Double crRNA-CRISPR-Cas13a system established by using ERASE test paper and used for on-site detection of rifampicin resistance of mycobacterium tuberculosis

Abstract

The invention discloses a CRISPR-Cas13a (clustered regularly interspaced short palindromic repeats-CRISPR-Cas13a) double crRNA (ribonucleic acid) system which is established by using ERASE test paper and is used for detecting the rifampicin resistance of mycobacterium tuberculosis on site. The CRISPR-Cas13a double crRNA-system comprises a Cas13a protein and crRNA, or a complex formed by the Cas13a protein and the crRNA; the crRNA comprises an anchoring sequence and a guide sequence; the anchoring sequence is used for being combined with Cas13a protein; the guide sequence is used for targeting mutation target sequences of sites 531, 526, 516 and 513 in a mycobacterium tuberculosis drug-resistant gene rpoB gene; the target sequence of the mycobacterium tuberculosis is located at the 2317th site to the 2597th site of the rifampicin drug-resistant gene rpoB. On the basis of a CRSPR-Cas13a nucleic acid detection technology, result interpretation is performed through RAA amplification in combination with a line elimination method (ERASE) lateral flow chromatography test paper, and experiments prove that the kit can target high-frequency mutation sites of four rifampicin drug-resistant genotypes at the same time, has good detection sensitivity and specificity, and can be used for detecting the rifampicin drug-resistant genotypes of the rifampicin drug-resistant genotypes of the rifampicin drug-resistant genotypes of the rifampicin drug-resistant genotypes. The method can realize rapid, efficient, simple and convenient detection of mycobacterium tuberculosis rifampicin drug-resistant nucleic acid, has a sensitivity of 10 copies / [mu] L, and has an important application value.

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic technology, specifically relating to a dual crRNA-CRISPR-Cas13a system for on-site detection of rifampicin resistance in Mycobacterium tuberculosis using ERASE test strips. Background Technology

[0002] Tuberculosis (TB) is a major infectious disease caused by Mycobacterium tuberculosis, primarily affecting the respiratory system. Symptoms include persistent cough, hemoptysis, and chest pain; in severe cases, it can lead to difficulty breathing and even death. However, immunological testing cannot definitively identify individuals infected with live MTB. If ordinary TB is not treated promptly and accurately, it can easily become chronic or develop drug resistance, eventually leading to a lack of treatment options and the individual becoming a source of infection for drug-resistant TB, infecting others. The 2024 Global Tuberculosis Report indicated that in 2023, an estimated 10.8 million people worldwide had TB, of whom 400,000 had multidrug-resistant (rifampicin and isoniazid resistant) or rifampicin-resistant TB, with 1.25 million deaths globally.

[0003] rpoB Gene mutations can alter the structure of the RNA polymerase β subunit, thereby hindering rifampin binding and leading to drug resistance. 96% of these mutations occur at sites 507-533 of the rpob gene, with mutations at sites 513, 516, 526, and 531 accounting for 70%-90% of all rpob mutations. In China, S531L, H526Y, and D516V are the main contributors, while Q513L has a smaller but still significant impact. Rifampin-resistant tuberculosis (RR-TB) is a key marker of multidrug-resistant tuberculosis (MDR-TB). Approximately 90% of rifampin-resistant patients also exhibit isoniazid resistance (Hr-TB), and this dual resistance constitutes a characteristic of MDR-TB. Given that rifampin is a core first-line drug for tuberculosis treatment, the emergence of resistance complicates treatment regimens, leading to prolonged treatment duration and increased mortality, with MDR-TB-related mortality rates reaching 30% to 50%. Summary of the Invention

[0004] To address the technical problems existing in the prior art, this invention provides a dual crRNA-CRISPR-Cas13a system for on-site detection of rifampicin resistance in Mycobacterium tuberculosis using ERASE test strips. This invention leverages the advantages of RAA-based detection technology, which is simple to operate, stable, and widely used in clinical molecular diagnostics. By combining RAA technology with CRISPR based on the Cas13a protein, and through design, construction, and screening, a crRNA targeting sites 531, 526, 516, and 513 is ultimately provided to activate the CRISPR-Cas13a system. The RAA-CRISPR system constructed using this target can specifically detect rifampicin resistance gene mutation sites.

[0005] To achieve the above objectives, this invention is based on the principles of the CRISPR-Cas13a system and the selection principles of target sequences, and is formulated according to the 531, 526, 516, and 513 sites and the corresponding wild-type... rpoB Four crRNAs were designed based on the gene sequences, and the crRNA with the best activation effect on the CRISPR-Cas13a system was selected for mutation detection at sites 531, 526, 516, and 513.

[0006] According to a first aspect of the technical solution of the present invention, the present invention provides a dual crRNA-CRISPR-Cas13a system for on-site detection of rifampicin resistance in Mycobacterium tuberculosis using ERASE test strips, the system comprising a1) or a2): a1) RAA primer pair, Cas13a protein and crRNA; a2) The RAA primer pair and complex; the complex is formed by the Cas13a protein and the crRNA; The crRNA includes an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting mutations at sites 531, 526, 516, and 513. The target sequence of the rifampicin resistance gene wild-type is located at rpoB The target sequences at positions 2317-2597 of the gene (GenBank ID: NC_414012.1); the target sequences at positions 531, 526, 516, and 513 are located in... rpoB The gene (GenBank ID: NC_414012.1) is located at positions 2317-2597, and the sequence is as follows: 531: CAC→TAC; 526: TCG→TTG; 516: GAC→GTC; 513: CAA→AAA.

[0007] The RAA primer pair consists of single-stranded DNA molecules shown in SEQ ID No. 10 and SEQ ID No. 12, and is used to specifically amplify target sequences with mutations at sites 531, 526, 516, and 513.

[0008] In the aforementioned CRISPR-Cas13a system, the wild-type target sequence of the rifampicin resistance gene is SEQ ID No. 1.

[0009] In the aforementioned CRISPR-Cas13a system, the crRNA sequence is SEQ ID No. 8. Specifically, positions 1-38 of SEQ ID No. 8 are the anchoring sequence for binding to the Cas13a protein; positions 39-66 of SEQ ID No. 8 are the targeting sequence. rpoB Guide sequences for gene mutation site target sequences.

[0010] In the aforementioned CRISPR-Cas13a system, the Cas13a protein is the LwCas13a protein.

[0011] A second objective of this invention is to provide a kit for detecting rifampicin resistance.

[0012] The kit for detecting rifampicin resistance provided by this invention includes the system described above for detecting rifampicin resistance.

