A heat-resistant and highly efficient reverse transcriptase mutant and its application

Abstract

The present invention belongs to the field of biological diagnosis, and particularly relates to a heat-resistant, highly efficient, and inhibitor-resistant reverse transcriptase mutant. The present invention discloses a heat-resistant and highly efficient reverse transcriptase mutant, and its amino acid sequence is as shown in SEQ ID NO.1. The reverse transcriptase of the present invention is a modified M-MLV reverse transcriptase, which has high processive synthesis ability and high heat resistance, takes a shorter time to generate complete cDNA, can perform a good reverse transcription reaction on a very small amount of RNA template; has strong anti-inhibition ability, can use a direct sample collection solution, and cDNA can be synthesized without RNA purification, and has broad application prospects and market promotion value.

Description

Technical Field

[0001] The present invention belongs to the field of biological diagnosis, and particularly relates to a heat-resistant, highly efficient, and anti-inhibition reverse transcriptase mutant. Background Art

[0002] Reverse transcriptase is a DNA polymerase that uses RNA as a template to direct the synthesis of complementary DNA (cDNA) from deoxynucleotide triphosphates. It is a multifunctional enzyme with three enzymatic activities, including RNA- and DNA-dependent DNA polymerase activities, and RNase H activity that catalyzes the degradation of RNA in RNA-DNA hybrid chains. In the field of biomedicine, reverse transcriptase is widely used in virus RNA detection, gene expression and function analysis, cDNA library preparation, RNA sequencing, microarray analysis, RACE, etc., and is one of the most widely used biomedical tool enzymes.

[0003] Currently, reverse transcriptase is derived from Avian Myeloblastosis Virus (AMV) or Moloney Murine Leukemia virus (M-MLV). AMV reverse transcriptase is a heterodimer with good thermal stability, but it has strong RNase H activity and can degrade the RNA in the RNA:cDNA complex, so the yield is low, and usually only short cDNA fragments (<5 kb) can be produced. M-MLV reverse transcriptase is a monomeric enzyme, which is more convenient for production and modification, and its reaction temperature is about 37°C. Although the thermal stability of M-MLV is lower than that of AMV reverse transcriptase, its RNase H activity is lower, so it has a higher synthesis efficiency of long cDNA (<7 kb). Using M-MLV reverse transcriptase is still the mainstream direction in the market.

[0004] The optimal reaction temperature of wild-type M-MLV reverse transcriptase is 37°C. At this temperature, single-stranded RNA is prone to self-pairing to form complex secondary structures such as hairpins, which hinders the progress of the reverse transcription reaction. This problem can be overcome by performing cDNA synthesis at a higher temperature, but the wild-type reverse transcriptase has poor thermal stability. Although the thermal stability of H-MMLV reverse transcriptase has been improved to a certain extent, it is not sufficient to completely overcome the thermal stability problem, which puts forward higher requirements for the thermal stability of the enzyme. At the same time, nucleic acid direct amplification is now one of the breakthrough directions in this field, but various substances in the unpurified samples often inhibit the activity of M-MLV reverse transcriptase.

[0005] The most important products of current reverse transcription reagents are the SuperScript series products of Invitrogen Corporation in the United States (which has been acquired by Thermo Fisher), occupying more than half of the domestic market. Due to the high price of imported reagents, the market still lacks domestic reverse transcription reagents with low cost and excellent performance. Therefore, it is very important to develop a reverse transcriptase mutant with high thermal stability, good synthesis performance, and good inhibitor tolerance. Summary of the Invention

[0006] The purpose of the present invention is to provide a reverse transcriptase with high thermal stability, good synthesis performance, and good inhibitor tolerance.

[0007] The present invention discloses a heat-resistant and highly efficient reverse transcriptase mutant, whose amino acid sequence is shown in SEQ ID NO.1.

[0008] Furthermore, the present invention provides a nucleotide sequence encoding a reverse transcriptase, and the reverse transcriptase sequence encoded by the nucleotide sequence is shown in SEQ ID No.2.

