crRNA and kit for monkeypox virus nucleic acid detection

Abstract

The application provides a CRISPR / Cas12a-based monkeypox virus nucleic acid detection crRNA and a monkeypox virus nucleic acid rapid detection kit using the crRNA. Specifically, the application provides a crRNA for monkeypox virus nucleic acid detection, which comprises a nucleotide sequence shown in SEQ NO. 12 or SEQ NO. 19. Meanwhile, the application provides a monkeypox virus nucleic acid detection kit, which comprises specific amplification primers for monkeypox virus genes, one or two of the crRNAs, CRISPR / Cas12a protein and a single-stranded DNA (ssDNA) reporting system. The application is the first to detect monkeypox virus using CRISPR / Cas12a, and through specific recognition of monkeypox virus nucleic acid by CRISPR / Cas12a, high-sensitivity, high-specificity and rapid visual detection of monkeypox virus nucleic acid are achieved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of rapid detection of nucleic acid, and in particular to a crRNA for detecting monkeypox virus nucleic acid and a related detection kit and a preparation method. BACKGROUND

[0002] Monkeypox is an acute infectious disease caused by monkeypox virus (MP). Monkeypox virus was first discovered in 1958 when a group of monkeys for research developed a "pox-like" infectious disease, hence the name. Since the World Health Organization declared the complete eradication of smallpox in 1980, monkeypox virus has become the most influential orthopoxvirus to public health. The disease is highly contagious, with a mortality rate of 1-10%. As of June 16, 2022, the number of confirmed cases of monkeypox worldwide has exceeded 2000, reaching 2027. Monkeypox virus belongs to the Poxviridae family of orthopoxviruses, and is one of the four orthopoxviruses that cause disease in humans, the other three being smallpox virus, vaccinia virus, and cowpox virus. Poxviridae is the largest class of DNA viruses, with a complex structure. The orthopoxvirus genome is double-stranded DNA, with a genome size of 130-375 kb, containing approximately 190 open reading frames, encoding 213 proteins. In terms of monkeypox treatment, there is currently no specific drug for treating monkeypox infection. Only some drugs can be used. Therefore, monkeypox needs early diagnosis and early treatment, and laboratory pathogen diagnosis is the key to the diagnosis of monkeypox virus infection.

[0003] According to the detection method of monkeypox virus, it includes virus culture and nucleic acid detection. Virus culture method uses collected pathological specimens for virus culture and isolation of monkeypox virus. This method requires a long time period, which is not conducive to rapid identification, and the virus culture environment requires strict conditions and needs to be carried out in a level three or higher biosafety laboratory. Nucleic acid detection uses nucleic acid amplification detection method to detect monkeypox virus nucleic acid in skin rash, blister fluid, scab, oropharyngeal or nasopharyngeal secretions and other specimens. The common method of nucleic acid detection is conventional polymerase chain reaction (PCR) or real-time fluorescent PCR. Nucleic acid detection can be for the large category of orthopoxviruses (OPXV), or specifically for monkeypox virus (MPXV, MP). The first step is to detect OPXV that causes disease in humans by PCR, but the specific species is not determined. Then a second step can be performed, which can be based on PCR or use sequencing to specifically detect MPXV. However, PCR-based methods have strict environmental and instrument dependence, which is not conducive to the popularization and application of detection in primary medical institutions or at home.

[0004] Isothermal amplification technology (IAT) is a novel nucleic acid amplification technique developed in recent years. It utilizes various enzymes and specific primers for rapid amplification under constant temperature conditions. It includes loop-mediated isothermal amplification (LAMP), crossing priming amplification (CPA), strand displacement amplification (SDA), recombinase polymerase amplification (RPA), nucleic acid sequence-based amplification (NASBA), rolling circle amplification (RCA), and helicase-dependent amplification (HDA). Compared to PCR, isothermal amplification utilizes simpler instrumentation and shortens amplification time. LAMP has been used in studies for the rapid identification of monkeypox virus. Nevertheless, the LAMP method involves many problems such as the large number of primers and high requirements for primer design, which limits its application in pathogen detection. In addition, isothermal amplification also needs to overcome the false positive bottleneck of nonspecific amplification.

[0005] In recent years, the gene editing system represented by Crispr / cas9 has developed rapidly, and efficient and precise DNA and RNA editing has been widely used in biomedicine, agriculture and many other fields. At the same time, it is found that part of the Crispr system, such as Cas12a / b and Cas13, has non-specific nucleic acid cleavage activity after being activated. For example, Lachnospiraceae bacterium ND2006 Cas12a (LbCas12a) can quickly degrade single-stranded M13 DNA phage under the guidance of guide RNA (such as natural crRNA), thereby proposing that LbCas12a has strong non-specific cleavage activity of single-stranded DNA (ssDNA) after binding with target DNA, i.e. "accessory cleavage" activity. Since then, based on the "accessory cleavage" activity, combined with single-stranded DNA carrying fluorescence, various specific target sequence detection technologies have been developed, which makes this technology not only can be used for nucleic acid editing but also can be used for nucleic acid variation detection. Therefore, the nucleic acid detection technology based on the Crispr system can have high specificity in theory, which makes up for the lack of specificity of isothermal amplification, but its sensitivity is limited, and more importantly, the fault tolerance of guide RNA such as crRNA or gRNA is high, which is difficult to distinguish single-base mutation. At present, there is no report on the detection technology of monkeypox virus based on the Crispr system. SUMMARY

[0006] The application provides a crRNA for detecting monkeypox virus nucleic acid based on CRISPR / Cas12a, and a rapid detection kit for monkeypox virus nucleic acid using the crRNA.

[0007] According to a first aspect, the application provides a crRNA for detecting monkeypox virus nucleic acid, which comprises a nucleotide sequence as shown in SEQ NO. 12 or SEQ NO. 19.

[0008] Further, the 5' end of the crRNA in the application comprises a hairpin sequence, and in a specific embodiment of the application, the hairpin sequence is as shown in SEQ NO. 23.

[0009] Meanwhile, the application also provides a preparation method of the above-mentioned crRNA, comprising: finding a target sequence containing a CRISPR / Cas12a recognition sequence in the monkeypox virus crmB gene region and the monkeypox virus gene 46428-46723 region, designing a nucleotide sequence with a length of 20-23 nt (the nucleotide sequence can be specifically recognized with the target DNA to be detected), and obtaining the above-mentioned crRNA by in vitro transcription or synthesis.

[0010] According to a second aspect, the present application provides a monkeypox virus nucleic acid detection kit, the kit comprising one or two of the above-mentioned crRNAs. The above-mentioned kit can further comprise specific amplification primers for monkeypox virus genes, the above-mentioned crRNAs, a CRISPR / Cas12a protein, and a single-stranded DNA (ssDNA) reporter system.

[0011] Specifically, the specific amplification primers for monkeypox virus genes comprise specific amplification primers for the monkeypox virus crmB gene region and / or the monkeypox virus gene region 46428-46723. The single-stranded DNA reporter system comprises a ssDNA FQ reporter or a ssDNA DB reporter. The CRISPR / Cas12a protein is an LbCas12a protein.

[0012] The present application has the beneficial effect that the present application is the first to detect monkeypox virus using CRISPR / Cas12a, and by using the specific recognition of CRISPR / Cas12a for monkeypox virus nucleic acid, high sensitivity, high specificity, and rapid visual detection of monkeypox virus nucleic acid are achieved. Based on the characteristics of CRISPR / Cas12a recognizing specific PAM sequences, specific crRNAs are designed according to the target sequence of the monkeypox virus gene. Through detection experiments, it is verified that the designed crRNAs can effectively shield other orthopoxviruses and specifically recognize monkeypox virus, thereby providing a CRISPR / Cas12a-based rapid detection kit for monkeypox virus nucleic acid. The kit has the advantages of high sensitivity, strong specificity, short time consumption, high throughput, and independence from large experimental equipment, and is convenient for rapid detection and diagnosis of monkeypox virus nucleic acid in laboratories and clinical medicine.

