supernatant was pipetted to the purification column with a pipette, and centrifuged at 10,000g for 1 minute at room temperature and 1 minute. A new collection tube was replaced, 200μL of DNA Pre-WashBuffer was added to the centrifuge column, and the solution was centrifuged at 10,000g for 1 minute at room temperature and 1 minute, and the waste liquid was discarded. 400μL of g-DNA WashBuffer was added to the centrifuge column, and the solution was centrifuged at 10,000g for 1 minute at room temperature and 1 minute, and the waste liquid was discarded. The purification column and collection tube were centrifuged again at 10,000g for 2 minutes. Replace the purification column into a new 1.5 mL centrifuge tube, add 50 μL of Elution Buffer to elute the DNA, and place at room temperature for 2 minutes. Centrifuge at 12000 rpm for 1 minute to obtain the canine genomic DNA solution.

[0066] Canine genomic DNA was used as a template for PCR and PCR product sequencing. The sequences of the PCR identification primer pairs are as follows:

[0067] PCR Primers:

[0068] OXT-DOG-U1 (forward primer): GTAACCCTTCCCCCAGATGC (SEQ ID NO: 8)

[0069] OXT-DOG-D1 (reverse primer): CTCCCTCCCATTTCCGACAC (SEQ ID NO: 9)

[0070] PCR reaction system (25 μL system):

[0071]

[0072] PCR reaction conditions:

[0073] 95℃3min; (95℃15s, 58℃15s, 72℃1min10s) 30 cycles; 72℃3min; store at 4℃.

[0074] Table 1 Cytoplasmic injection and embryo transfer records

[0075]

[0076] Figure 2 The PCR results of newborn puppies are shown. Figure 2 The stripes in the middle rubber map represent numbers 220201(1T), 220202(2T), 220203(3T), 220204(4T), 220205(5T), 220206(6T), 220207(7T), 220208(8T), 220209(9T), 220210(10T), 220211(11T), 220212(12T), 2 For the puppies 20213 (13T), 220214 (14T), 220215 (15T), 220216 (16T), 220217 (17T), 220218 (18T), 220219 (19T), and 220220 (20T), the amplification results showed that the amplification product band of each sample was single, and the theoretical fragment size was 1043 bp. The PCR products were sequenced and the results of gene editing were analyzed.

[0077] According to sequencing and sequence information comparison, 5 of the 28 puppies had mutations at the exon 1 and exon 2 target sites of the OXT gene. Among them, puppies numbered 220205, 220206, 220208, 220216, and 220217 all had OXT gene editing. Figure 3-Figure 7 The OXT gene sequencing results of puppies numbered 220205, 220206, 220208, 220216, and 220217 are shown respectively. The specific mutation information is as follows:

[0078] (1) The genotype of the OXT gene of individual No. 220205 is 25 bp deletion and -4 bp deletion. The mutated nucleic acid sequence contains the sequence shown in SEQ ID NO: 10, and the mutated amino acid sequence contains the sequence shown in SEQ ID NO: 11.

[0079] (2) The genotype of the OXT gene of individual No. 220206 is 490 bp deletion + 7 bp insertion and 31 bp deletion. The mutated nucleic acid sequence contains the sequence shown in SEQ ID NO: 12. The mutated nucleic acid sequence has no ATG start codon and does not express an amino acid sequence.

[0080] (3) The genotype of the OXT gene of individual No. 220208 is 48 bp deletion and 4 bp deletion, the mutated nucleic acid sequence is the sequence shown in SEQ ID NO: 13, and the mutated amino acid sequence contains the sequence shown in SEQ ID NO: 14.

[0081] (4) The genotype of the OXT gene of individual No. 220216 is 16bp deletion and 14bp deletion + 2bp insertion. The mutated nucleic acid sequence contains the sequence shown in SEQ ID NO: 15, and the mutated amino acid sequence contains the sequence shown in SEQ ID NO: 16.

[0082] (5) The genotype of the OXT gene of individual No. 220217 is 11 bp deletion and 4 bp deletion. The mutated nucleic acid sequence contains the sequence shown in (SEQ ID NO: 17), and the mutated amino acid sequence contains the sequence shown in SEQ ID NO: 18.