[0009] Furthermore, the present invention provides a recombinant expression vector, and the vector contains the nucleotide sequence shown in SEQ ID No.2.

[0010] Furthermore, the present invention provides a recombinant host bacterium, and the host bacterium contains a recombinant expression vector with the nucleotide sequence shown in SEQ ID No.2.

[0011] Furthermore, the present invention provides a reverse transcription reaction kit, which contains a highly efficient reverse transcriptase mutant and a reverse transcription reaction buffer.

[0012] Furthermore, the present invention provides a reverse transcription reaction buffer with good compatibility. The reaction buffer mainly includes: 50 - 300 mM Tirs-HCl, 50 - 200 mM (NH 4 ) 2 SO 4 , 2 - 10 mM MgCl 2 , 0.5 - 1 mM dNTPs, 0.1 - 2.5 µM Oligod(T) 20 / random primer, 1 - 5 mM DTT. Preferably, the composition of the reaction buffer is: 150 mM Tirs-HCl, 50 mM (NH4) 2 SO 4 , 6 mM MgCl 2 , 0.5 mM dNTPs, 2.5 µM Oligod(T) 20 / random primer, 2 mM DTT.

[0013] The reaction buffer of the present invention can maintain the optimal pH and ionic strength of the reaction and contains additives that improve the reverse transcription efficiency and the subsequent PCR reaction efficiency. Among them, Tirs-HCl can provide a stable buffer environment with a pH of 6.0-9.0; (NH4) 2 SO 4 belongs to an inert substance and is not easily reactive with other bioactive substances, can form a high-salt environment, and maximally protects the enzyme activity during the reaction; MgCl 2 can increase the activities of reverse transcriptase and DNA polymerase; dNTPs are usually 0.5-1 mM, preferably at equimolar concentration, and it is recommended to use freshly diluted high-quality dNTPs to ensure good reverse transcription; DTT is a reducing agent and is usually used to provide optimal enzyme activity.

[0014] Furthermore, the present invention provides a one-step RT-PCR detection kit, which includes the high-efficiency reverse transcriptase mutant described in the present invention.

[0015] Furthermore, the present invention provides the use of the high-efficiency reverse transcriptase mutant described above in the preparation of molecular biology reagents.

[0016] In addition, the present invention further provides an optimized RT-PCR detection method for RNA viruses. The specific method includes:

[0017] (1) RNA sample sampling:

[0018] Coarsely processed RNA sample: Use a virus preservation solution (Tianlu Diagnosis, product number TS-SA-20200604-A) to process the throat swab sample. The specific operation is to immerse the swab head in 500 μl of the virus preservation solution after collecting the sample with a throat swab, and shake well for later use;

[0019] (2) Reaction system preparation:

[0020] Note: The primer / probe concentration for RNA detection should refer to the final concentration of 0.1-1.0 μM as the setting range. When the amplification efficiency is not high, the primer concentration can be increased; when non-specific reactions occur, the primer concentration can be decreased to optimize the reaction system.

[0021] (3) RT-PCR amplification:

[0022] Place the prepared reaction system in a PCR instrument and perform the amplification reaction according to the following procedure.

[0023] The reverse transcriptase of the present invention is a modified M-MLV reverse transcriptase, which has high continuous synthesis ability and high heat resistance, takes less time to generate complete cDNA, can perform good reverse transcription reaction on extremely small amounts of RNA templates; has strong anti-inhibition ability, can use direct sample collection solution, and cDNA can be synthesized without RNA purification, and has broad application prospects and market promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is the purified SDS-PAGE diagram of MMLVwt and partial mutants.

[0025] Figure 2 It is the RT-qPCR amplification curve of MMLVwt and mutant M106.

[0026] Figure 3 It is the RT-qPCR amplification curve of mutant M106 at different temperatures.

[0027] Figure 4 It is the direct amplification of ORF gene in the one-step RT-qPCR system of MMLVwt, M106 and SuperScript™ IV.