[0013] Furthermore, the kit also includes other reagents for specifically amplifying the target sequences of mutations at sites 531, 526, 516, and 513, and other reagents for detecting the amplification products. The other reagents for specifically amplifying the target sequences of mutations at sites 531, 526, 516, and 513 include buffer and / or enzyme-free water; the other reagents for detecting the amplification products include all or some of the following: NTPs (such as NTPMix), T7 RNA polymerase, RNase inhibitors, fluorescent and test strip reporter RNA (reporter RNA is an RNA molecule with signal reporting function), and RNase-free water.

[0014] The kit may also include a carrier containing the following judgment criteria A or judgment criteria B: CRISPR-Cas13a fluorescence detection system judgment criterion A: For the detection of mutations at sites 531, 526, 516, and 513, if the fluorescence intensity values ​​of the detection system for mutations at sites 531, 526, 516, and 513 in the test sample are significantly different from those of the wild-type detection system and the negative control (enzyme-free water) within the same detection time (P<0.5), then the test sample contains or is a candidate for containing rifampicin resistance; otherwise, the test sample does not contain or is a candidate for not containing rifampicin resistance.

[0015] CRISPR-Cas13a test strip system judgment standard B: After the reaction of the detection system, drop the product obtained into the sample well of the test strip, let it stand for 2-5 minutes, and then interpret it. If no "T" line appears on the test strip but a "C" line appears, the sample to be tested contains or is a candidate for containing rifampicin resistance; if both a "T" line and a "C" line appear on the test strip, the sample to be tested does not contain or is a candidate for not containing rifampicin resistance; if no "C" line appears on the test strip, the test strip is invalid and needs to be replaced and the experiment repeated.

[0016] A third objective of this invention is to provide any of the following applications: B1) The use of any of the systems, kits, or RAA primer pairs described above in the detection or auxiliary detection of rifampicin resistance; B2) The use of any of the systems, kits, or RAA primer pairs described above in the preparation of products for detecting or assisting in the detection of rifampicin resistance; B3) The application of any of the above-described systems, kits, or RAA primer pairs in detecting or assisting in the detection of rifampicin resistance in a sample to be tested; B4) The use of any of the above-described systems, kits, or RAA primer pairs in the preparation of products for detecting or assisting in the detection of rifampicin resistance in test samples; B5) The use of any of the systems, kits or RAA primer pairs described above in screening or assisting in screening drugs for the prevention and treatment of rifampicin resistance; B6) The use of any of the above-described systems, kits, or RAA primer pairs in the preparation of products for screening or assisting in the screening of drugs for the prevention and treatment of rifampicin resistance; B7) Application of the RAA primer pair in the preparation of the above kit.

[0017] The final objective of this invention is to provide a method for detecting or assisting in the detection of rifampicin resistance.

[0018] The method for detecting or assisting in the detection of rifampicin resistance provided by this invention includes the following steps: C1) Using the nucleic acid of the sample to be tested as a template, RAA amplification is performed using primer pairs composed of single-stranded DNA molecules as shown in sequences 1, 2, 3, 4, 5, 6, and 7 to obtain RAA amplification products; C2) Prepare the detection system and then perform fluorescence detection; the detection system includes the RAA amplification product, any of the above-mentioned Cas13a protein, any of the above-mentioned crRNA, reporter RNA, NTP Mix, T7 RNA polymerase, and RNase inhibitor; and use enzyme-free water instead of the RAA amplification product as a negative control. C3) Detect the fluorescence intensity of the detection system. Determine whether the sample contains sites 531, 526, 516, and 513 based on the fluorescence intensity: If the fluorescence intensity of the sample detection system is significantly different from that of the negative control within the same detection time (P<0.5), the sample contains or is a candidate for rifampicin resistance; otherwise, the sample does not contain or is a candidate for rifampicin resistance. Alternatively, in test strip detection, the following method can be used: After the reaction of the detection system, drop the product into the sample well of the test strip, let it stand for 2-5 minutes, and then interpret the result. If no "T" line appears on the test strip but a "C" line appears, the sample contains or is a candidate for rifampicin resistance; if both a "T" line and a "C" line appear on the test strip, the sample does not contain or is a candidate for rifampicin resistance; if no "C" line appears on the test strip, the test strip is invalid and needs to be replaced and the experiment repeated.

[0019] Furthermore, in step C1), the reaction conditions for RAA amplification are: 39-42℃, 20-40 min.

[0020] Furthermore, in step C3), the reaction conditions are: 37°C, fluorescence intensity value is read every 1-2 minutes, for more than 30 readings.

[0021] The sample to be tested mentioned above may be a sputum sample, bronchoalveolar lavage fluid, blood sample, urine, organ (such as liver, spleen, kidney, etc.) tissue sample, cell, etc.

[0022] The method for detecting or assisting in the detection of rifampicin resistance provided by this invention can be used as both a non-disease diagnosis and treatment method and a disease diagnosis and treatment method. Specifically, the non-disease diagnosis and treatment method can, for example, detect the presence of rifampicin in cells before and after drug administration when screening for rifampicin resistance prevention and treatment drugs at the cellular level. rpoB Gene mutation sites.

[0023] In any of the systems, kits, RAA primer pairs, applications, or methods described above, the 531, 526, 516, and 513 sites can be various Mycobacterium tuberculosis species. rpoB Mutation sites in genes, such as H37Ra and H37Rv. In a specific embodiment of the present invention, sites 531, 526, 516, and 513 are from the MTB wild-type strain. rpoB Mutated genes at positions 531, 526, 516, and 513 constructed from the gene (GenBank ID: NC_414012.1).

[0024] Compared with the prior art, the present invention has the following beneficial effects: This study, based on the CRISPR-Cas13a nucleic acid detection technology, combined with RAA isothermal amplification technology and ERASE test strips, established a field nucleic acid detection technology for rifampicin-resistant tuberculosis. It can achieve single-reaction detection of four mutation sites (531, 526, 516, and 513 sites) using dual crRNA, and can identify DNA templates of 10 copies / μL within 1 hour using a visual test strip method. In establishing rifampicin resistance detection, since mutation at any one of the four sites indicates rifampicin resistance, designing wild-type and mutant crRNAs for each of the four sites and constructing detection systems separately is complex and costly. In contrast, the method of this invention can determine whether a mutation has occurred in a single reaction, and has high specificity, capable of distinguishing mutations below 10 copies / μL. 3 Wild-type and mutant templates at concentrations of copies / μL. This invention has significant application value. Attached Figure Description

[0025] Figure 1 The results of screening three pairs of candidate RAA primers using CRISPR fluorescence method (fluorescence image).

[0026] Figure 2 The results of screening three pairs of candidate RAA primers using CRISPR fluorescence method (bar chart).

[0027] Figure 3 The results of screening three pairs of candidate RAA primers using CRISPR fluorescence method (heatmap).