[0013] Meanwhile, the present application provides two monkeypox virus detection sites, and specific primers and crRNAs are designed for each of them, which not only can achieve single target detection, but also can perform double target detection, effectively ensuring the accuracy of the detection. In addition, the kit of the present application can realize rapid, high specificity, high sensitivity, and visual detection of monkeypox virus nucleic acid through a fluorescence emitter, a real-time fluorescence quantitative PCR instrument, and a colloidal gold test strip, and therefore, the kit can provide multiple specific detection forms, providing an accurate, rapid, and simple detection method for clinical diagnosis and laboratory research. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 Figure for multiple sequence alignment results of different orthopoxvirus crmB gene regions;

[0015] Figure 2Figure for CRISPR / Cas12a fluorescent emitter (ultraviolet light) detection of the crmB gene region of monkeypox virus using different crRNAs (crRNA1-3);

[0016] Figure 3 Figure for CRISPR / Cas12a fluorescent emitter (blue light) detection of the crmB gene region of monkeypox virus using different crRNAs (crRNA1-3);

[0017] Figure 4 Figure for CRISPR / Cas12a real-time fluorescent quantitative PCR instrument detection of the crmB gene region of monkeypox virus using crRNA1;

[0018] Figure 5 Figure for CRISPR / Cas12a colloidal gold test strip detection of the crmB gene region of monkeypox virus using crRNA1;

[0019] Figure 6 Figure for the sensitivity of CRISPR / Cas12a fluorescence detection of the crmB gene region of monkeypox virus using crRNA1;

[0020] Figure 7 Figure for CRISPR / Cas12a fluorescent emitter (ultraviolet light) detection of the crmB gene region of monkeypox virus using amplification detection combined method using crRNA1;

[0021] Figure 8 Figure for the sensitivity of CRISPR / Cas12a fluorescence detection of the crmB gene region of monkeypox virus using amplification detection combined method using crRNA1;

[0022] Figure 9 Figure for multiple sequence alignment of various orthopoxviruses in the region similar to the monkeypox virus gene (46428-46723);

[0023] Figure 10 Figure for CRISPR / Cas12a fluorescent emitter (ultraviolet light) detection of the monkeypox virus gene (46428-46723) region using different crRNAs (crRNA4-7);

[0024] Figure 11 Figure for CRISPR / Cas12a fluorescent emitter (blue light) detection of the monkeypox virus gene (46428-46723) region using different crRNAs (crRNA4-7);

[0025] Figure 12This is the result of using different crRNAs (crRNA4-7) for CRISPR / Cas12a real-time fluorescence quantitative PCR to detect the monkeypox virus gene (46428-46723) region;

[0026] Figure 13 This is the result of using crRNA4 for CRISPR / Cas12a colloidal gold test strips to detect the monkeypox virus gene (46428-46723) region;

[0027] Figure 14 Results of fluorescence sensitivity analysis of the monkeypox virus gene (46428-46723) region using CRISPR / Cas12a with crRNA4;

[0028] Figure 15 Results of the monkeypox virus gene (46428-46723) region detected using crRNA4 amplification detection combined with CRISPR / Cas12a fluorescence emitter (ultraviolet light);

[0029] Figure 16 The results of the fluorescence sensitivity of the monkeypox virus gene (46428-46723) region detected by crRNA4 amplification detection combined with CRISPR / Cas12a;

[0030] Figure 17 This is the result of CRISPR / Cas12a fluorescence emitter (ultraviolet light) detection of monkeypox virus dual targets using crRNA1 and crRNA4;

[0031] Figure 18 This is the result of CRISPR / Cas12a fluorescence emitter (blue light) detection of monkeypox virus dual targets using crRNA1 and crRNA4;

[0032] Figure 19 This is the result of using crRNA1 and crRNA4 for CRISPR / Cas12a real-time fluorescence quantitative PCR to detect dual targets of monkeypox virus;

[0033] Figure 20 This is a graph showing the sensitivity of the dual-target fluorescence assay for monkeypox virus detection using crRNA1 for CRISPR / Cas12a.

[0034] Figure 21 This is a graph showing the sensitivity of the dual-target fluorescence assay for monkeypox virus detection using crRNA4 for CRISPR / Cas12a.

[0035] Figure 22The results of the CRISPR / Cas12a fluorescence emitter (ultraviolet light) detection of monkeypox virus double target points using crRNA1 and crRNA4 for amplification detection combination method are shown in the following figure. DETAILED DESCRIPTION

[0036] The key of the CRISPR / Cas12a-based nucleic acid detection technology is crRNA. When the target DNA that can hybridize with the crRNA exists in the sample to be detected, the crRNA can activate the CRISPR / Cas12a. At this time, the CRISPR / Cas12a has endonuclease activity and can non-specifically cut single-stranded DNA (non-target ssDNA). Using this principle, the rapid detection of monkeypox virus nucleic acid can be further realized through the design of an ssDNA reporting system. The nucleic acid detection based on the Crispr system alone has relatively low sensitivity and cannot efficiently detect trace nucleic acid samples. More importantly, the efficiency and fault tolerance of different guide RNAs differ greatly, which leads to the need for careful design and sufficient experimental verification of the system in order to obtain guide RNAs that meet the requirements of detection efficiency and specificity. A large amount of research and screening on the monkeypox virus gene has been carried out in the present application, and two specific crRNAs have been designed in the monkeypox virus crmB gene region and the monkeypox virus gene (46428-46723) region through experimental verification. The above crRNAs can be used to effectively construct a monkeypox virus detection system based on CRISPR / Cas12a. The detailed design process of the crRNAs and related methods will be further described in the subsequent examples.

[0037] It should be noted that the crRNA suitable for the CRISPR / Cas12a protein comprises a hairpin sequence that can bind to the CRISPR / Cas12a protein, and a nucleotide sequence adjacent to the hairpin sequence and capable of hybridizing with the target DNA, wherein the hairpin sequence is located at the 5' end of the crRNA. The aforementioned hybridization with the target DNA means that the sequence has complementarity with the target DNA, and in some literature, this sequence is also referred to as a guide sequence (Guide sequence). The schematic structure of the crRNA can be briefly described as: 5'-

hairpin sequence

nucleotide sequence capable of hybridizing with target DNA

[0038] Based on the above specific crRNA, the present application further provides a CRISPR / Cas12a-based monkeypox virus nucleic acid detection kit, comprising specific amplification primers for monkeypox virus genes, one or two of the above specific crRNAs, a CRISPR / Cas12a protein, and a single-stranded DNA (ssDNA) reporting system.

[0039] As described above, the construction of the CRISPR / Cas12a-based monkeypox virus detection system preferably amplifies the target DNA of the sample to be tested, and the kit of the present application preferably specifically amplifies the monkeypox virus crmB gene region and / or the monkeypox virus gene (46428-46723) region. Therefore, the present application provides two alternative target points, which can achieve single target point detection and double target point detection, and those skilled in the art can use the specific detection mode according to the need. The specific amplification method for the above-mentioned target points can be various, and the isothermal amplification technology is preferred in the present application, such as recombinase polymerase amplification technology (RPA), multi-enzyme constant temperature rapid amplification technology (MIRA) and the like, and those skilled in the art can select the appropriate amplification method according to the need. At the same time, those skilled in the art can design specific specific target DNA amplification primers based on the above-mentioned fragments according to the amplification method. Several preferred primers are provided in the specific embodiments of the present application, which can be used in different amplification methods, for example, MPoxL1 and MPoxR1 can be used with MPoxL2 and MPoxR2 for MIRA amplification of target DNA, and at the same time, MPoxL1 and MPoxR1 can also be used alone for RPA amplification of target DNA. The specific selection of amplification primers does not constitute a limitation on the present application, and those skilled in the art can design appropriate amplification primers according to the specific crRNA described above, in the monkeypox virus crmB gene region, the monkeypox virus gene (46428-46723) region. In a specific embodiment of the present application, MIRA is preferably used for amplification. At this time, the specific amplification primers for the monkeypox virus crmB gene region include: MPoxL1 and MPoxR1, the sequences of which are shown in SEQ NO. 8 and SEQ NO. 9, respectively; and MPoxL2 and MPoxR2, the sequences of which are shown in SEQ NO. 10 and SEQ NO. 11, respectively. The specific amplification primers for the monkeypox virus gene 46428-46723 region include: MPL1 and MPR1, the sequences of which are shown in SEQ NO. 15 and SEQ NO. 16, respectively; and MPL2 and MPR2, the sequences of which are shown in SEQ NO. 17 and SEQ NO. 18, respectively.