[0028] Figure 5 It is the direct amplification of N gene in the one-step RT-qPCR system of MMLVwt, M106 and SuperScript™ IV.

[0029] Figure 6 It is the detection of the amplification sensitivity of ORF gene in the one-step RT-qPCR system of MMLVwt, M106 and SuperScript™ IV. DETAILED DESCRIPTION OF THE INVENTION

[0030] In the present invention, the reaction system of PCR amplification of the present invention is a double-enzyme RT-qPCR reaction system;

[0031] The enzymes and proteins included in RT-qPCR include DNA polymerase, wild or modified taq DNA polymerase, wild or modified Tth DNA polymerase, the reverse transcriptase described in the present invention; or UNG enzyme and RNase enzyme inhibitor.

[0032] In the present invention, the RT-qPCR reaction system contains the template to be amplified, the primer pair for amplification, the polymerase and the reagents required for performing polymerase chain reaction.

[0033] Generally, the template to be amplified is a sample collection solution or nucleic acid extract from various different organisms (including pathogens, bacteria, mammals such as humans).

[0034] In the RT-qPCR reaction system of the present invention, there is no particular limitation on the concentration of each primer in the primer pair. Typically, the final concentration of each primer is 0.05 - 1.0 μM, preferably 0.1 - 0.9 μM, more preferably 0.3 - 0.6 μM (about 0.5 μM).

[0035] It should be understood that in the RT-qPCR reaction system of the present invention, other reagents or components that are helpful for performing polymerase chain reaction may be included, for example, including (but not limited to) one or more reagents selected from the following group:

[0036] (i) PCR buffer

[0037] (ii) dNTP

[0038] (iii) ddH 2 O

[0039] In the present invention, there is no particular limitation on the total volume of the polymerase chain reaction system, and it can generally be 10 - 200 μL, preferably 20 - 100 μL, more preferably 25 - 50 μL.

[0040] Amplification method and amplification product

[0041] Typically, the amplification method includes reverse transcription, denaturation, annealing, and extension steps, and includes 20 - 50 cycles, preferably 40 cycles.

[0042] In another preferred embodiment, the annealing temperature of the polymerase chain reaction is T average ± 5°C, preferably T average ± 3°C, where T average is the arithmetic mean of the Tm values of all primers.

[0043] The present invention will be further illustrated below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following embodiments are usually carried out according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0044] 1. Experimental plasmids, materials, and reagents:

[0045] Construction of mutant library: Expression plasmid pET28a-MMLVwt containing wild MMLV reverse transcriptase gene (MMLVwt), 19 pairs of saturation mutation primer pairs, T7-F / T7-R, KMM (TOYOBO), QuickMutation™ Random Gene Mutation Kit (Beyotime), restriction endonuclease TOROBlue® Dpn I, seamless cloning kit TOROIVD® One Step FusionCloning Mix, competent cell BL21(DE3);

[0046] Protein expression and preparation: 0.5 M IPTG stock solution, 200 ml LB medium, high-pressure tissue homogenizer, 5 ml Ni pre-packed column, protein purifier, BufferA, BufferB, BufferC, BufferD;

[0047] Reverse transcription reaction: 5× RT buffer, MS2RNA, dNTPs, Random6 random primer, MS2RNA specific primer MS-F, MS-R;

[0048] qPCR reaction: QST-100 quantitative PCR reagent, Step one Plus quantitative PCR instrument.

[0049] The primer sequences are as follows:

[0050]

[0051] Random6 random primer: NNNNNN (N = A or T or G or C)

[0052] The formulations of the above media and each buffer are as follows:

[0053] LB medium: Yeast extract 5 g / L, NaCl 10 g / L, peptone 10 g / L, pH 7.0, sterilized at 121 °C for 15 min;

[0054] BufferA: 50 mM Tris-HCl (pH 8.0), 300 mM NaCl;

[0055] BufferB: 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 20 mM imidazole;

[0056] BufferC: 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 250 mM imidazole;

[0057] Buffer D: 50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 0.5% NP40.