[0028] Figure 4 The screening results for four crRNAs at positions 531 & 526 (30 min).

[0029] Figure 5 The screening results for four crRNAs with mismatched bases at positions 531 & 526 (30 min).

[0030] Figure 6 The screening results for four crRNAs at sites 516 and 513 (30 min).

[0031] Figure 7 The screening results for four crRNAs with mismatched bases at sites 516 & 513 (30 min).

[0032] Figure 8 Sensitivity results for detecting mutations at 526 sites using the CRISPR-Cas13a dual crRNA system (fluorescence image).

[0033] Figure 9 Sensitivity results for detecting mutations at 526 sites using the CRISPR-Cas13a dual crRNA system (test strip image).

[0034] Figure 10 Sensitivity results for detecting mutations at site 531 using the CRISPR-Cas13a dual crRNA system (fluorescence image).

[0035] Figure 11 Sensitivity results for detecting mutations at site 531 using the CRISPR-Cas13a dual crRNA system (test strip image).

[0036] Figure 12 Sensitivity results for detecting mutations at site 516 using the CRISPR-Cas13a dual crRNA system (fluorescence image).

[0037] Figure 13 Sensitivity results for detecting mutations at site 516 using the CRISPR-Cas13a dual crRNA system (test strip image).

[0038] Figure 14 Sensitivity results for detecting mutations at site 513 using the CRISPR-Cas13a dual crRNA system (fluorescence image).

[0039] Figure 15 Sensitivity results for detecting mutations at site 513 using the CRISPR-Cas13a dual crRNA system (test strip image).

[0040] Figure 16 Sensitivity results (fluorescence image) for detecting mutations at sites 531+526 using the CRISPR-Cas13a dual crRNA system.

[0041] Figure 17 Sensitivity results for detecting mutations at sites 531+526 using the CRISPR-Cas13a dual crRNA system (test strip image).

[0042] Figure 18 Sensitivity results (fluorescence image) for detecting mutations at the 516+513 site using the CRISPR-Cas13a dual crRNA system.

[0043] Figure 19 Sensitivity results for detecting mutations at the 516+513 site using the CRISPR-Cas13a dual crRNA system (test strip image).

[0044] Figure 20 Sensitivity and positive control results for detecting wild-type plasmids using the CRISPR-Cas13a double crRNA system (test strip image). Detailed Implementation

[0045] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0046] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0047] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0048] The reagents and their sources involved in the following examples are as follows: NTPMix (Beyotime), 2*Super PFXMaster Mix (CWBIO), LwCas13a protein (GenScript), HOLMES ssRNA reporter (TOLOBIO), T7 Quick High Yield RNA Synthesis Kit (NEB), Murine RNase inhibitor (Vazyme), T7 RNA polymerase (NEB), RNA purification magnetic beads (Vazyme), isopropanol (Shanghai Guoyao Hushi), anhydrous ethanol (Shanghai Guoyao Hushi), chloroform (Shanghai Guoyao Hushi), Tris balanced phenol (Solarbio), DNA isothermal rapid amplification kit - basic type (Anpu Future), fluorescent RNA (Tulugang), test strip reporter RNA (Tianyi Huiyuan), HEPES buffer (gibco), MgCl solution (Invitrogen), RNase free water (Beyotime), CRISPR test strip (Hangzhou Zhongce).

[0049] Example 1: Design and preparation of crRNA and PCR primers used in this invention 1. The crRNA design and preparation used in this invention (I) Preparation of plasmid standards.

[0050] 1. Plasmid sequence.

[0051] rpoB -WT is derived from the following rifampicin resistance gene. rpoBThe wild-type sequence tcaacatccggccggtggtcgccgcgatcaaggagttcttcggcaccagccagctgagccaattcatggaccagaacaacccgctgtcggggttgacccacaagcgccgactgtcggcgctggggcccggcggtctgtcacgtgagcgtgccgggctggaggtccgcgacgtgcacccgtcgcactacggccggatgtgcccgatcgaaacccctgaggggcccaacatcggtctgatcggctcgctgtcggtgtacgcgcgggtcaacccgttcgggtt (SEQ ID No. 1) was inserted into the pUC57 vector and purified (Beijing Bomaide Gene Technology Co., Ltd.) to obtain the plasmid. rpoB -WT.

[0052] rpoB -531 refers to the following genes derived from rifampicin resistance. rpoB The mutant sequence at position 531, tcaacatccggccggtggtcgccgcgatcaaggagttcttcggcaccagccagctgagccaattcatggaccagaacaacccgctgtcggggttgacccacaagcgccgactgttggcgctggggcccggcggtctgtcacgtgagcgtgccgggctggaggtccgcgacgtgcacccgtcgcactacggccggatgtgcccgatcgaaacccctgaggggcccaacatcggtctgatcggctcgctgtcggtgtacgcgcgggtcaacccgttcgggtt (SEQ ID No. 2), was inserted into the pUC57 vector and purified (Beijing Bomaide Gene Technology Co., Ltd.) to obtain the plasmid. rpoB -531.

[0053] rpoB -526 is derived from the following rifampicin resistance gene. rpoBThe mutant sequence at position 526, tcaacatccggccggtggtcgccgcgatcaaggagttcttcggcaccagccagctgagccaattcatggaccagaacaacccgctgtcggggttgacctacaagcgccgactgtcggcgctggggcccggcggtctgtcacgtgagcgtgccgggctggaggtccgcgacgtgcacccgtcgcactacggccggatgtgcccgatcgaaacccctgaggggcccaacatcggtctgatcggctcgctgtcggtgtacgcgcgggtcaacccgttcgggtt (SEQ ID No. 3), was inserted into the pUC57 vector and purified (Beijing Bomaide Gene Technology Co., Ltd.) to obtain the plasmid. rpoB -531.

[0054] rpoB -516 is derived from the following rifampicin resistance gene. rpoB The 516 mutant sequence tcaacatccggccggtggtcgccgcgatcaaggagttcttcggcaccagccagctgagccaattcatggtccagaacaacccgctgtcggggttgacccacaagcgccgactgtcggcgctggggcccggcggtctgtcacgtgagcgtgccgggctggaggtccgcgacgtgcacccgtcgcactacggccggatgtgcccgatcgaaacccctgaggggcccaacatcggtctgatcggctcgctgtcggtgtacgcgcgggtcaacccgttcgggtt (SEQ ID No. 4) was inserted into the pUC57 vector and purified (Beijing Bomaide Gene Technology Co., Ltd.) to obtain the plasmid. rpoB -531.