[0040] It should be noted that, based on the inventive concept of the present invention, the effect of the ssDNA reporter system is to provide a measurable detection signal for displaying whether there is target DNA in the sample to be tested, and the detectable measurement signal can be any measurable signal generated when ssDNA is non-specifically cut by CRISPR / Cas12a. Therefore, the ssDNA in the reporter system is not particularly limited, but requires that it not hybridize with crRNA. Based on the above principles, the ssDNA reporter system applicable to the present invention can have a variety of specific implementation forms, and when selecting different ssDNA reporter systems, the kit of the present invention has different specific implementations. Those skilled in the art can select other suitable specific ssDNA reporter systems that meet detection needs according to the demonstration of the specific embodiment of the present invention, and the above principles. Further, in a specific embodiment of the present invention, ssDNAFQ reporter is preferably ssDNA labeled with carboxyfluorescein (FAM) and fluorescence quencher (BHQ1), and the labeled product is as follows: / 5FAM / TTATTATT / 3BHQ1 / , fully named ssDNA FQ reporter / 5FAM / ATTATTT / 3BHQ1 / . When using a real-time fluorescence quantitative PCR instrument, the presence of the monkeypox virus gene in the CRISPR / Cas12a detection system activates the endonuclease activity of the CRISPR / Cas12a protein, mediated by the monkeypox virus-specific crRNA. The activated CRISPR / Cas12a protein cleaves the ssDNA FQ reporter labeled with a fluorophore and a quencher, releasing the activated fluorophore. The real-time fluorescence quantitative PCR instrument can detect a fluorescence increase over time. Conversely, when the monkeypox virus gene sequence is absent from the sample, the fluorescence value remains constant over time at a baseline value. When using a fluorescence emitter, the presence of the monkeypox virus gene in the CRISPR / Cas12a detection system activates the endonuclease activity of the CRISPR / Cas12a protein, mediated by the monkeypox virus-specific crRNA. The activated CRISPR / Cas12a protein cleaves the ssDNA FQ reporter labeled with a fluorophore and a quencher, releasing the activated fluorophore. Fluorescence can be observed using a gel imager. Correspondingly, when the monkeypox virus gene sequence is absent in the sample to be tested, no fluorescence is generated. In another specific embodiment of the present invention, the ssDNA DB reporter is preferably ssDNA labeled with 6-carboxyfluorescein (6-FAM) and biotin. The labeled product is as follows: / 5 6FAM / TTATTATT / 3Biotin / , fully named ssDNA DB reporter / 5 6FAM / TTATTATT / 3Biotin / .In the detection using the immunocolloidal gold test strip, the sample to be detected after being cut by CRISPR / Cas12a is added to the colloidal gold test strip, the colloidal gold-labeled mouse anti-6-carboxyfluorescein antibody is combined with the 6-carboxyfluorescein-labeled ssDNA reporter system, and the complex moves from the quality control line to the detection line along the flow direction; the streptavidin on the quality control line captures the biotin-labeled ssDNA reporter system, thereby displaying the strip; when CRISPR / Cas12a detects the gene of monkeypox virus, the 6-carboxyfluorescein-labeled and biotin-labeled ssDNA reporter system is cut off, thereby the 6-carboxyfluorescein-labeled ssDNA fragment is captured by the detection line to show color; when CRISPR / Cas12a cannot detect the gene sequence of monkeypox virus, the 6-carboxyfluorescein-labeled and biotin-labeled ssDNA reporter system cannot be cut off, thereby no 6-carboxyfluorescein-labeled ssDNA fragment is captured by the detection line to show color. In the rapid detection test paper suitable for the above colloidal gold test strip or similar principle, the double labeling of ssDNA can select different labels, which are suitable for the capture in the detection line and the quality control line, and the person skilled in the art can make specific selection.

[0041] It should be further pointed out that the specific detection process of the present application can first amplify the sample, and then mix the amplification product with crRNA, CRISPR / Cas12a protein and ssDNA reporter for cutting and result detection. The specific amplification product, crRNA, CRISPR / Cas12a protein and ssDNA reporter can also be mixed, that is, the target DNA amplification and CRISPR / Cas12a protein cutting are combined into one tube for reaction (also referred to as amplification detection combination method in the embodiments of the present application), so as to realize the rapid detection of monkeypox virus nucleic acid. In other words, different detection steps can be used in the specific use of the kit in the present application. Therefore, the use steps of the kit do not constitute a limitation on the kit of the present application.

[0042] Meanwhile, the CRISPR / Cas12a protein suitable for the present application can be directly purchased or artificially synthesized according to its sequence (including its appropriately optimized sequence), and the acquisition method and specific sequence of CRISPR / Cas12a protein do not constitute a limitation on the present application.

[0043] The specific relevant materials involved in the specific embodiments of the present application are described as follows: The DNA constant temperature rapid amplification kit in the present application is purchased from Amp Future Biotech Co., Ltd.; the crRNA in vitro transcription box TranscriptAid T7 High Yield Transcription Kit is purchased from Thermo Fisher Scientific Company; the purification box RNAClean & Concentrator-5 is purchased from Zymo Research Company; the CRISPR / Cas12a protein and NEBuffer r2.1 (10X) are purchased from NEB Company; the colloidal gold test strip HybriDetect Universal Lateral Flow Assay Kit is purchased from Milenia Biotec Company; and the synthesis of nucleic acid and ssDNA probe is completed by Beijing Lihe Huada Gene Technology Co., Ltd.

[0044] The present application will be further described in detail through specific embodiments combined with the accompanying drawings. In the following embodiments, many details are described in order to make the present application better understood. However, those skilled in the art can easily recognize that some features can be omitted in different cases, or can be replaced by other elements, materials or methods. In some cases, some operations related to the present application are not shown or described in the specification in order to avoid the core part of the present application being overwhelmed by too much description, and it is not necessary to describe these related operations in detail for those skilled in the art according to the description in the specification and general technical knowledge in the art. The present application refers to “connection” and “coupling”, which includes direct and indirect connection (coupling) unless otherwise specified.

[0045] In addition, the features, operations or characteristics described in the specification can be combined in any appropriate way to form various embodiments. At the same time, the steps or actions in the method description can also be sequentially adjusted or adjusted in a manner that those skilled in the art can easily see. Therefore, the order in the specification and the drawings is only for the purpose of clear description of a certain embodiment, and does not mean the necessary order, unless otherwise stated that a certain order must be followed.

[0046] Example 1: Rapid and sensitive detection of monkeypox virus nucleic acid crmB gene nucleic acid fragment

[0047] 1. Nucleic acid preparation

[0048] Through a large number of studies and comparisons, the present application selects the design of relevant specific crRNA for the monkeypox virus nucleic acid crmB gene fragment. In this example, the orthopoxvirus crmB gene fragment is downloaded using the NCBI database BLAST tool, and the sequence includes monkeypox virus (Monkeypox virus strain Congo_8; Monkeypox virus strain Nigeria-SE-1971; Monkeypox virus isolate MpxV / human), vaccinia virus (vaccinia virus), variola virus (variola virus), camel pox virus (Camelpox virus), horsepox virus (horsepox virus), buffalo pox virus (Buffalopox virus), rabbit pox virus (rabbitpox virus), cowpox virus (Cowpox virus), etc. The downloaded fragment sequence is subjected to multiple sequence analysis using CLUSTAL O (1.2.4) software (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ), and the analysis results are shown in Figure 1 Then, according to the above-mentioned multiple sequence alignment results, a conservative section is selected for isothermal amplification primer design, and a specific cRNA is designed for a variable section.

[0049] In this example, the orthopoxvirus monkeypox (Monkeypox, MP), smallpox (variola, VV), camel pox (Camelpox, CV), and rabbit pox (rabbitpox, RV) gene fragments are referenced from the crmB gene fragments of MP, VV, CV, and RV in the NCBI database, and MP1 fragments (308 bp, the sequence of which is shown in SEQ NO. 1), VV fragments (308 bp, the sequence of which is shown in SEQ NO. 2), CV1 fragments (305 bp, the sequence of which is shown in SEQ NO. 3), and RV fragments (271 bp, the sequence of which is shown in SEQ NO. 4) of part of the genes of MP, VV, CV, and RV are synthesized by Beijing Lihe Huada Gene Technology Co., Ltd., and are constructed into PMV vectors, named PMV-MP1, PMV-VV, PMV-CV1, and PMV-RV.

[0050] In this example, MIRA is used for amplification, and the MIRA amplification primers include SEQ NO. 8 to SEQ NO. 11, and the specific information is shown in Table 1.

