A molecular marker, method and application for identifying red-leaf dwarf of upland cotton

Abstract

The present invention belongs to the field of plant molecular biology, and particularly relates to a molecular marker and method for identifying the red leaf and dwarf traits of upland cotton and its application. The InDel molecular marker has a genotype of ACT or A at the 79,598,917th base on chromosome A09 of cotton. The present invention has developed an InDel molecular marker for identifying the red leaf and dwarf traits of upland cotton. The phenotypic variations of red leaves and plant height in the F2 population constructed from the dwarf red plants of upland cotton and Xinluzao 74 can be identified by this InDel molecular marker. At the same time, this InDel marker can be used for molecular marker-assisted selection of the red leaf and dwarf traits of upland cotton, and also provides gene resources and theoretical basis for revealing the dwarfing mechanism of upland cotton and breeding new cotton varieties with ideal plant types.

Description

Technical Field

[0001] The invention belongs to the field of plant molecular biology, and particularly relates to a molecular marker for identifying red-leafed and short-stem upland cotton, as well as a method and application thereof. Background Art

[0002] The plant structure of cotton mainly includes plant height, number of fruit branches, leaf size, and arrangement of leaves and fruit branches, which directly affect the yield and quality of cotton. Plant height is a decisive factor affecting plant type and is the main agronomic trait that determines crop planting density and affects yield. Dwarf and semi-dwarf varieties have the advantages of improving photosynthetic utilization, increasing lodging resistance, and being less susceptible to pathogens. They are of great significance for saving production costs, improving fertilizer utilization, and increasing yield.

[0003] Cotton has an unlimited growth habit and the plants are tall. Nowadays, the conventional dwarfing cultivation measure is to use growth retardants such as mepiquat. As the use of such growth retardants becomes more and more widespread, their disadvantages are becoming more and more serious, especially the problem of environmental pollution. Therefore, making full use of dwarf materials and breeding dwarf varieties are important measures to increase yields and improve agricultural production efficiency. Cotton dwarf germplasm has important utilization value in dwarfing breeding. It not only provides important genetic resources for breeding dwarf cotton varieties with ideal plant types, but is also an ideal material for studying the growth of plant stems and hormone regulation.

[0004] So far, three gene loci related to anthocyanin accumulation have been located and cloned in upland cotton: R1 , R2 ,and Rs .have R1 ( GhPAP1D / GhRLC1 )or Rs ( GhPAP1A) Cotton plants with the gene all have red leaves, stems and flowers. Rs Compared with the red phenotype R1 The color is slightly lighter, showing a sub-red leaf phenotype. R2 ( GbB ) gene has a distinct petal base spot phenotype, but the leaves and stems of the plants appear normal green. In addition to the above three gene loci related to anthocyanin accumulation, there is another Rd Location, Rd The mutant plants showed red leaves and short stems, but Rd There is no clear chromosome location information for the gene, nor is there an available linkage marker. Cotton germplasm resources rich in anthocyanins can provide genetic resources and theoretical basis for cotton stress resistance and colored cotton breeding.

[0005] In this study, the dwarf red plant introduced from the germplasm resource bank was hybridized with the tall material Xinluzao 74 to construct the F2 The red leaf and stalk traits of dwarf red plants were located through BSA-seq and GBTS target region capture in the first generation of segregating populations. The aim is to develop a molecular marker that is tightly linked to the red leaf and stalk traits of dwarf red plants, and to carry out molecular marker-assisted screening in the dwarf breeding of cotton using dwarf red plants of upland cotton varieties, thereby accelerating the breeding process. Summary of the invention

[0006] The purpose of the present invention is to develop a molecular marker closely linked to the red leaf and dwarf stalk trait of upland cotton, to achieve rapid and accurate selection of the red leaf and dwarf stalk trait of upland cotton, and to carry out molecular assisted breeding.