[0055] rpoB -513 is derived from the following rifampicin resistance gene. rpoBThe 513 mutant sequence tcaacatccggccggtggtcgccgcgatcaaggagttcttcggcaccagccagctgagcaaattcatggaccagaacaacccgctgtcggggttgacccacaagcgccgactgtcggcgctggggcccggcggtctgtcacgtgagcgtgccgggctggaggtccgcgacgtgcacccgtcgcactacggccggatgtgcccgatcgaaacccctgaggggcccaacatcggtctgatcggctcgctgtcggtgtacgcgcgggtcaacccgttcgggtt (SEQ ID No. 5) was inserted into the pUC57 vector and purified (Beijing Bomaide Gene Technology Co., Ltd.) to obtain the plasmid. rpoB -531.

[0056] rpoB -531 & 526 are derived from the following rifampicin resistance genes. rpoB The 531+526 mutant sequence tcaacatccggccggtggtcgccgcgatcaaggagttcttcggcaccagccagctgagccaattcatggaccagaacaacccgctgtcggggttgacctacaagcgccgactgttggcgctggggcccggcggtctgtcacgtgagcgtgccgggctggaggtccgcgacgtgcacccgtcgcactacggccggatgtgcccgatcgaaacccctgaggggcccaacatcggtctgatcggctcgctgtcggtgtacgcgcgggtcaacccgttcgggtt (SEQ ID No. 6) was inserted into the pUC57 vector and purified (Beijing Bomaide Gene Technology Co., Ltd.) to obtain the plasmid. rpoB -31&526.

[0057] rpoB -513 & 516 are derived from the following rifampicin resistance genes. rpoBThe 513+516 mutant sequence tcaacatccggccggtggtcgccgcgatcaaggagttcttcggcaccagccagctgagcaaattcatggtccagaacaacccgctgtcggggttgacccacaagcgccgactgtcggcgctggggcccggcggtctgtcacgtgagcgtgccgggctggaggtccgcgacgtgcacccgtcgcactacggccggatgtgcccgatcgaaacccctgaggggcccaacatcggtctgatcggctcgctgtcggtgtacgcgcgggtcaacccgttcgggtt (SEQ ID No. 7) was inserted into the pUC57 vector and purified (Beijing Bomaide Gene Technology Co., Ltd.) to obtain the plasmid. rpoB -513&516.

[0058] The concentration of the purified plasmid was calculated using the following formula: copies / μL = 6.02 × 10⁻⁶ 23 × (concentration ng / μL) × 10 -9 / (DNA length × 660).

[0059] All plasmids are 2990 bp in length.

[0060] The copy number of all plasmids was 6.10 × 10⁻⁶. 9 copies / μL.

[0061] 2. Dilution 10 μL of plasmid was added to 51.0 μL of water to obtain a concentration of 1×10⁻⁶. 9 Copies / μL of plasmid standard were serially diluted to the required concentration and then sent to Beijing Xinyi Biotechnology Co., Ltd. for digital PCR to accurately quantify the plasmid concentration.

[0062] (II) Preparation of primers and amplification products required for RAA amplification.

[0063] 1. Design of RAA amplification primers.

[0064] Primers for amplifying the target sequence of Mycobacterium tuberculosis detection using RAA were designed and synthesized. These primers contain a T7 transcription sequence at the 5' end, allowing the double-stranded DNA (dsDNA) obtained from RAA amplification to be recognized and transcribed by T7 RNA polymerase (see Table 1). The DNA sequence was synthesized by Beijing Bomeide Gene Technology Co., Ltd.

[0065] Table 1. RAA amplification primers used for MTB detection

[0066] 2. Obtaining RAA amplification products.

[0067] Using plasmid standards as templates, RAA amplification was performed using primers designed in step 1 to obtain RAA amplification products.

[0068] The RAA amplification system is shown in Table 2.

[0069] Table 2. RAA amplification system

[0070] Add 47.5 μL of the mixed solution to the basic reaction unit containing the lyophilized powder, ensuring complete dissolution. Add 2.5 μL of B Buffer to the cap of each reaction tube, close the cap, invert the tube to mix, and centrifuge at low speed to collect the residue at the bottom of the tube. Incubate the reaction tubes at 39°C for 30 minutes. The RAA amplification product is then obtained.

[0071] Nine primer combinations were obtained through cross-pairing: MTB-RAA-F1&R1, MTB-RAA-F1&R2, MTB-RAA-F1&R3, MTB-RAA-F2&R1, MTB-RAA-F2&R2, MTB-RAA-F2&R3, MTB-RAA-F3&R1, MTB-RAA-F3&R2, and MTB-RAA-F3&R3. The crRNA prepared in Example 1 (III) was selected for detection. The signal strength of different primer sets was compared, and the primer set with the strongest fluorescence signal was selected as the primer set for subsequent CRISPR-Cas13a detection of rifampicin-resistant bacteria.

[0072] (III) Preparation of crRNA.

[0073] 1. Primer sequence synthesis.

[0074] exist rpoB -531&526、 rpoBcrRNA was designed from the conserved sequences -516 & 513 (SEQ ID No. 6, 7). The 5' end of the crRNA contains a 39 nt repeat sequence, which can bind to the LwCas13a protein. The single-stranded DNA sequence 5'-GGGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-3'' (SEQ ID No. 8) was designed as a template consisting of a repeat sequence and a target sequence. The upstream primer was a T7 sequence (5'-TAATACGACTCACTATAGGG-3') + a partial repeat sequence (5'-GATTTAGACTACCCCAA-3'). The downstream primer was the approximately 20 bp inverse complementary sequence downstream of the target sequence (Tables 3-4). The sequences in Tables 3-4 were synthesized.

[0075] Table 3. Primer sequences

[0076] Table 4. Primer Sequences

[0077] 2. PCR amplification The sequences shown in Tables 3 and 4 were synthesized by Beijing Tianyi Huiyuan Company, respectively. Following the research methods described in the literature, the corresponding crRNAs were synthesized through DNA synthesis, annealing, transcription, and purification steps (J.T.Huang, et al. Clinicalchemistry 61, 290-296(2015).). The above sequences were diluted to 10 μM with enzyme-free water. The PCR reaction system was prepared as follows: the upstream primer was T7-crRNA-F, and the templates were 531&526-crRNA-1, 2, 3, 4, 5, 6, 7, 8 and 516&513-crRNA-1, 2, 3, 4, 5, 6, 7, 8 (as shown in Tables 3 and 4). The corresponding downstream primers were 531&526-R-1, 2, 3, 4, 5, 6, 7, 8 and 516&513-R-1, 2, 3, 4, 5, 6, 7, 8 (as shown in Table 3).