[0051] Table 1. MIRA amplification primer sequences

[0052] SEQ name Prime name Prime sequence (5’-3’) SEQ NO. 8 MPoxL1 CGTGTGGTTCGGATACCTTTACATCTCAC SEQ NO. 9 MPoxR1 TGTTACACGATCGCGTCTCTACCTGATTACT SEQ NO. 10 MPoxL2 AATAAACGGAAGAGATATAGCACCACATGCAC SEQ NO. 11 MPoxR2 CAATAATATCCTGGAGAGCATTCACAGATTCT

[0053] The MP1 fragment, the VV fragment, the CV1 fragment and the RV fragment are amplified to obtain the samples to be detected (denoted as MP1, VV, CV1 and RV, respectively) according to the operation steps of the DNA constant temperature rapid amplification kit. The specific operation is as follows: the amplification uses a 50 μL system as shown in Table 2, but is not limited thereto, and contains the proportion adjustment of the corresponding components:

[0054] Table 2. MIRA amplification system

[0055] Ingredient Amount A buffer (already added to the dry powder tube mixed solvent) 29.4 μL MpoxL (1+2) (10 μM) 2 μL MPoxR (1+2) (10 μM) 2 μL DNA (1 ng / μL) 5 μL B buffer 2.5 μL ddH2O 9.1 μL

[0056] According to the system in Table 2, various components are sequentially added and uniformly mixed, and then reacted at 37 °C for 30 min to obtain the samples to be detected (MP1, VV, CV1 and RV) for subsequent nucleic acid detection.

[0057] 1.2 Design and preparation of monkeypox virus specific crRNA

[0058] The preparation of crRNA is carried out according to the following scheme. For the crmB gene fragments of MP, VV, CV and RV mentioned in 1.1, target sequences containing the CRISPR / Cas12a recognition sequence (PAM) TTTN are searched, and 20 nt length nucleotide sequences (guide sequences) are designed. In this example, three theoretically preferred nucleotide sequences are selected as the fragments for hybridization with target DNA in crRNA, which are the core part of crRNA. The final complete crRNA is named as crRNA1, crRNA2 and crRNA3, respectively, and the specific information is shown in Table 3.

[0059] Table 3. crRNA specific to monkeypox virus crmB gene region corresponding to the fragment hybridizable with target DNA

[0060] SEQ name Corresponding crRNA Corresponding fragment that can hybridize with target DNA (5’-3’) SEQ NO. 12 crRNA1 CAGGCUUGUCUAAGUUGUAA SEQ NO. 13 crRNA2 CAUCUCACAAUAAUCAUUUA SEQ NO. 14 crRNA3 CCCGCUUGUCUAAGUUGUAA

[0061] In this example, the final specific crRNA is obtained by in vitro transcription, so when preparing the specific crRNA, according to the sequence information in Table 3 above, the corresponding DNA sequence is first designed, and a T7 promoter sequence and a hairpin sequence adjacent thereto are added at the 5' end of each DNA sequence. The T7 promoter is located at the 5' end.

[0062] It should be noted that the promoter selected in this example is the T7 promoter, but other promoters can also be selected. The sequence of the T7 promoter is shown in SEQ NO. 24: SEQ NO. 24: CTAATACGACTCACTATAGGG.

[0063] Since Lbcas12a protein is used in subsequent examples, the hairpin structure sequence of the Lbcas12a related crRNA is shown in SEQ NO. 23 when designing specific crRNA in this example: SEQ NO. 23: UAAUUUCUACUAAGUGUAGAU.

[0064] According to the above sequence, DNA oligo is designed and synthesized by Beijing Liuhewadakai Genetech Co., Ltd., and target sequence related crRNAs are obtained by T7 promoter mediated in vitro transcription. Each crRNA (crRNA1, crRNA2 and crRNA3) finally obtained contains the same 5' end hairpin sequence and the respective nucleotide sequence that can be hybridized with the target DNA.

[0065] In this example, TranscriptAid T7High Yield Transcription Kit is used for in vitro transcription. 1 μL of 10×PCR Buffer, 4 μL of T7 promoter DNA, 4 μL of T7-crRNA, 1 μL of ddH2O are mixed uniformly, annealed at 95°C for 5 min, and placed at room temperature for 1 h. The obtained sample is subjected to the next step of in vitro transcription. The system used for in vitro transcription is shown in Table 4, but is not limited thereto, and contains the proportion adjustment of the corresponding components.

[0066] Table 4. crRNA in vitro transcription system

[0067] Ingredient Amount 5×TranscriptAid Reaction Buffer 2 μL TranscriptAid Enzyme Mix 1 μL dATP 1 μL dCTP 1 μL dUTP 1 μL dGTP 1 μL DNA 3 μL

[0068] After mixing the components uniformly, 37°C overnight, the obtained sample is subjected to the next step of RNA purification. RNA Clean & Concentrator-5 kit is used for crRNA purification and concentration, and the purified target crRNAs (crRNA1, crRNA2 and crRNA3) are obtained. Nanodrop2000 is used for RNA concentration determination, and finally stored at -20°C or -80°C.

[0069] 1.3 Fluorescent emitter fluorescence detection

[0070] Utilize the crRNAs (crRNA1, crRNA2 and crRNA3) obtained in 1.2 above and the test samples (MP1, VV, CV1, RV) prepared in 1.1, and perform fluorescence detection by fluorescent emitter. Various components are added to the detection system in sequence, and the components are mixed evenly and reacted at 37 ° C for 15 minutes. Among them, the CRISPR / Cas12a in the above reaction system is 1 μM, the ssDNA FQreporter concentration is 10 μM, and the crRNA (crRNA1, crRNA2, crRNA3) concentration is 1 μM. Among them, ssDNA FQreporter is: / 5FAM / TTATTATT / 3BHQ1 / . This test uses a 10 μL system as shown in Table 5, but is not limited thereto, including adjustments to the proportions of the corresponding components:

[0071] Table 5. Monkeypox virus CRISPR / Cas12a detection system

[0072] Ingredient Amount NEBuffer r2.1 (10X) 1 μL CRISPR / Cas12a (1 μM) 0.5 μL crRNA (1 μM) 0.5 μL DNA (to be tested sample) 1 μL ssDNA reporter (10 μM) 0.5 μL ddH2O 6.5 μL

[0073] After the reaction is complete, fluorescence detection is used to determine the activity of the CRISPR / Cas12a detection system. Specifically, a gel imager or a blue light gel exciter is used to detect the fluorescence of the reaction. After 8-15 minutes of reaction, observe whether there is fluorescence.

[0074] In this case, the detection results of different crRNAs targeting the crmB gene region of monkeypox virus are as follows: Figure 2 、 Figure 3 As shown in the figure, the test results of crRNA1-3 on different samples are shown, and the test samples are MP1 (monkeypox), CV1 (camelpox), VV (smallpox), RV (rabbitpox) and water (blank control). Among them, crRNA1 can specifically detect monkeypox virus (i.e. Figure 2 and 3 crRNA2 showed fluorescence responses to MP1, CV1, and VV, while crRNA3 did not show fluorescence responses to MP1 but did show fluorescence responses to CV1, VV, and RV. Therefore, crRNA2 and crRNA3 cannot specifically detect monkeypox virus.

[0075] Therefore, among the crRNAs designed in 1.2, only crRNA1 can detect monkeypox virus under the fluorescence emitter.

[0076] 1.4 Fluorescence detection by real-time quantitative PCR

[0077] The crRNA1 obtained by 1.2 above and the sample (MP1, VV, CV1, RV) prepared in 1.1 are subjected to real-time fluorescence quantitative PCR instrument fluorescence detection. Various components are sequentially added to the detection system, and after the components are uniformly mixed, detection is performed in a real-time fluorescence quantitative PCR instrument. Among them, the CRISPR / Cas12a in the above reaction system is 1 μM, the ssDNA FQ reporter concentration is 10 μM, and the crRNA1 concentration is 1 μM. Among them, the ssDNA FQ reporter is: / 5FAM / TTATTATT / 3BHQ1 / .

[0078] The fluorescence detection is used to determine the activity of the CRISPR / Cas12a detection system. The final fluorescence value is detected in a real-time fluorescence quantitative PCR instrument at 37°C for 30 min. The CRISPR / Cas12a detection of monkeypox virus is as shown in Figure 4 The crRNA1 only shows a high fluorescence value for MP1, and no fluorescence value for CV1, VV, RV and water. This example shows that the crRNA1 and the real-time fluorescence quantitative PCR result determination scheme can realize specific detection of monkeypox virus.

[0079] 1.5 Colloidal gold test strip detection

[0080] The crRNA1 obtained by 1.2 above is used for colloidal gold test strip detection of MP1 and CV1 samples prepared in 1.1 (blank control is water). Various components are sequentially added to the detection system, and after the components are uniformly mixed, reaction is carried out at 37°C for 15 min. Among them, the CRISPR / Cas12a in the above reaction system is 1 μM, the ssDNA DB reporter concentration is 10 μM, and the crRNA (crRNA1) concentration is 1 μM. Among them, the ssDNA DB reporter is: / 5 6FAM / TTATTATT / 3Biotin / .