[0058] Example 1. Screening and Evaluation of MMLV Mutants

[0059] I. Experimental Methods

[0060] 1.1 Mutation Library Construction

[0061] The first round of saturation mutagenesis: Using conventional PCR site-directed mutagenesis technology, 19 mutants with saturation mutagenesis at the D524 site were constructed using 19 pairs of site-directed mutagenesis primers, and were named MMLV-G, MMLV-A, MMLV-L, MMLV-I, MMLV-V, MMLV-P, MMLV-F, MMLV-M, MMLV-W, MMLV-S, MMLV-Q, MMLV-T,

[0062] MMLV-C, MMLV-N, MMLV-Y, MMLV-E, MMLV-K, MMLV-R, MMLV-H.

[0063] The second round of saturation mutagenesis: The random mutagenesis experiment was carried out according to the instructions of the QuickMutation™ Gene Random Mutagenesis Kit (Beyotime). The above 19 kinds of saturation mutants were randomly mutagenized respectively to construct random mutant fragments; according to the instructions of the seamless cloning kit TOROIVD® One Step Fusion Cloning Mix, the random mutant fragments were constructed onto the pET28a vector, and finally transformed into the Escherichia coli expression host BL21(DE3) to construct a random mutant library.

[0064] 1.2 Mutant Induction Expression and Protein Preparation

[0065] Each random mutant clone was inoculated into a 5 ml LB test tube, an appropriate amount of kanamycin was added, and the bacteria were shaken overnight at 37°C in a shaker at 220 rpm. The next day, the bacterial liquid was transferred to 200 ml of LB medium at an inoculation amount of 1-5%, and cultured at 37°C and 220 rpm until OD600 = 0.8 - 1.2, then IPTG with a final concentration of 0.5 mM was added to induce the expression of mutant proteins; after continuing to culture at 37°C and 220 rpm for 5-6 hr, the bacteria were collected by centrifugation.

[0066] Weigh the collected bacterial cells and resuspend them in buffer A at a ratio of 10 - 15%. Use a high-pressure tissue disruptor to lyse and break the resuspended bacterial solution. Centrifuge the above bacterial cell lysate at 12,000 rpm for 30 min, collect the supernatant, and discard the bacterial sludge precipitate. After filtering the supernatant through a 0.22 μm filter membrane, use a protein purifier and a 5 ml Ni pre-packed column for purification. Among them, the washing solution is buffer B and the elution solution is buffer C. Dialyze and desalt the eluted enzyme solution in dialysis buffer D and then concentrate it. Mix the mutant protein concentrate with 100% glycerol in equal volume and store it in a -20°C refrigerator.

[0067] 1.3 Evaluation of the relative reverse transcription efficiency of mutants

[0068] Using MS2RNA standard as a template, perform reverse transcription reaction.

[0069] The reverse transcription system is as follows:

[0070] Component Added Volume (ul) 5×RT buffer 4 Wild MMLV / Mutant Protein Sample 1 Primer Mix 1 Water 12 RNA Template 2 Total Volume 20

[0071] Mix well and centrifuge, then perform the reverse transcription reaction. The reaction program is as follows:

[0072] Stage Temperature Time Number of Cycles Reverse Transcription 37℃ 15min 1 High Temperature Reverse Transcription 50℃ 5min 1 Denaturation 98℃ 5min 1

[0073] After reverse transcription, dilute the cDNA by 5-fold. Mix well and centrifuge, then use it as a quantitative template. The quantitative reaction system is as follows:

[0074] Component 1×（ul） QST-100 10 MS-F (10uM) 0.8 MS-R (10uM) 0.8 Water 3.4 Template 5 Total Volume 20

[0075] qPCR program: 95°C for 1 minute, 40 cycles (95°C for 10 seconds, 60°C for 15 seconds, 72°C for 30 seconds).