[0007] The above objectives are achieved through the following technical means:

[0008] The invention provides an InDel molecular marker for identifying red-leafed and dwarfed upland cotton. The InDel molecular marker is that the genotype of the 79598917th base on the A09 chromosome of the cotton is ACT or A.

[0009] The present invention also provides an application of the above-mentioned InDel molecular marker in identifying red-leafed and short-stemmed upland cotton.

[0010] As a further improvement of the above technical solution, if the genotype is A, it indicates that the cotton to be identified has red leaves and short stems, and if the genotype is ACT, it indicates that the cotton to be identified has green leaves and tall stems.

[0011] The present invention also provides a method for identifying red-leafed short-stem upland cotton, characterized in that it comprises the following steps:

[0012] Step S1, extracting cotton tissue DNA to be tested;

[0013] Step S2, designing specific amplification primers with the sequence of the site where the InDel molecular marker is located and its upstream and downstream bases as the target sequence, and using the DNA as a template to perform PCR amplification using the specific amplification primers to obtain an amplification product;

[0014] Step S3, performing genotyping detection and sequencing on the amplified product to obtain the molecular marker type of the cotton to be tested;

[0015] Step S4: determining cotton traits according to the molecular marker type.

[0016] As a further improvement of the above technical solution, if the genotype is A, it indicates that the cotton to be identified has red leaves and short stems, and if the genotype is ACT, it indicates that the cotton to be identified has green leaves and tall stems.

[0017] As a further improvement of the above technical solution, the forward primer sequence of the specific amplification primer is: 5'-CAGGGACCGTGAAGAACTCGT-3'; the reverse primer sequence of the specific amplification primer is: 5'-CCATGTCCGATTCTCTGGTTGC-3'.

[0018] As a further improvement of the above technical solution, the PCR amplification system is: 2 μl of DNA with a concentration of 50-500 ng / μL, 2 μl of 10×PCR Buffer for specific amplification primers and 1.6 μl of 2.5 mM dNTP, 0.4 μl of TaqDNAPolymerase, ddH 2 O 12μl, the total reaction system is 20μl.

[0019] As a further improvement of the above technical solution, the PCR amplification program is: ① pre-denaturation at 95°C for 5 min; ② denaturation at 95°C for 30 s; ③ annealing at 60°C for 30 s; ④ extension at 72°C for 30 s; ②-④ for 32 cycles; ⑤ final extension at 72°C for 10 min; ⑥ storage of the amplified product at 4°C.

[0020] The present invention also provides an application of the InDel molecular marker in cotton genetic breeding.

[0021] The beneficial effects of the present invention are:

[0022] The InDel molecular markers provided by the present invention, which are closely linked to the red-leafed and short-stalked traits of upland cotton dwarf red plants, are directly expressed in the form of DNA, are not restricted by seasons and growth periods, and can correspond to phenotypic variation in F2 segregating populations. They can be used for molecular marker-assisted selection of the red-leafed and short-stalked traits of upland cotton dwarf red plants, and provide a certain theoretical basis for the study of cotton dwarfing mechanism and the breeding of cotton dwarf varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The phenotypes of Upland cotton varieties Xinluzao 74 (left, green leaves and tall stems) and Dwarf Red (right, red leaves and short stems). DETAILED DESCRIPTION

[0024] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0025] 1. Materials

[0026] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.

[0027] 2. Methods

[0028] 2.1. Obtaining molecular markers closely linked to the red leaves and short stems of upland cotton dwarf red plants

[0029] (1) Dwarf red plants (red leaves and short stems, Figure 1 As shown in the middle right picture, it is from the National Cotton Germplasm Resource Medium-term Bank) as the male parent, and the green-leaf tall material Xinlu Zao 74 ( Figure 1 As shown in the middle left picture, it is from the National Cotton Germplasm Resource Medium-term Bank) as the female parent for hybridization to obtain the F1 generation, which is then self-pollinated to produce an F containing 528 individual plants. 2 To control the systematic error of the field experiment, all materials were planted in the same plot to ensure consistent environmental conditions.