[0081] The immunocolloidal gold test strip detection step in the present application is as follows: 100 μL of colloidal gold test strip buffer is added to an EP tube, 10 μL of the CRISPR / Cas12a cleavage product is added to the test strip, and then the test strip is immersed in the buffer, and the result is determined by the naked eye after reaction for 3 minutes, and photographed. The results are as shown in Figure 5 The lower quality control line shows color, but the upper detection line only shows color for the MP test strip, indicating that the crRNA1 and the colloidal gold detection test strip can realize rapid and specific detection of monkeypox virus.

[0082] Example Two: CRISPR / Cas12a detects monkeypox virus crmB gene region nucleic acid sensitivity

[0083] In the case of sensitivity detection, the PMV-MP1 plasmid prepared in 1.1 was converted to copy number according to molecular weight, and 10-fold gradient dilution was performed to obtain gradient dilution samples with different concentrations of 2x10 8 , 2x10 7 , 2x10 6 , 2x10 5 , 2x10 4 , 2x10 3 , 2x10 2 copies per microliter. 5 μL of the above different gradient dilution samples were subjected to MIRA amplification reaction: 29.4 μL A buffer (mixed with solvent in a dry powder tube), 2 μL MPoxL (1+2), 2 μL MPoxR (1+2), 2.5 μL B buffer and 9.1 μL ddH2O, mixed well, reacted at 37°C for 30 min, and the amplified samples were labeled for the next nucleic acid detection. The above amplification primers are the same as Table 1.

[0084] The detection system used in this example is 10 μL as shown in Table 6, but is not limited thereto, and includes adjustment of the proportion of the corresponding components:

[0085] Table 6. Monkeypox virus CRISPR / Cas12a detection system

[0086] Ingredient Amount NEBuffer r2.1 (10X) 1 μL CRISPR / Cas12a (1 μM) 0.5 μL crRNA1 (1 μM) 0.5 μL DNA 1 μL ssDNA FQ reporter (10 μM) 0.5 μL ddH2O 6.5 μL

[0087] In this example, the CRISPR / Cas12a detection system was used to determine the activity of the fluorescence detection. The real-time fluorescence quantitative PCR instrument was used to detect the fluorescence value at 37°C for 30 min. The detection results are shown in Figure 6 In this case, crRNA1 was used for CRISPR / Cas12a fluorescence detection of monkeypox virus nucleic acid, and high sensitivity detection of 2x10 2 copies of monkeypox virus was achieved.

[0088] Example Three: Rapid detection of monkeypox virus crmB gene region nucleic acid by amplification detection combination method

[0089] 3.1 Specificity detection of amplification detection combination method

[0090] In this example, amplification and detection are combined into one tube for reaction to achieve rapid detection of monkeypox virus. The detection system used in this example is 10 μL as shown in Table 7, but is not limited thereto, and includes adjustment of the proportion of the corresponding components. Among them, MPoxL and MPoxR in Table 7 are the same as Table 1 in 1.1 above, and ssDNA FQ reporter is the same as 1.3 above. DNA is: PMV-MP1, PMV-VV, PMV-CV1, PMV-RV.

[0091] Table 7. Monkeypox virus amplification detection combined method CRISPR / Cas12a detection system

[0092]

[0093]

[0094] In this example, the fluorescence detection is used to determine the activity of the CRISPR / Cas12a detection system. The components are mixed uniformly and reacted at 37°C for 30 min. A gel imager is used to detect the fluorescence of the reaction to observe whether fluorescence is generated. The detection results are shown in Figure 7 As shown in the table, only MP1 generates a fluorescence reaction, indicating that the crRNA1 can be used to achieve specific and rapid detection of monkeypox virus nucleic acid by the amplification detection combined method.

[0095] 3.2 Sensitivity detection of the amplification detection combined method

[0096] In the sensitivity detection, the PMV-MP1 plasmid prepared in 1.1 is converted to copy number according to the molecular weight, and is diluted by 10 times gradient to obtain different concentrations of gradient dilution samples containing 2 x 10 8 , 2 x 10 7 , 2 x 10 6 , 2 x 10 5 , 2 x 10 4 , 2 x 10 3 , 2 x 10 2 copies per microliter. The above different 1 μL gradient dilution samples are used for CRISPR / Cas12a detection reaction by the amplification detection combined method.

[0097] The detection uses a 10 μL system as shown in Table 8, but is not limited thereto, and includes adjustment of the proportion of the corresponding components.

[0098] Table 8. Monkeypox virus amplification detection combined method CRISPR / Cas12a detection system

[0099] Ingredient Amount NEBuffer r2.1 (10X) 1 μL CRISPR / Cas12a (1 μM) 0.25 μL crRNA1 (1 μM) 0.25 μL DNA 1 μL ssDNA FQ reporter (10 μM) 0.25 μL MPoxL (1+2) (10 μM) 0.2 μL MPoxR (1+2) (10 μM) 0.2 μL A buffer (mixed with dry powder in tube) 2.94 μL B buffer 0.5 μL ddH2O 3.41 μL

[0100] In this example, the fluorescence detection is used to determine the activity of the CRISPR / Cas12a detection system. The real-time fluorescence quantitative PCR instrument is used to detect the fluorescence value after 37°C reaction for 30 min. The detection results are shown in Figure 8 As shown in the table, only MP1 generates a fluorescence reaction, indicating that the crRNA1 can be used to achieve specific and rapid detection of monkeypox virus nucleic acid by the amplification detection combined method. 2 copies of monkeypox virus.

[0101] Example 4: Rapid and sensitive detection of monkeypox virus gene (46428-46723) nucleic acid fragment

[0102] 4.1 Preparation of nucleic acid

[0103] Through a large number of research and comparison, the present application selects the design of relevant specific crRNA for the monkeypox virus nucleic acid (46428-46723) fragment. In this example, according to the monkeypox virus gene (46428-46723) fragment, the BLAST tool of the NCBI database is used to download and find similar orthopoxvirus gene fragments, including monkeypox virus (Monkeypox virus), cowpox virus (Cowpox virus), vaccinia virus (Vaccinia virus), Orthopoxvirus Abatino, buffalopox virus (Buffalopox virus), rabbitpox virus (Rabbitpox virus), taterapox virus (Taterapox virus), Akhmeta virus (Akhmeta virus), camelpox virus (Camelpox virus), horsepox virus (Horsepox virus), variola virus (Variola virus), ectromelia virus (Ectromelia virus), raccoonpox virus (Raccoonpox virus), skunkpox virus (Skunkpox virus), etc. The downloaded fragment sequences are subjected to multiple sequence analysis using CLUSTAL O (1.2.4) software (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ), and the analysis results are shown in Table 1. Figure 9 Then, according to the above multiple sequence alignment results, the conserved section is selected for isothermal amplification primer design, and the specific cRNA is designed for the variable section.

[0104] In this example, the orthopoxvirus monkeypox (Monkeypox, MP), cowpox (Cowpox, CV), and ectromelia (Ectromelia, EV) gene fragments are reference fragments similar to the monkeypox virus gene (46428-46723) in the NCBI database. MP2 fragment (296bp, its sequence is shown in SEQ NO. 5), CV2 fragment (298bp, its sequence is shown in SEQ NO. 6), and EV (298bp, its sequence is shown in SEQ NO. 7) of part of the genes of MP, CV, and EV synthesized by Beijing Lihe Huada Gene Technology Co., Ltd. are constructed into PMV vectors, named PMV-MP2, PMV-CV2, and PMV-EV.

[0105] In this example, MIRA is used for amplification, and the MIRA amplification primers include SEQ NO. 15 to SEQ NO. 18, and the specific information is shown in Table 9.

[0106] Table 9. MIRA amplification primer sequence

[0107] SEQ name Prime name Prime sequence (5'-3') SEQ NO. 15 MPL1 ACCATAGCACTACGTTGAAGATCATACAGA SEQ NO. 16 MPR1 TAGATGACGGGTTAATCAGAGCTACATTCG SEQ NO. 17 MPL2 CAGAGCTTTATTAACTTCTCGCTTCTCCAT SEQ NO. 18 MPR2 CTACATTCGATAGGAACGACGAACCACCAG

[0108] According to the DNA constant temperature rapid amplification kit operation steps, the above MP2 fragment, CV2 fragment and EV fragment are amplified to obtain the sample to be detected (MP2, CV2 and EV, respectively).