[0076] The calculation standard for evaluating the relative reverse transcription efficiency of mutants is as follows: Set the reverse transcription efficiency of wild-type reverse transcriptase as 100%. Compare the reverse transcription reaction efficiency of each mutant with that of wild-type reverse transcriptase. The formula for calculating the relative reverse transcription reaction efficiency of each mutant is as follows:

[0077] Relative reverse transcription reaction efficiency = 100% × 2 (Ct野生型-Ct突变体)

[0078] 1.4 Obtaining the DNA sequence of mutants with high reverse transcription efficiency and analyzing the corresponding mutation sites

[0079] Use conventional PCR technology to amplify the target gene fragment of the screened high-efficiency mutants, send it to a sequencing company for sequencing to obtain its DNA sequence. Use Snapgene software to analyze the differences between the mutant gene sequence and the wild-type MMLV reverse transcriptase gene sequence, and confirm the mutation sites of the mutants.

[0080] 1.5 Heat resistance test of mutants

[0081] Set the reverse transcription program to 4 temperature gradients of 37 - 42 - 55 - 62 °C. The specific reverse transcription program is as follows:

[0082] Stage Temperature Time Number of Cycles Reverse Transcription 37 / 42 / 55 / 62℃ 15min 1 High Temperature Reverse Transcription 50℃ 5min 1 Denaturation 98℃ 5min 1

[0083] After reverse transcription, dilute the cDNA by 5 times. After mixing and centrifuging, use it as the qPCR quantitative template.

[0084] II. Experimental results

[0085] 2.1 Induced expression and protein preparation of mutants

[0086] Through experiments, wild MMLV reverse transcriptase (MMLVwt) and most mutants can be normally expressed and can be purified and prepared. The DNA sequence of wild MMLV reverse transcriptase (MMLVwt) is such as gene ID: NP_955591, and its protein sequence is such as UPI0000233647. The purification effects of MMLVwt and some mutants are as Figure 1 shown.

[0087] 2.2 Evaluation of relative reverse transcription efficiency of mutants

[0088] After a large number of tests, a mutant M106 with a significantly improved reverse transcription efficiency compared to MMLVwt was screened out. According to the formula (relative reverse transcription reaction efficiency = 100% × 2 (Ct野生型-Ct突变体)） Calculated, the reverse transcription efficiency of mutant M106 is 51.6 times that of MMLVwt. The detailed reverse transcription efficiency test results are shown in Table 1, Figure 2 .

[0089] Table 1

[0090] 2.3 Confirmation of DNA sequence of mutants with high reverse transcription efficiency and analysis of corresponding mutation sites

[0091] Through sequencing analysis, the DNA sequence of mutant M106 is such as SEQ ID No.2, and its protein sequence is such as SEQ ID No.1. By comparing and analyzing with the amino acid sequence of wild-type MMLV reverse transcriptase, it is confirmed that mutant M106 involves amino acid mutations at 5 sites: D114N, Q299R, T458A, D524L, H592R.

[0092] 2.4 Heat resistance test of mutant M106

[0093] As shown in Table 2, Figure 3As shown, the reverse transcription efficiency of mutant M106 is relatively consistent at temperatures of 37 / 42 / 55 / 62 °C, and high-efficiency reverse transcription can be carried out in all cases.

[0094] Table 2

[0095] III. Conclusion

[0096] A reverse transcriptase mutant with heat resistance and high reverse transcription efficiency was screened in the present invention. Specifically, the mutation sites are D114N, Q299R, T458A, D524L, and H592R. Compared with the wild-type MMLV enzyme, this mutant can perform high-efficiency reverse transcription at 37 - 62 °C, and the reverse transcription efficiency is increased by 51.6 times.

[0097] Example 2. Detection of the sensitivity and anti-inhibition performance of the one-step RT-qPCR system for reverse transcriptase

[0098] One-step RT-qPCR direct amplification performance detection was carried out for wild-type MMLVwt, MMLV mutant M106, and SuperScript™ IV (Invitrogen™). The COVID-19 pseudovirus RNA of the novel coronavirus was detected using the CDC novel coronavirus COVID-19 primers and probe ORF / N.