[0083] The nucleic acid sequence of the wild-type OXT gene contains the sequence shown in SEQ ID NO:19, and the amino acid sequence of the wild-type OXT gene contains the sequence shown in SEQ ID NO:20.

[0084] 3. Behavioral verification of OXT gene-edited dogs

[0085] The five OXT gene-edited dogs obtained above were subjected to a mother-infant separation experiment at the puppy stage. Mother-infant separation experiment: The lactating mother dog was removed from the breeding cage and returned to the breeding cage 30 minutes later. The camera on the ceiling of the breeding cage recorded the behavior of the puppies in the breeding cage after they were separated from their mothers and reunited. The behavior of the puppies in the 3-minute video after separation and reunion was classified and evaluated. The results showed that during the reunion stage, the OXT gene-edited dogs had less social contact with their mothers and their tails wagged less than their littermates (see Figure 8 ); During the separation phase, OXT gene-edited dogs were more active and wagged their tails than littermates (see Fig. 9), which further verified that the present invention obtained OXT gene-edited dogs.

[0086] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A method for establishing an OXT gene-edited model dog, the method comprising the following steps: (1) Determine the target site based on the sequences of exon 1 and exon 2 of the canine OXT gene; (2) Synthesizing the sgRNA sequence according to the targeting site determined in step (1), and connecting the synthesized sgRNA sequence to the backbone vector to construct an sgRNA targeting vector; (3) Obtaining in vitro transcription products of sgRNA and CRISPR / Cas9 respectively through in vitro transcription; (4) introducing the sgRNA obtained in step (3) and the in vitro transcription product of CRISPR / Cas9 into canine fertilized eggs or canine somatic cells to obtain canine fertilized eggs or canine somatic cells with OXT gene knockout; The method also include: The obtained OXT gene knockout canine fertilized egg is transplanted into the oviduct of a recipient female dog, thereby preparing an OXT gene-edited model dog; or the nucleus of the obtained OXT gene knockout canine somatic cell is transplanted into a canine enucleated oocyte, and then the canine enucleated oocyte after nuclear transplantation is transplanted into the oviduct of a recipient female dog, thereby preparing an OXT gene-edited model dog; Wherein, in step (1), the sgRNA sequence of the targeting site and its complementary sequence are the following sequences: S1 site: ACCCGCTGTGACCAGCCATGCGG (SEQ ID NO: 2), complementary sequence: CCGCATGGCTGGTCACAGCGGGT (SEQ ID NO: 3); S2 site: GCAGTTCTGGATGTAGCAGGCGG (SEQ ID NO: 4), complementary sequence: CCGCCTGCTACATCCAGAACTGC (SEQ ID NO: 5); S3 site: TTCGGGCCCAGCATCTGCTGCGG (SEQ ID NO: 6), complementary sequence: CCGCAGCAGATGCTGGGCCCGAA (SEQ ID NO: 7).

2. The method according to claim 1, It is characterized in that The canine somatic cells are derived from the following tissues or organs: fetal tissue, skin, muscle, ear, mammary gland, fallopian tube, ovary, blood, urine, fat, bone marrow, blood vessel and luminal endothelium.

3. Canine somatic cells, tissues or organs of the OXT gene-edited model dog obtained by the method of claim 1 or 2.

4. The canine somatic cell, tissue or organ according to claim 3, It is characterized in that The canine somatic cell, tissue or organ comprises at least one of the sequences shown in SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15 and SEQ ID NO:

17.

5. A targeting vector for canine OXT gene knockout, the targeting vector comprising an sgRNA sequence designed for the targeting site sequence of exon 1 and exon 2 of the canine OXT gene and a backbone vector, The sgRNA and its complementary sequence are the following sequences: S1 site: ACCCGCTGTGACCAGCCATGCGG (SEQ ID NO: 2), complementary sequence: CCGCATGGCTGGTCACAGCGGGT (SEQ ID NO: 3); S2 site: GCAGTTCTGGATGTAGCAGGCGG (SEQ ID NO: 4), complementary sequence: CCGCCTGCTACATCCAGAACTGC (SEQ ID NO: 5); S3 site: TTCGGGCCCAGCATCTGCTGCGG (SEQ ID NO: 6), complementary sequence: CCGCAGCAGATGCTGGGCCCGAA (SEQ ID NO: 7).

Images