[0109] The specific operation is as follows: the amplification in this example uses a 50 μL system as shown in Table 10, but is not limited thereto, and includes adjustment of the proportion of the corresponding components:

[0110] Table 10. MIRA amplification system

[0111] Ingredient Amount A buffer (mixed with dry powder in tube) 29.4 μL MPL (1+2) (10 μM) 2 μL MPR (1+2) (10 μM) 2 μL DNA (1 ng / μL) 5 μL B buffer 2.5 μL ddH2O 9.1 μL

[0112] According to the system in Table 10, various components are sequentially added and mixed uniformly, and the sample (MP2, CV2 and EV) is obtained at 37°C for 30 min for subsequent nucleic acid detection.

[0113] 4.2 Design and preparation of monkeypox virus gene (46428-46723) region specific crRNA

[0114] The specific crRNA is prepared according to the following scheme, and the targeting sequence containing the CRISPR / Cas12a recognition sequence (PAM) TTTN is searched for the MP, CV and EV gene fragments (46428-46723) region mentioned in 4.1 above, and a 20 nt length nucleotide sequence (the nucleotide sequence can specifically recognize the target DNA, and the guide sequence) is designed. In this example, four theoretically preferred nucleotide sequences are selected as the fragments in the crRNA for hybridization with the target DNA, which is the core part of the crRNA, and the corresponding final complete crRNA is named as crRNA4, crRNA5, crRNA6 and crRNA7, respectively, and the specific information is shown in Table 11.

[0115] Table 11. Monkeypox virus gene (46428-46723) region specific crRNA corresponding to the fragment hybridizable with the target DNA

[0116] SEQ name Corresponding crRNA Corresponding fragment hybridizable with target DNA (5'-3') SEQ NO. 19 crRNA4 AUAACCGCACACAAUCUCUG SEQ NO. 20 crRNA5 GAGAGAACUAACGCAACUAGCAA SEQ NO. 21 crRNA6 UUGCUAGUUGCGUUAGUUCUCUC SEQ NO. 22 crRNA7 AACGCUCGUCAAUAUAGAUCUUA

[0117] In this example, the final specific crRNA was obtained by in vitro transcription. According to the sequence information in Table 11 above, the corresponding DNA sequence was first designed, and a T7 promoter sequence and a hairpin sequence adjacent thereto were added at the 5' end of each DNA sequence. The T7 promoter is located at the 5' end.

[0118] It should be noted that the promoter selected in this example is a T7 promoter, but other promoters can also be selected. The sequence of the T7 promoter is shown in SEQ NO. 24: SEQ NO. 24: CTAATACGACTCACTATAGGG.

[0119] Since the Lbcas12a protein is used in subsequent examples, the hairpin structure sequence of the Lbcas12a-related crRNA is shown in SEQ NO. 23: SEQ NO. 23: UAAUUUCUACUAAGUGUAGAU when designing the crRNA in this example.

[0120] The DNA oligo was synthesized by Beijing Liuhewadagen Technology Co., Ltd. according to the above sequence, and the target sequence-related crRNAs were obtained by T7 promoter-mediated in vitro transcription. Each crRNA (crRNA4, crRNA5, crRNA6 and crRNA7) finally obtained contains the same 5' end hairpin sequence and the respective nucleotide sequence that can hybridize to the target DNA.

[0121] In this example, TranscriptAid T7High Yield Transcription Kit was used for in vitro transcription. 1 μL of 10x PCR Buffer, 4 μL of T7 promoter DNA, 4 μL of T7-crRNA, 1 μL of ddH2O were mixed uniformly, annealed at 95°C for 5 min, and placed at room temperature for 1 h. The obtained sample was subjected to the next step of in vitro transcription.

[0122] The system used for in vitro transcription is shown in Table 12, but is not limited thereto, and includes adjustment of the proportion of the corresponding components.

[0123] Table 12. crRNA in vitro transcription system

[0124] Ingredient Amount 5x TranscriptAid Reaction Buffer 2 μL TranscriptAid Enzyme Mix 1 μL dATP 1 μL dCTP 1 μL dUTP 1 μL dGTP 1 μL DNA 3 μL

[0125] After mixing the components uniformly, incubate at 37°C overnight, and then perform the next step of RNA purification. The RNA Clean & Concentrator-5 kit was used for crRNA purification, and the purified target crRNAs (crRNA4, crRNA5, crRNA6 and crRNA7) were obtained.

[0126] 4.3 Fluorescent emitter fluorescence detection

[0127] The crRNAs (crRNA4, crRNA5, crRNA6 and crRNA7) obtained by 4.2 above and the test sample (MP2, CV2, EV) prepared in 4.1 were subjected to fluorescence emitter fluorescence detection. Various components were added to the detection system in turn, and after the components were mixed evenly, the reaction was carried out at 37°C for 15 min. Among them, the CRISPR / Cas12a in the above reaction system was 1 μM, the ssDNA FQ reporter concentration was 10 μM, and the crRNA (crRNA4, crRNA5, crRNA6, crRNA7) concentration was 1 μM. Among them, the ssDNA FQ reporter is: / 5FAM / TTATTATT / 3BHQ1 / .

[0128] The present detection adopts a 10 μL system as shown in Table 13, but is not limited thereto, and contains the proportion adjustment of the corresponding components:

[0129] Table 13. Monkeypox virus CRISPR / Cas12a detection system

[0130] Ingredient Amount NEBuffer r2.1 (10X) 1 μL CRISPR / Cas12a (1 μM) 0.5 μL crRNA (1 μM) 0.5 μL DNA (sample to be tested) 1 μL ssDNA reporter (10 μM) 0.5 μL ddH2O 6.5 μL

[0131] After the reaction is completed, the CRISPR / Cas12a detection system detection activity is determined by fluorescence detection. Specifically, a gel imager or a blue light gel cutter is used to detect the fluorescence of the reaction, and after 8-15 min of reaction, whether fluorescence is generated is observed.

[0132] The detection results of different crRNAs in this example are shown in Figure 10 , Figure 11 The detection results of crRNA4-7 on different samples are included in the figure, and the detection samples are MP2, CV2, EV and water (blank control) respectively. Among them, crRNA6 has fluorescence reaction on MP2 and CV2, so crRNA6 cannot specifically detect monkeypox virus, while crRNA4, crRNA5 and crRNA7 only have fluorescence reaction on MP2 and can be further verified.

[0133] 4.4 Real-time fluorescence quantitative PCR instrument fluorescence detection

[0134] The crRNAs (crRNA4, crRNA5, crRNA6 and crRNA7) obtained by 4.2 above and the samples (MP2, CV2, EV) prepared in 4.1 are subjected to real-time fluorescence quantitative PCR instrument fluorescence detection. Various components are sequentially added to the detection system, and after the components are uniformly mixed, the detection is performed in the real-time fluorescence quantitative PCR instrument. Among them, the CRISPR / Cas12a in the above reaction system is 1 μM, the ssDNA FQ reporter concentration is 10 μM, and the crRNA (crRNA4, crRNA5, crRNA6, crRNA7) concentration is 1 μM. Among them, the ssDNA FQ reporter is: / 5FAM / TTATTATT / 3BHQ1 / .

[0135] The fluorescence detection is used to determine the activity of the CRISPR / Cas12a detection system. The detection fluorescence value is detected in the real-time fluorescence quantitative PCR instrument at 37°C for 30 min. The CRISPR / Cas12a detection of monkeypox virus is shown in Figure 12 The crRNA4 only shows a high fluorescence value for MP2, and no fluorescence value for CV2, EV and water, and the crRNA5, crRNA6 and crRNA7 have different degrees of fluorescence value in the samples other than MP2. Therefore, the crRNA5, crRNA6 and crRNA7 cannot specifically detect monkeypox virus, and only the crRNA4 can specifically detect monkeypox virus.

[0136] This example shows that the crRNA4 and the real-time fluorescence quantitative PCR result determination scheme can be used to achieve specific detection of monkeypox virus.

[0137] 4.5 Colloidal gold test strip detection

[0138] The crRNA4 obtained by 4.2 above and the samples (MP2, CV2) prepared in 4.1 are subjected to colloidal gold test strip detection (blank control is water). Various components are sequentially added to the detection system, and after the components are uniformly mixed, the reaction is performed at 37°C for 15 min. Among them, the CRISPR / Cas12a in the above reaction system is 1 μM, the ssDNA DB reporter concentration is 10 μM, and the crRNA (crRNA4) concentration is 1 μM. Among them, the ssDNA DB reporter is: / 5 6FAM / TTATTATT / 3Biotin / .