[0099] I. Experimental materials

[0100] Virus preservation solution (Tianlu Diagnosis, product number RDB-200; containing high concentrations of PVSA and Triton X-100);

[0101] Novel coronavirus COVID-19 pseudovirus nucleic acid reference material (Guangzhou Bangde Sheng Biotechnology Co., Ltd., reference material number GBW(E)091132, 2×10 5 copies / mL);

[0102] Antibody-modified hot-start rTTH DNA polymerase: TOROIVD® 5G DNA polymerase (Tianlu Diagnosis, product number MFP-207, 4 U / μL);

[0103] 2×5G qPCR Buffer GB (Tianlu Diagnosis, product number ASF101GB), the components are as follows:

[0104] Ingredient Concentration Range Tris-HCl pH7.0 - 9.0 20 - 200mM <![CDATA[MgCl 2 > 1 - 10 mM KCl 50 - 200mM BSA 0.1-0.5%

[0105] Recombinant RNase Inhibitor (Tianlu Diagnosis, product number RIN-002, 40 U / μL);

[0106] Wild-type MMLVwt (100 U / μL);

[0107] MMLV mutant M106 (100 U / μL);

[0108] SuperScript™ IV (Invitrogen™, catalog number 18090010, 200 U / μL);

[0109] Rnase Free H 2 O;

[0110] The primers and probes (Primer / Probe Mix) used are as follows:

[0111] Primer Name Primer Sequence Probe Label ORF-F CCCTGTGGGTTTTACACTTAA 5’- ORF-R ACG ATT GTG CATCAG CTGA ORF-P CCGTCTGCGGTATGTGGAAAGGTTATGG 5’-FAM, 3’-BHQ1 N-F GGG GAACTT CTCCTG CTA GAAT N-R CAG ACATTTTGCTCT CAA GCTG N-P TTG CTG CTG CTT GAC AGA TT 5’-VIC, 3’-BHQ1

[0112] II. Experimental methods

[0113] 2.1 Gradient dilution of the nucleic acid standard substance of the SARS-CoV-2 pseudovirus and experimental group design

[0114] Dilute the nucleic acid standard substance of the SARS-CoV-2 pseudovirus at 2×10 5 copies / mL with the RDB-200 virus preservation solution to obtain pseudovirus nucleic acid templates at 2×10 4 copies / mL and 2×10 3 copies / mL respectively; among them: the pseudovirus nucleic acid template at 2×10 4 copies / mL is used to compare and detect the gene amplification performance of the one-step RT-qPCR systems of wild-type MMLVwt, MMLV mutant M106, and SuperScript™ IV, with 3 replicate wells set for each experimental group; the pseudovirus nucleic acid template at 2×10 ORF / N copies / mL is used to compare and detect the sensitivity of the one-step RT-qPCR systems of MMLVwt, M106, and SuperScript™ IV, with 20 replicates set for each experimental group, and all use 3 gene amplification. ORF Gene amplification.

[0115] Since the RDB-200 virus preservation solution contains high concentrations of PVSA and Triton X-100, which can inhibit the activity of reverse transcriptase, the pseudovirus nucleic acid template at 2×10 3 copies / mL obtained by diluting with the RDB-200 virus preservation solution can also be used to compare and detect the anti-inhibition performance of the one-step RT-qPCR systems of MMLVwt, M106, and SuperScript™ IV.