[0030] (2) Select F 2 Thirty extremely tall plants and 30 extremely dwarf plants were sequenced together with the two parents by BSA mixed pool sequencing. The analysis resulted in a 6.54 Mb initial positioning interval, within which 47 molecular markers were developed based on differential sites.

[0031] (3) DNA from young leaves of individual plants in the F2 population was extracted, and the GBTS genotyping and target region capture methods were combined with the individual plant phenotypes to finally screen out an InDel molecular marker that co-segregated with the red leaf and dwarf stalk phenotype of upland cotton dwarf red plants.

[0032] (4) Using the InDel molecular marker, PCR amplification was performed in individual plants of the F2 generation population, and the amplified products were sequenced. When the genotype of the InDel molecular marker site was A, the plant showed red leaves and short stems, and when the genotype of the InDel molecular marker site was ACT, the plant showed green leaves and tall stems.

[0033] (5) The specific reaction system and procedure are as follows:

[0034] The PCR amplification system was as follows: 2 μl of genomic DNA with a concentration of 50-500 ng / μL, 1 μl of the upstream primer and downstream primer shown in Table 1, 2 μl of 10×PCR Buffer, 1.6 μl of 2.5 mM dNTP, 0.4 μl of Taq DNA Polymerase, and ddH 2O 12μl, the total reaction system is 20μl. The PCR amplification program is: ① 95℃ pre-denaturation for 5 min; ② 95℃ denaturation for 30 s; ③ 60℃ annealing for 30 s; ④ 72℃ extension for 30 s; ②-④ 32 cycles; ⑤ 72℃ final extension for 10 min; ⑥ 4℃ storage of amplified products.

[0035] Based on BSA-seq and genotyping by Target Sequencing (GBTS), a gene GhDR controlling the red-leaf and short-stem trait of dwarf red plants of upland cotton was cloned. The GhDR gene encodes a BBX24 protein, and there is a 2 bp frameshift mutation in the third exon of the gene. At the same time, based on this mutation site, an InDel molecular marker co-segregated with the red-leaf and short-stem trait of dwarf red plants of upland cotton was developed. The InDel molecular marker is located at position 79598917 on chromosome A09 and its upstream and downstream nucleotide sequences. The polymorphism is wild-type ACT or mutant A. The InDel molecular marker is directly presented in the form of DNA and is not restricted by the environment and growth period. The specific primers of the molecular marker are used to capture the target region, and the red-leaf and short-stem trait of dwarf red plants of upland cotton can be identified based on the sequencing results of the amplified products.

[0036] Table 1. InDel sites

[0037] ;

[0038] 2.2 InDel detection

[0039] To verify the reliability of the above InDel molecular markers, we used F 2 Individual strains of the population are used as experimental objects, and PCR amplification is performed using primers corresponding to the InDel molecular markers, followed by sequencing verification to obtain reliable analysis results. The steps are as follows:

[0040] (1) Use F 2 The DNA of the population was used as a template and PCR amplification was performed using specific primers. The primers are as follows:

[0041] Table 2. InDel specific primers

[0042] ;

[0043] The PCR amplification system is as follows: 2 μl of genomic DNA with a concentration of 50-500 ng / μL, 1 μl of the upstream primer and downstream primer shown in the table above, 2 μl of 10×PCR Buffer, 1.6 μl of 2.5 mM dNTP, 0.4 μl of TaqDNA Polymerase, ddH 2O12μl, the total reaction system is 20μl. The PCR amplification program is: ① 95℃ pre-denaturation for 5min; ② 95℃ denaturation for 30s; ③ 60℃ annealing for 30s; ④ 72℃ extension for 30s; ②-④ 32 cycles; ⑤ 72℃ final extension for 10min; ⑥ 4℃ storage of amplified products. The nucleotide sequence of the amplified product of InDel molecular marker InDelA09 is: CAGGGACCGTGAAGAACT CGTCATCTTCATCCGGGGTTTCGATTCTAGGCTTCTTAAGAGCCATGGAATATTTGGTGGGTCGGTATAAGTTTGTACTGCTTGATTGCGATATCGGAAGTTGAGGAACTTCAGCTGCTGCTAAAGCCTCCTGTGGCAATTGATCACCAAAAAGACCGATGTCTGCTAGCCATTCAAGCTCTCCAAGCTCAGAGTGCTCTTTCT GCAACCAGAGAATCGGACATGG