[0078] Table 5. PCR amplification system for preparing template sequences for crRNA

[0079] 531 & 526-crRNA-X represent the templates for 531 & 526-crRNA-1, 531 & 526-crRNA-2, 531 & 526-crRNA-3, 531 & 526-crRNA-4, 531 & 526-crRNA-5, 531 & 526-crRNA-6, 531 & 526-crRNA-7, and 531 & 526-crRNA-8, respectively.

[0080] 516 & 513-crRNA-X represent the templates for 516 & 513-crRNA-1, 516 & 513-crRNA-2, 516 & 513-crRNA-3, 516 & 513-crRNA-4, 516 & 513-crRNA-5, 516 & 513-crRNA-6, 516 & 513-crRNA-7, and 516 & 513-crRNA-8, respectively.

[0081] The PCR reaction system was subjected to PCR amplification to obtain the PCR product.

[0082] PCR reaction conditions: 95℃, 5 min for heat denaturation; 95℃, 30 s, 55℃, 30 s, 72℃, 15 s for a total of 38 cycles; automatic extension at 72℃ for 10 min; PCR products stored at 4℃.

[0083] 3. Purification of PCR products The four PCR products obtained in step 2 were purified using Tris-balanced phenol, as follows: Tris-balanced phenol and chloroform were mixed in an equal proportion, vortexed thoroughly, centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded; 600 μL of the phenol-chloroform mixture was added to 200 μL of the PCR product, mixed well, and centrifuged at 12,000 rpm for 1 min; the supernatant was transferred to a new 1.5 mL centrifuge tube, anhydrous ethanol was added to make the supernatant-ethanol ratio 3:7, centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded; 200 μL of 75% ethanol was added, centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded (this step was repeated three times). The resulting precipitate was air-dried at room temperature (approximately 10 min) to obtain three purified PCR products. The four purified PCR products were added to 50 μL of RNase-free water, and the concentration was measured using Nanodrop. They were then stored at -80℃.

[0084] 4. Transcription Take 1 μg of the 16 purified PCR products obtained in step 3 and transcribe them using the T7 transcription kit (NEB). The crRNA transcription system is shown in Table 6.

[0085] Table 6. crRNA transcription system

[0086] After mixing the above crRNA transcription system, incubate at 37°C overnight to obtain the transcription product, i.e., crRNA.

[0087] 5. crRNA purification Purify the crRNA obtained from transcription in step 4 according to the Novizan instructions. The specific steps are as follows: First, vortex the magnetic beads to mix them thoroughly. Add 1.8 times the volume (36 μL) of magnetic beads to 20 μL of the transcription product, then add 100 μL of isopropanol and vortex for 30 s to mix the magnetic beads and transcription system. Let it stand at room temperature for 10 min. Then place the reaction system on a magnetic rack and let it stand for 5-10 min. Gently aspirate the liquid from the system to separate the magnetic beads. Add 200 μL of 70% ethanol to the magnetic beads and incubate at room temperature for 30 s. Aspirate the ethanol. Repeat this process to wash the magnetic beads three times. Air dry the system at room temperature to remove the ethanol, about 10 min. Add 40 μL of enzyme-free water to dissolve the crRNA in the system, vortex for 30 s, aspirate the supernatant, and transfer it to a 1.5 ml centrifuge tube. Measure the concentration of the purified crRNA using Nanodrop and dilute to 100 ng / μL. Aliquot at -80℃ for use.

[0088] A total of 16 crRNAs were prepared: 531&526-crRNA-1, 531&526-crRNA-2, 531&526-crRNA-3, 531&526-crRNA-4, 531&526-crRNA-5, 531&526-crRNA-6, 531&526-crRNA-7, 531&526-crRNA-8, 516&513-crRNA-1, 516&513-crRNA-2, 51 The crRNAs 6 & 513-crRNA-3, 516 & 513-crRNA-4, 516 & 513-crRNA-5, 516 & 513-crRNA-6, 516 & 513-crRNA-7, and 516 & 513-crRNA-8 were used for detection. The signal intensity of different crRNAs was compared, and the crRNA with the strongest fluorescent signal was selected for subsequent CRISPR-Cas13a detection of rifampicin resistance.

[0089] Example 2: Establishment of a RAA-CRISPR method for detecting rifampicin resistance The detection principle of this invention is as follows: This study utilized RAA technology to amplify the target nucleic acid, and transcribed the target sequence detected by mutations at gene sites 531 & 526 to obtain the crRNA mentioned above. rpoB-crRNA-1, rpoB -crRNA-2, rpoB -crRNA-3, rpoB -crRNA-4 was detected, and the signal intensity of different crRNAs was compared. The crRNAs with stronger mutant fluorescence signals and weaker wild-type fluorescence signals were selected to introduce mismatched bases, resulting in the crRNAs mentioned above: 531&526-crRNA-5, 531&526-crRNA-6, 531&526-crRNA-7, and 531&526-crRNA-8. The crRNAs with stronger mutant fluorescence signals and no significant difference between wild-type and negative fluorescence signals (P>0.5) were selected as the crRNAs for subsequent detection.

[0090] The target sequences for 516 & 513 gene site mutation detection were transcribed to obtain the crRNAs mentioned above: 516 & 513-crRNA-1, 516 & 513-crRNA-2, 516 & 513-crRNA-3, and 516 & 513-crRNA-4. These crRNAs were then detected, and the signal strength of different crRNAs was compared. The crRNAs with stronger mutant fluorescence signals and weaker wild-type fluorescence signals were selected to introduce mismatched bases, resulting in the crRNAs mentioned above: 516 & 513-crRNA-5, 516 & 513-crRNA-6, 516 & 513-crRNA-7, and 516 & 513-crRNA-8. The crRNAs with stronger mutant fluorescence signals and no significant difference between wild-type and negative fluorescence signals (P>0.5) were selected as the subsequent detection crRNAs.

[0091] The specific steps and principles are as follows: First, the target sequence is amplified using specific primers (through denaturation, annealing, and extension). The 5' end of the primers contains a T7 transcription sequence, allowing the double-stranded DNA (dsDNA) obtained from PCR amplification to be recognized and transcribed by T7 RNA polymerase. Second, a portion of the amplification product is taken and added to T7 RNA polymerase, LwCas13a protein, crRNA that recognizes the target sequence, and reporter RNA for target sequence detection (performed at 37℃). Real-time PCR instrument, FAM channel detection: 37℃ for 15 s, 37℃ for 1 min 45 s (fluorescence collection), for a total of 30 cycles.

[0092] (I) Preparation of CRISPR-Cas13a fluorescence detection system After serially diluting the mutant plasmid DNA template, take 5 μL of the template and use the primers from step 1 of Example 1 (II) above. rpoB -RAA-F2 and rpoB -RAA-R1 performs RAA amplification on the nucleic acid of the test sample to obtain RAA amplification products; Take 5 μL of the RAA amplification product obtained above as a template and prepare the CRISPR-Cas13a detection system according to Table 7 below.