[0139] The detection steps of the immunocolloidal gold test strip in the present application are as follows: 100 μL of colloidal gold test strip buffer is added to an EP tube, 10 μL of CRISPR / Cas12a cleavage product is added to the test strip, and then the test strip is immersed in the buffer, and after 3 minutes of reaction, the result can be judged by the naked eye and photographed for record. The results are shown in Figure 13 As shown in the lower control line, the upper detection line only shows color for the MP test strip, indicating that the use of crRNA4 and colloidal gold detection test strip can achieve rapid and specific detection of monkeypox virus.

[0140] Example Five: CRISPR / Cas12a detection of monkeypox virus gene (46428-46723) region nucleic acid sensitivity

[0141] In the sensitivity detection case, the PMV-MP2 plasmid prepared in 4.1 is converted to copy number according to the molecular weight, and 10-fold gradient dilution is performed to obtain different concentrations of gradient dilution samples containing 2×10 8 , 2×10 7 , 2×10 6 , 2×10 5 , 2×10 4 , 2×10 3 , 2×10 2 copies per microliter (copy / μL). The above different 5 μL gradient dilution samples are subjected to MIRA amplification reaction: 29.4 μL A buffer (mixed with solvent in a dry powder tube), 2 μL MPL (1+2), 2 μL MPR (1+2), 2.5 μL B buffer and 9.1 μL ddH2O, mixed uniformly, reacted at 37°C for 30 min, and the amplified samples were labeled for the next step of nucleic acid detection. The above amplification primers are the same as Table 9.

[0142] The present detection uses a 10 μL system as shown in Table 14, but is not limited thereto, and includes adjustment of the proportion of the corresponding components:

[0143] Table 14. Monkeypox virus CRISPR / Cas12a detection system

[0144] Ingredient Amount NEBuffer r2.1 (10X) 1 μL CRISPR / Cas12a (1 μM) 0.5 μL crRNA4 (1 μM) 0.5 μL DNA 1 μL ssDNA FQ reporter (10 μM) 0.5 μL ddH2O 6.5 μL

[0145] In this example, the CRISPR / Cas12a detection system detection activity is determined by fluorescence detection. The real-time fluorescence quantitative PCR instrument is used to detect the fluorescence value after 37°C reaction for 30 min. The detection results are shown in Figure 14 As shown in the lower control line, the upper detection line only shows color for the MP test strip, indicating that the use of crRNA4 and colloidal gold detection test strip can achieve rapid and specific detection of monkeypox virus. 2 copies of monkeypox virus.

[0146] Example 6: Rapid detection of monkeypox virus gene (46428-46723) region nucleic acid by amplification detection combination method

[0147] 6.1 Specific detection of amplification detection combination method

[0148] This example is to combine amplification and detection into one tube for reaction, so as to realize rapid detection of monkeypox virus. The detection uses a 10 μL system as shown in Table 15, but not limited to this, including the proportion adjustment of the corresponding components: wherein, the MPL and MPR in Table 15 are the same as Table 9 in 4.1 above, and the ssDNA FQ reporter is the same as 4.3 above. The DNA is: PMV-MP2, PMV-CV2, PMV-EV.

[0149] Table 15. Monkeypox virus amplification detection combination method CRISPR / Cas12a detection system

[0150]

[0151]

[0152] In this example, the fluorescence detection is used to determine the activity of the CRISPR / Cas12a detection system. The components are mixed uniformly, and reacted at 37°C for 30 min. The gel imager is used for detecting the fluorescence of the reaction, and whether the fluorescence is generated is observed. The detection results are shown in Table 16, and only MP2 generates fluorescence reaction, indicating that the crRNA4 can realize specific rapid detection of monkeypox virus nucleic acid by amplification detection combination method. Figure 15

[0153] 6.2 Sensitivity detection of amplification detection combination method

[0154] In the sensitivity detection case, the PMV-MP2 plasmid prepared in 4.1 is converted to copy number according to the molecular weight, and is diluted by 10 times gradient to obtain different concentrations of gradient dilution samples containing 2×10 8 , 2×10 7 , 2×10 6 , 2×10 5 , 2×10 4 , 2×10 3 , 2×10 2 copies per microliter. The above different 1 μL gradient dilution samples are respectively subjected to CRISPR / Cas12a detection reaction by amplification detection combination method. The detection uses a 10 μL system as shown in Table 16, but not limited to this, including the proportion adjustment of the corresponding components.

[0155] ​Table 16. Monkeypox virus amplification detection combined method CRISPR / Cas12a detection system

[0156] Ingredient Amount NEBuffer r2.1 (10X) 1 μL CRISPR / Cas12a (1 μM) 0.25 μL crRNA4 (1 μM) 0.25 μL DNA 1 μL ssDNA FQ reporter (10 μM) 0.25 μL MPL (1+2) (10 μM) 0.2 μL MPR (1+2) (10 μM) 0.2 μL A buffer (mixed with the solvent in the dry powder tube) 2.94 μL B buffer 0.5 μL ddH2O 3.41 μL

[0157] In this example, the activity of the CRISPR / Cas12a detection system was determined by fluorescence detection. The real-time fluorescence quantitative PCR instrument was used to detect the fluorescence value after 37°C reaction for 60 min. The detection results are shown in Table 16. In this example, the amplification detection combined method CRISPR / Cas12a detection of monkeypox virus nucleic acid was carried out using crRNA4, which could realize the high sensitivity detection of 2x10 Figure 16 copies of monkeypox virus. 4 copies of monkeypox virus.

[0158] Example Seven: Monkeypox virus detection based on double target

[0159] 7.1 Specific detection of monkeypox virus based on double target

[0160] In this example, PMV-MP1 prepared in 1.1 and PMV-MP2 prepared in 4.1 were mixed at the same concentration and volume, and named as MPs; PMV-VV, PMV-CV1 and PMV-RV prepared in 1.1 were mixed with PMV-CV2 and PMV-EV prepared in 4.1 at the same concentration and volume, and named as Ex MPs; PMV-MP1, PMV-VV, PMV-CV1 and PMV-RV prepared in 1.1 were mixed with PMV-MP2, PMV-CV2 and PMV-EV prepared in 4.1 at the same concentration and volume, and named as Ex MPs+MPs.

[0161] In this example, MIRA was used for amplification, and the above MPs, Ex MPs and Ex MPs+MPs were amplified to obtain the samples to be detected according to the operation steps of the DNA constant temperature rapid amplification kit. The specific operation is as follows:

[0162] In this example, 50 μL system was used for amplification, but not limited to this, and the proportion of the corresponding components was adjusted as shown in Table 17:

[0163] Table 17. MIRA amplification system

[0164]

[0165]

[0166] According to the system in Table 17, various components were added in turn, mixed uniformly, and reacted at 37°C for 30 min to obtain samples (MPs, Ex MPs and Ex MPs+MPs) for subsequent nucleic acid detection.

[0167] Fluorescence detection was performed using the crRNA1 obtained in 1.2, the crRNA4 obtained in 4.2, and the prepared test samples (MPs, ExMPs, Ex MPs+MPs). Various components were added to the detection system in sequence, mixed evenly, and reacted at 37°C for 15 minutes. In the above reaction system, the concentration of CRISPR / Cas12a was 1μM, the concentration of ssDNA FQ reporter was 10μM, and the concentration of crRNA (crRNA1, crRNA4) was 1μM. The ssDNA FQ reporter was: / 5FAM / TTATTATT / 3BHQ1 / .

[0168] This test uses a 10 μL system as shown in Table 18, but is not limited thereto, including adjustments to the proportions of the corresponding components:

[0169] Table 18. Monkeypox virus CRISPR / Cas12a detection system

[0170] Ingredient Amount NEBuffer r2.1 (10X) 1 μL CRISPR / Cas12a (1 μM) 0.5 μL crRNA (1 μM) 0.5 μL DNA (1 ng / μL) 1 μL ssDNA reporter (10 μM) 0.5 μL ddH2O 6.5 μL

[0171] After the reaction is complete, fluorescence detection is used to determine the activity of the CRISPR / Cas12a detection system. Specifically, a gel imager or a blue light gel exciter is used to detect the fluorescence of the reaction. After 8-15 minutes of reaction, observe whether there is fluorescence.

[0172] The detection results of different crRNAs in this example are as follows Figure 17 、 Figure 18 The figure shows the detection results of crRNA1 and crRNA4 on different samples, including MPs, Ex MPs, Ex MPs + MPs, and water (blank control). The results show that crRNA1 and crRNA4 can be used for dual-target specific detection of monkeypox virus.