[0116] 2.2 Primer-Probe Mix System

[0117] Component Volume (ul) ORF-F (100uM) 10 ORF-R (100uM) 10 ORF-R (100uM) 8 N-F (100uM) 10 N-R (100uM) 10 N-P (100uM) 8 Rnase Free H2O 44 Total Volume 100

[0118] 2.3 One-step RT-qPCR Reaction System

[0119] Component Volume (ul) 1× 2×5G qPCR Buffer GB 12.5 5G DNA polymerase 0.2-1 MMLV Reverse Transcriptase 0.1-0.3 RIN-002 0.2-2 Primer / Probe Mix 1 Pseudovirus RNA Template 5 Rnase Free H2O Up to 25 Total Volume 25

[0120] 2.4 One-step RT-qPCR Reaction Program

[0121]

[0122] III. Experimental Results

[0123] 3.1 One-step RT-qPCR Systems of Wild-type MMLVwt, MMLV Mutant M106 and SuperScript™ IV ORF Comparison of Direct Gene Amplification Performance

[0124] As Figure 4 、 Figure 5 and Table 3 show: The Ct values and fluorescence curves of the experimental groups of M106 and SuperScript™ IV are basically the same, and both are 2.74 - 3.58 Ct values lower than those of the MMLVwt laboratory group. The above experimental results indicate that: The amplification performances of the one-step RT-qPCR systems of M106 and SuperScript™ IV are basically the same, and are significantly better than that of the one-step RT-qPCR system of MMLVwt.

[0125] Table 3: One-step RT-qPCR Systems of MMLVwt, M106 and SuperScript™ IV ORF 、 N Direct Gene Amplification Ct Values

[0126]

[0127] 3.2 Detection of Sensitivity and Anti-inhibition Performance of One-step RT-qPCR Systems of MMLVwt, M106 and SuperScript™ IV

[0128] As Figure 6 and Table 4 show: For the one-step RT-qPCR systems of M106 and SuperScript™ IV to amplify ORF gene, the detection rates of the pseudovirus nucleic acid template at 2×10 3 copies / mL are both 100%; For the one-step RT-qPCR system of MMLVwt to amplify ORF gene, 2×10 3The detection rate of the pseudovirus nucleic acid template at [[X]] copies / mL was only 15%, and the CT value was relatively high. The above experimental results indicate that: the sensitivity and anti-inhibition performance of the one-step RT-qPCR systems of M106 and SuperScript™ IV are basically the same, and are significantly better than that of MMLVwt.

[0129] Table 4: One-step RT-qPCR systems of MMLVwt, M106 and SuperScript™ IV ORF Ct value of gene amplification

[0130]

[0131] IV. Conclusion

[0132] The one-step RT-qPCR system of the MMLV mutant M106 of the present invention has high sensitivity and strong anti-inhibition performance, can be used to directly amplify samples stored in virus preservation solution, and the sensitivity can reach 2×10 3 copies / mL, which is suitable for rapid detection of RNA viruses.

[0133] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various deformations or modifications within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A heat-resistant high-efficiency reverse transcriptase mutant, whose amino acid sequence is shown in SEQ ID NO.

1.

2. A recombinant expression vector, which contains the nucleotide sequence shown in SEQ ID No.

2.

3. A recombinant host bacterium, which contains the recombinant expression vector with the nucleotide sequence shown in SEQ ID No.

2.

4. A reverse transcription reaction kit, which contains the high-efficiency reverse transcriptase mutant as claimed in claim 1 and a reverse transcription reaction buffer.

5. The reverse transcription reaction kit as claimed in claim 4, characterized in that The reverse transcription reaction buffer includes: 50 - 300 mM Tirs-HCl, 50 - 200 mM (NH 4 ) 2 SO 4 , 2 - 10 mM MgCl 2 , 0.5 - 1 mM dNTPs, 0.1 - 2.5 µM Oligod(T) 20 , 1 - 5 mM DTT.

6. The reverse transcription reaction kit as claimed in claim 4, characterized in that The composition of the reverse transcription reaction buffer is: 150 mM Tirs-HCl, 50 mM (NH4) 2 SO 4 , 6 mM MgCl 2 , 0.5 mM dNTPs, 2.5 μM Oligod(T) 20 , 2 mM DTT.

7. A one-step RT-PCR detection kit, which includes the high-efficiency reverse transcriptase mutant as claimed in claim 1.

8. Use of the high-efficiency reverse transcriptase mutant as claimed in claim 1 in the preparation of molecular biology reagents.

Images