[0093] The negative control is to replace the RAA product in Table 7 with enzyme-free water while keeping other reagent components unchanged.

[0094] Table 7 shows the CRISPR-Cas13a fluorescence detection system.

[0095] PCR tubes containing the reaction system shown in Table 7 were placed in a real-time PCR instrument. The FAM channel was used to detect changes in fluorescence signal. The excitation wavelength of the channel was set to 490 nm and the emission wavelength to 520 nm. The reaction was carried out at 37°C for 15 s and then at 37°C for 1 min 45 s (fluorescence was collected). A total of 30 cycles were performed, and the readings were taken 30 times for a total of 30 minutes to detect changes in fluorescence intensity in the system.

[0096] Result determination: If the fluorescence intensity value of the experimental group is significantly different from that of the negative control (enzyme-free water) within the same detection time (P<0.5), it is considered a positive result, meaning that the sample to be tested contains or is a candidate for rifampicin resistance; otherwise, it is considered a negative result, meaning that the sample to be tested does not contain or is a candidate for rifampicin resistance.

[0097] (II) Preparation of CRISPR-Cas13aERASE test strip detection system After serially diluting the Mycobacterium tuberculosis DNA template, 5 μL of the template was taken and RAA amplified using the primers rpoB-RAA-F2 and rpoB-RAA-R1 from Example 1 (II) 1 above to obtain the RAA amplification product. Take 5 μL of the RAA amplification product obtained above as a template and prepare the CRISPR-Cas13a test strip detection system according to Table 8 below.

[0098] The negative control is to replace the RAA product in Table 8 with enzyme-free water while keeping other reagent components unchanged.

[0099] Table 8. CRISPR-Cas13a test strip detection system

[0100] Cap the reaction tube containing the reaction system shown in Table 8, invert it 5-6 times to mix, and centrifuge at low speed for 10 seconds. Place the reaction tube at 37°C for 30 minutes. After the reaction is complete, add 40-50 μL of the reaction system to the sample well of the CRISPR test paper.

[0101] Result Interpretation: Read the results 2-5 minutes after the test strip is applied. If no "T" line appears but a "C" line does, the sample contains or is a candidate for rifampicin resistance. If both a "T" line and a "C" line appear, the sample does not contain or is a candidate for rifampicin resistance. If no "C" line appears, the test strip is invalid and needs to be replaced and the test repeated.

[0102] (III) Optimization of conditions for the method of detecting rifampicin resistance based on the CRISPR-Cas13a system 1. Selection of optimal primers The concentration prepared in Example 1(a) is 1×10 11 The mutant plasmid was serially diluted with enzyme-free water to a concentration of 1×10⁻⁶ copies / μL. 1 When the number of copies / μL is used as a template, RAA amplification is performed using the method in Example 1 (II) above. The primers are the primer combinations shown in Table 1, and the RAA amplification products are obtained.

[0103] Then, CRISPR fluorescence screening was performed: the method in Example 2 (a) was used, wherein the RAA amplification primers were F1&R1, F1&R2, F1&R3, F2&R1, F2&R2, F2&R3, F3&R1, F3&R2, and F3&R3, and the crRNA was temporarily selected as 531&526-crRNA-2.

[0104] The results are as follows Figure 1 As shown, compared to other cross-combination primer pairs, rpoB The fluorescence signal corresponding to the -RAA-F2&R1 primers peaked earliest; and... Figure 2 As can be seen, the primer set captured the highest fluorescence signal at 30 min. Therefore, in subsequent experiments, F2 & R1, which are significantly superior to other primer sets, will be used. Figure 3 ) is the best amplification primer for RAA amplification targeting mutation sites.

[0105] 2. Optimal crRNA screening 1) Synthesis of crRNA primer sequences Sixteen types of crRNA were synthesized and prepared using the method in (iii) of Example 1.

[0106] 2) The concentration obtained by the method in Example 1(a) is 1×10 11 Plasmid standards of 531, 526, 516, 513, 531 & 526, and 516 & 513 copies / μL were diluted to 1×10⁻⁶. 2After copying / μL, the product was used as a template and RAA amplification was performed according to the method in (ii) of Example 1. The primer used was F2R1 (the optimal primer), and 6 RAA amplification products were obtained.

[0107] 3) Take 5 μL of RAA amplification product and detect different crRNAs according to the method in Example 2 (I). At the same time, set up the amplification product with enzyme-free water as template as a negative control. The crRNAs are the 16 crRNAs in Example 1 (III) above.

[0108] Test results as follows Figure 4 As shown, when using plasmids of the same concentration as templates, rpoB The fluorescence signal detected by -crRNA2 was stronger than that of the other three crRNAs, while its fluorescence signal was relatively weaker when detecting wild-type crRNAs; rpoB After -crRNA2 introduces mismatched bases, from Figure 5 It can be seen that after half an hour rpoB -crRNA2-1 showed the highest fluorescence value, and there was no significant difference between wild-type and negative groups (P>0.5). Therefore, rpoB -crRNA2-1 is the optimal crRNA.

[0109] Figure 6 The detection results show that, when using plasmids of the same concentration as templates, only rpoB -crRNA8 showed relatively weak fluorescence signal when detecting wild-type plasmids, and the fluorescence value of mutant plasmids was significantly different from that of negative plasmids (P<0.001); rpoB -crRNA8 introduces mismatched bases from Figure 7 It can be seen that after half an hour rpoB -crRNA8-4 showed the highest fluorescence value, and there was no significant difference between wild-type and negative groups (P>0.5). Therefore, rpoB -crRNA8-4 is the optimal crRNA.

[0110] Example 3: Sensitivity detection of mutation sites based on the CRISPR-Cas13a dual crRNA system The mutant plasmid obtained in Example 1(a) was serially diluted to obtain template solutions containing different concentrations, and then... rpoB -crRNA8-4 and rpoB -crRNA2-1 was mixed in the same system for detection to test the sensitivity of the method of the present invention. The specific steps are as follows: 1. The concentration obtained in Example 1 (a) is 1×10 11Each point mutation plasmid was serially diluted with water to obtain solutions containing different concentrations of the gene fragment at the mutation site, with concentrations of 10-1 and 10-1 μL, respectively. 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 10 -1 copies / μL.

[0111] 2. RAA amplification was performed according to the method in (II) of Example 1, using primer F2R1 (optimal primer). RAA amplification products were obtained. 5 μL of the RAA amplification product was taken and detected at sites 531, 526, 516, and 513 using the double crRNA-CRISPR-Cas13a fluorescence system according to the method in step (I) of Example 2. Simultaneously, amplification products using enzyme-free water as a template were set as a negative control. rpoB -crRNA8-4 and rpoB -crRNA2-1 are mixed in equal proportions.