[0173] Using the crRNA1 obtained in 1.2 above, the crRNA4 obtained in 4.2, and the prepared test samples (MPs, ExMPs, Ex MPs+MPs), real-time fluorescence quantitative PCR fluorescence detection was performed. Various components were added to the detection system in sequence, and after each component was evenly mixed, it was detected in a real-time fluorescence quantitative PCR instrument. Among them, the CRISPR / Cas12a in the above reaction system was 1 μM, the ssDNA FQ reporter concentration was 10 μM, and the crRNA (crRNA1, crRNA4) concentration was 1 μM. Among them, the ssDNA FQ reporter is: / 5FAM / TTATTATT / 3BHQ1 / .

[0174] The activity of the CRISPR / Cas12a detection system was determined by fluorescence detection. The fluorescence value was detected in a real-time fluorescence quantitative PCR instrument at 37°C for 30 min. The CRISPR / Cas12a detection of monkeypox virus is shown in Table 9. This example shows that the use of crRNA1 and crRNA4 and the use of real-time fluorescence quantitative PCR results to determine the scheme can achieve specific detection of double target points of monkeypox virus. Figure 19

[0175] 7.2 Nucleic acid sensitivity of monkeypox virus based on double target points

[0176] In the sensitivity detection case, the MP plasmid prepared in 7.1 was converted to copy number according to the molecular weight, and was diluted by 10 times gradient to obtain gradient dilution samples containing 2x10 8 , 2x10 7 , 2x10 6 , 2x10 5 , 2x10 4 copies per microliter (copy / μL). The above different 5 μL gradient dilution samples were subjected to MIRA amplification reaction: 29.4 μL A buffer (mixed with solvent in a dry powder tube), 2 μL MPL (1+2), 2 μL MPR (1+2), 2 μL MPoxL (1+2), 2 μL MPoxR (1+2), 2.5 μL B buffer and 5.1 μL ddH2O, mixed uniformly, reacted at 37°C for 30 min, and the samples after amplification were labeled for the next nucleic acid detection. The above amplification primers are the same as Table 1, Table 9.

[0177] The detection uses a 10 μL system as shown in Table 19, but is not limited thereto, and includes adjustment of the proportion of the corresponding components:

[0178] Table 19. Monkeypox virus CRISPR / Cas12a detection system

[0179]

[0180]

[0181] In this example, the activity of the CRISPR / Cas12a detection system was determined by fluorescence detection. The fluorescence value was detected in a real-time fluorescence quantitative PCR instrument at 37°C for 30 min. The detection results are shown in Table 9, and in this case, the use of crRNA1 and crRNA4 for CRISPR / Cas12a fluorescence detection of double target points of monkeypox virus can achieve high sensitivity detection of 2x10 4 copies of monkeypox virus. Figure 20 Figure 21 ​​​

[0182] 7.3 Dual-target amplification detection of monkeypox virus combined with specific detection

[0183] For example, amplification and detection can be combined into one reaction tube to achieve rapid detection of monkeypox virus. This test uses a 10 μL system as shown in Table 20, but is not limited to this, including adjustments to the proportions of the corresponding components:

[0184] In Table 20, MPL, MPR, MPoxL, and MPoxR are the same as those in Tables 1 and 9 above. The crRNAs are crRNA1 and crRNA4 in 7.1 above. The ssDNA FQ reporter is the same as in 7.1 above. DNA is: MPs and Ex MPs.

[0185] Table 20. Monkeypox virus amplification detection combined with CRISPR / Cas12a detection system

[0186] Ingredient Amount NEBuffer r2.1 (10X) 1 μL CRISPR / Cas12a (1 μM) 0.25 μL crRNA (1 μM) 0.25 μL DNA (1 ng / μL) 1 μL ssDNA FQ reporter (10 μM) 0.25 μL MPL (1+2) (10 μM) 0.2 μL MPR (1+2) (10 μM) 0.2 μL MPoxL (1+2) (10 μM) 0.2 μL MPoxR (1+2) (10 μM) 0.2 μL A buffer (mixed with the solvent in the dry powder tube) 2.94 μL B buffer 0.5 μL ddH2O 3.01 μL

[0187] In this example, fluorescence detection was used to determine the activity of the CRISPR / Cas12a detection system. All components were mixed evenly and reacted at 37°C for 30 minutes. A gel imager was used to detect the fluorescence of the reaction and observe whether fluorescence was generated. The test results are as follows: Figure 22 As shown, fluorescence reaction was only generated in MPs, indicating that the use of crRNA1 and crRNA4 can achieve specific and rapid detection of dual-target monkeypox virus nucleic acid through amplification detection combined method.

[0188] The above examples are used to illustrate the present invention, which are only used to help understand the present invention and are not intended to limit the present invention. Those skilled in the art can make several simple deductions, modifications or substitutions based on the concept of the present invention.

Claims

1. A crRNA for monkeypox virus nucleic acid detection, characterized in that The nucleotide sequence in the crRNA that hybridizes with the target DNA is as shown in SEQ NO.12 or SEQ NO.

19.

2. The crRNA according to claim 1, wherein The 5' end of the crRNA contains a hairpin sequence.

3. The crRNA according to claim 2, wherein The hairpin sequence is shown in SEQ NO.

23.

4. A monkeypox virus nucleic acid detection kit, characterized in that: The kit includes crRNA for monkeypox virus nucleic acid detection, and the crRNA includes: The nucleotide sequence hybridizing with the target DNA is crRNA as shown in SEQ NO.12; and / or, The nucleotide sequence that hybridizes with the target DNA is crRNA as shown in SEQ NO.

19.

5. The monkeypox virus nucleic acid detection kit according to claim 4, wherein The 5' end of the crRNA contains a hairpin sequence.

6. The monkeypox virus nucleic acid detection kit according to claim 5, wherein The hairpin sequence is shown as SEQ NO.

23.

7. The monkeypox virus nucleic acid detection kit according to any one of claims 4 to 6, wherein The kit also includes CRISPR / Cas12a protein.

8. The monkeypox virus nucleic acid detection kit according to claim 7, wherein The CRISPR / Cas12a protein is LbCas12a protein.

9. The monkeypox virus nucleic acid detection kit according to any one of claims 4 to 6, wherein The kit also includes specific amplification primers for monkeypox virus genes.

10. The monkeypox virus nucleic acid detection kit according to claim 9, wherein The specific amplification primers for the monkeypox virus gene include specific amplification primers for the monkeypox virus crmB gene region and / or for the monkeypox virus gene 46428-46723 region.

11. The monkeypox virus nucleic acid detection kit according to claim 10, wherein The specific amplification primers for the monkeypox virus crmB gene region include: MPoxL1 and MPoxR1, whose sequences are shown in SEQ NO.8 and SEQ NO.9 respectively; and / or The sequences of MPoxL2 and MPoxR2 are shown in SEQ NO.10 and SEQ NO.11, respectively.

12. The monkeypox virus nucleic acid detection kit according to claim 10, wherein The specific amplification primers for the monkeypox virus gene 46428-46723 region include: MPL1 and MPR1, whose sequences are shown in SEQ NO.15 and SEQ NO.16 respectively; and / or The sequences of MPL2 and MPR2 are shown in SEQ NO. 17 and SEQ NO. 18, respectively.

13. The monkeypox virus nucleic acid detection kit according to any one of claims 4 to 6, wherein The kit also includes a single-stranded DNA reporter system.

14. The monkeypox virus nucleic acid detection kit according to claim 13, wherein The single-stranded DNA reporter system includes ssDNA FQ reporter or ssDNA DB reporter.

15. The monkeypox virus nucleic acid detection kit according to claim 14, wherein The ssDNAFQreporter is ssDNA labeled with carboxyfluorescein and a fluorescence quencher, and the labeled product is / 5FAM / TTATTATT / 3BHQ1 / ; the ssDNA DB reporter is ssDNA labeled with 6-carboxyfluorescein and biotin, and the labeled product is / 5 6FAM / TTATTATT / 3Biotin / .

16. A method for preparing crRNA according to any one of claims 1 to 3, comprising: Targeting the monkeypox virus crmB gene region and / or the monkeypox virus gene 46428-46723 region, searching for a targeting sequence containing the CRISPR / Cas12a recognition sequence, designing a nucleotide sequence of 20-23 nt in length, and obtaining the crRNA by in vitro transcription or synthesis.

Images