[0112] 3. Results of fluorescence detection sensitivity of the dual crRNA-CRISPR-Cas13a system: 1) CRISPR detection of the 526-site mutation showed that... Figure 8 When using the double crRNA system to detect the 526-site mutant plasmid template, although the fluorescence signal was at 10 3 -10 1 The concentration of copies / μL continuously decreased, but all of them showed significant differences from the negative template detection. Therefore, the double crRNA system can detect mutations at 526 sites with a sensitivity of up to ten copies. 2) CRISPR detection of the 531 site mutation showed that... Figure 10 When using the dual crRNA system to detect the 531 site mutant plasmid template, although the fluorescence signal was at 10 3 -10 1 The concentration of copies / μL decreased continuously, but all of them showed significant differences from the negative template detection. Therefore, the double crRNA system can be used to detect mutations at 531 sites with a sensitivity of up to ten copies. 3) CRISPR detection of the 516-site mutation showed that... Figure 12 When using the dual crRNA system to detect the 516-site mutant plasmid template, although the fluorescence signal was at 10 3 -10 1The concentration of copies / μL decreased continuously, but all of them showed significant differences from the negative template detection. Therefore, the double crRNA system can detect mutations at 516 sites with a sensitivity of up to ten copies. 4) CRISPR detection of the 513 site mutation showed that... Figure 14 When using the double crRNA system to detect the 513 site mutant plasmid template, although the fluorescence signal was at 10 3 -10 1 The concentration of copies / μL decreased continuously, but all of them showed significant differences from the negative template detection. Therefore, the double crRNA system can be used to detect mutations at the 513 site with a sensitivity of up to ten copies. 5) CRISPR detection of simultaneous mutations at sites 531 and 526 showed that... Figure 16 When using the dual crRNA system to detect plasmid templates with simultaneous mutations at sites 531 and 526, although the fluorescence signal was at 10 3 -10 1 The concentration of copies / μL decreased continuously, but all of them showed significant differences from the negative template detection. Therefore, the dual crRNA system can be used to detect simultaneous mutations at sites 531 and 526 with a sensitivity of up to ten copies. 6) CRISPR detection of simultaneous mutations at sites 516 and 513 showed that... Figure 18 When using the dual crRNA system to detect plasmid templates with simultaneous mutations at sites 516 and 513, although the fluorescence signal was at 10... 3 -10 1 The concentration of copies / μL decreased continuously, but all of them showed significant differences from the negative template detection. Therefore, the dual crRNA system can be used to detect simultaneous mutations at sites 516 and 513 with a sensitivity of up to ten copies. 4. Sensitivity of the dual crRNA-CRISPR-Cas13a system test strip: After completing step 2, take 5 μL of RAA amplification product and detect the mutant plasmid using the double crRNA-CRISPR-Cas13a system according to the method in step (i) of Example 2. Simultaneously, set up the amplification product with enzyme-free water as a template as a negative control. rpoB -crRNA2-1 and rpoB -crRNA 8-4 in equal proportions, primers rpoB -RAA-F2 and rpoB -RAA-R1.

[0113] 1) CRISPR test strip results as follows Figure 9 As shown in the figure, the third row represents three replicates. When using the double crRNA system to detect the 526-site mutant plasmid, at 10 3-10 1 The T line disappeared and the C line appeared in the copies / μL group, indicating a negative result; 10 0 Both copies / μL and the T and C lines were visible in the negative control group, indicating a negative result. Therefore, the double crRNA system can detect mutations at 526 sites with a sensitivity of up to ten copies. 2) CRISPR test strip results as follows Figure 11 As shown in the figure, the third row represents three replicates. When using the double crRNA system to detect the 531 site mutant plasmid, at 10 3 -10 1 The T line disappeared and the C line appeared in the copies / μL group, indicating a negative result; 10 0 Both copies / μL and the T and C lines were visible in the negative control group, indicating a negative result. Therefore, the double crRNA system can detect mutations at site 531 with a sensitivity of up to ten copies. 3) CRISPR test strip results as follows Figure 13 As shown in the figure, the third row represents three replicates. When using the double crRNA system to detect the 516-site mutant plasmid, at 10 3 -10 1 The T line disappeared and the C line appeared in the copies / μL group, indicating a negative result; 10 0 Both copies / μL and the T and C lines were visible in the negative control group, indicating a negative result. Therefore, the double crRNA system can detect mutations at 516 sites with a sensitivity of up to ten copies. 4) CRISPR test strip results as follows Figure 15 As shown in the figure, the third row represents three replicates. When using the double crRNA system to detect the 513 site mutant plasmid, at 10 3 -10 1 The T line disappeared and the C line appeared in the copies / μL group, indicating a negative result; 10 0 Both copies / μL and the T and C lines were visible in the negative control group, indicating a negative result. Therefore, the double crRNA system can detect mutations at site 513 with a sensitivity of up to ten copies. 5) CRISPR test strip results as follows Figure 17 As shown in the figure, rows 3 represent 3 replicates. When using the dual crRNA system to detect plasmids with simultaneous mutations at sites 526 and 531, at 10 3 -10 1 The T line disappeared and the C line appeared in the copies / μL group, indicating a negative result; 10 0Both copies / μL and the T and C lines were visible in the negative control group, indicating a negative result. Therefore, the dual crRNA system can detect simultaneous mutations at sites 526 and 531 with a sensitivity of up to ten copies. 6) CRISPR test strip results as follows Figure 19 As shown in the figure, rows 3 represent 3 replicates. When using the dual crRNA system to detect plasmids with simultaneous mutations at sites 513 and 516, at 10 3 -10 1 The T line disappeared and the C line appeared in the copies / μL group, indicating a negative result; 10 0 Both copies / μL and the T and C lines were visible in the negative control group, indicating a negative result. Therefore, the dual crRNA system can detect simultaneous mutations at sites 513 and 516 with a sensitivity of up to ten copies. Example 4: Specific detection of Mycobacterium tuberculosis based on CRISPR-Cas13a system 1. Specificity of CRISPR-Cas13a mutation sites during detection Using the wild-type plasmid as a detection template, and setting up an amplification product with enzyme-free water as a template as a negative control group, the method in step (i) of Example 2 was used for detection to verify the specificity of the method of the present invention. The specific steps are as follows: The wild-type plasmid obtained in Example 1(a) was serially diluted to obtain template solutions containing different concentrations, with concentrations of 10... 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 10 -1 copies / μL. and rpoB -crRNA2-1 and rpoB -crRNA8-4 were mixed in the same system for detection to verify the specificity of the method of the present invention. The specific steps are as follows: 1) The concentration obtained in Example 1 (a) is 1×10 11 Each copy / μL of point mutation plasmid was serially diluted with enzyme-free water to obtain solutions containing gene fragments with different concentrations of the mutation sites. 2) Perform RAA amplification according to the method in (ii) of Example 1, using F2R1 (optimal primer) to obtain RAA amplification products. Take 5 μL of RAA amplification products and detect different concentrations of wild-type plasmids using the double crRNA-CRISPR-Cas13a fluorescence system according to the method in step (i) of Example 2. At the same time, set up amplification products with enzyme-free water as template as negative controls. rpoB -crRNA2-1 and rpoB -crRNA 8-4 in equal proportions.

[0114] 3) Results of the dual crRNA-CRISPR-Cas13a system test strip: CRISPR detection results for different concentrations of wild-type plasmids showed that... Figure 20 When using the dual crRNA system to detect wild-type plasmid templates, the "T" line disappeared and the "C" line appeared in the positive control containing the mutant, while both the "T" and "C" lines appeared in the negative control group (enzyme-free water) and in different concentrations of wild-type plasmids. This indicates that the method for detecting rifampicin resistance based on the CRISPR-Cas13a system ERASE test strip of the present invention has high specificity and no cross-reaction occurs during the detection process.

[0115] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

[0116] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A dual crRNA-CRISPR-Cas13a system for on-site detection of rifampicin resistance in Mycobacterium tuberculosis using ERASE test strips, characterized in that: Including a1) or a2): a1) RAA primer pair, Cas13a protein and crRNA; a2) The RAA primer pair and complex; the complex is formed by the Cas13a protein and the crRNA; The crRNA includes an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting the rifampicin resistance gene mutation site. The target sequence of the rifampicin resistance gene wild-type is located at rpoB The target sequences at positions 2317-2597 of the gene; the target sequences at positions 513, 516, 526, and 531 are located at... rpoB Gene positions 2317-2597; The rpoB The wild-type target sequence is SEQ ID No. 1; The rpoB The mutation target sequences at gene sites 531, 526, 516, 513, 531+526, and 516+513 are SEQ ID No. 2, 3, 4, 5, 6, and 7, respectively. The lateral flow test strip comprises, in sequence, a sample plate, a gold nanoparticle anti-FITC antibody, a streptavidin line, an antibody capture line, and an absorption plate; The antibody used to coat the antibody capture line is goat anti-rabbit IgG.

2. The dual crRNA-CRISPR-Cas13a system according to claim 1, characterized in that: The crRNA sequence is SEQ ID No.

8.

3. The dual crRNA-CRISPR-Cas13a system according to claim 1 or 2, characterized in that: The Cas13a protein is the LwCas13a protein.

4. A kit for detecting rifampicin resistance, comprising the dual crRNA-CRISPR-Cas13a system as described in any one of claims 1-3.

5. The reagent kit according to claim 4, characterized in that: The kit also includes a method for specifically amplifying rifampicin-resistant strains. rpoB RAA amplification primers for gene mutation target sequences; the RAA amplification primers are composed of single-stranded DNA molecules with the sequences shown.

6. Any of the following substances: A1) The crRNA as described in any one of claims 1-3; A2) The Cas13a protein and crRNA as described in any one of claims 1-3, or a complex thereof; A3) The primer pair as described in claim 5.

7. Any of the following applications: B1) The use of the system of any one of claims 1-3, the kit of claim 4 or 5, or the substance of claim 6 in the detection or auxiliary detection of rifampicin resistance or its nucleic acid; B2) The use of the system of any one of claims 1-3, the kit of claim 4 or 5, or the substance of claim 6 in the preparation of products for detecting or assisting in the detection of rifampicin resistance or its nucleic acids; B3) The use of the system of any one of claims 1-3, the kit of claim 4 or 5, or the substance of claim 6 in detecting or assisting in the detection of whether a sample contains rifampicin resistance or its nucleic acid; B4) The use of the system of any one of claims 1-3, the kit of claim 4 or 5, or the substance of claim 6 in the preparation of products for detecting or assisting in the detection of whether a sample contains rifampicin resistance or its nucleic acid; B5) The use of the system according to any one of claims 1-3, the kit according to claim 4 or 5, or the substance according to claim 6 in screening or assisting screening for drugs to prevent rifampicin resistance; B6) The use of the system of any one of claims 1-3, the kit of claim 4 or 5, or the substance of claim 6 in the preparation of products for screening or assisting in screening for drugs to prevent or treat rifampicin resistance; B7) Use of the substance of claim 6 in the preparation of the kit of claim 4 or 5.

8. A method for detecting or assisting in the detection of rifampicin resistance, comprising the following steps: C1) Using the nucleic acid of the sample to be tested as a template, RAA amplification was performed using a primer pair consisting of the single-stranded DNA molecule shown in SEQ ID No. 10 and the single-stranded DNA molecule shown in SEQ ID No. 12 to obtain the RAA product; C2) Prepare a CRISPR-Cas13a detection system containing the following components: the RAA product, the Cas13a protein as described in any one of claims 1-3, the crRNA as described in any one of claims 1-3, reporter RNA, NTP, T7 RNA polymerase, and RNase inhibitor; and use enzyme-free water instead of the PCR product as a negative control. C3) The CRISPR-Cas13a detection system is reacted, and the reaction products are detected to determine whether the sample to be tested contains rifampicin resistance. The above reactions are either reaction C3)-1 in the fluorescence system or reaction C3)-2 in the test strip system: C3)-1: The CRISPR-Cas13a detection system, wherein the RNA in the CRISPR-Cas13a detection system is a fluorescent reporter RNA, the CRISPR-Cas13a detection system is placed in a real-time PCR instrument to react, and the fluorescence intensity is detected. The presence of rifampicin resistance in the test sample is determined based on the magnitude of the fluorescence intensity: if the fluorescence intensity value of the test sample detection system is significantly different from that of the negative control (enzyme-free water) within the same detection time, then the test sample contains or is a candidate for containing rifampicin resistance; otherwise, the test sample does not contain or is a candidate for not containing rifampicin resistance. C3) -2: The CRISPR-Cas13a detection system is used for reaction, and the RNA in the CRISPR-Cas13a detection system is the reporter RNA detected by the test strip. The reaction product is detected by the test strip. The presence of rifampicin resistance in the test sample is determined by whether the "T" line disappears and the "C" line appears: If the "T" line of the test sample detection system disappears and the "C" line appears within the same detection time, then the test sample contains or is a candidate for containing rifampicin resistance; otherwise, the test sample does not contain or is a candidate for not containing rifampicin resistance.

Images