[0044] Among them, the underline indicates the primer binding position, and the bold indicates the position of the two base deletions in the genome of the red leaf dwarf material. The nucleotide sequence of the amplified product after the two base deletions is shown in SEQ ID NO.1, and the nucleotide sequence of the normal amplified product is shown in SEQ ID NO.2.

[0045] (2) The above amplified products were sequenced to detect the genotype of the InDel molecular marker site and corresponded with the statistical phenotype. The statistical results are shown in the following table:

[0046] Table 3. Statistical phenotypic results

[0047] ;

[0048] The statistical results show that in the F2 generation population, when the phenotype is red leaves and short stems, the genotype of the InDel molecular marker site is A, and when the phenotype is green leaves and tall stems, the genotype of the InDel molecular marker site is ACT.

[0049] The above results indicate that the InDel molecular marker screened by the present invention can be used as an InDel molecular marker tightly linked to the red leaf and dwarf stem trait of upland cotton dwarf red plants, and can be used for molecular marker-assisted selection of the red leaf and dwarf stem trait and breeding of dwarf cotton varieties.

[0050] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that for ordinary technicians in this field, several improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. Use of an InDel molecular marker for identifying red-leaf dwarf cotton in upland cotton in identifying red-leaf dwarf cotton in upland cotton, characterized in that, the nucleotide sequences of the InDel molecular marker are shown in SEQ ID NO.1 and SEQ ID NO.2, wherein the genotype of the InDel locus is ACT or A; if the genotype is A, it indicates that the cotton to be identified has the traits of red-leaf dwarf, and if the genotype is ACT, it indicates that the cotton to be identified has the traits of green-leaf tall stalk.

2. A method for identifying red-leaf dwarf cotton in upland cotton, characterized in that, it includes the following steps: Step S1: Extract the DNA of the cotton tissue to be detected; Step S2: Design specific amplification primers with the sequence composed of the base at the locus where the InDel molecular marker is located and its upstream and downstream bases as the target sequence, and use the DNA as a template to perform PCR amplification with the specific amplification primers to obtain an amplification product; the nucleotide sequences of the InDel molecular marker are shown in SEQ ID NO.1 and SEQ ID NO.2, wherein the genotype of the InDel locus is ACT or A; The forward primer sequence of the specific amplification primer is: 5 '-CAGGGACCGTGAAGAACTCGT-3 '; the reverse primer sequence of the specific amplification primer is: 5 '-CCATGTCCGATTCTCTGGTTGC-3 '; Step S3: Perform genotyping detection on the amplification product to obtain the molecular marker type of the cotton to be tested; Step S4: Judge the cotton traits according to the molecular marker type; if the genotype is A, it indicates that the cotton to be identified has the traits of red-leaf dwarf, and if the genotype is ACT, it indicates that the cotton to be identified has the traits of green-leaf tall stalk.

3. The method for identifying red-leaf dwarf cotton in upland cotton according to claim 2, characterized in that, The PCR amplification system is as follows: 2 μl of DNA with a concentration of 50 - 500 ng / µL, 1 μl each of forward and reverse specific amplification primers, 2 μl of 10×PCR Buffer, 1.6 μl of 2.5 mM dNTP, 0.4 μl of TaqDNA Polymerase, 2 12 μl of ddH O, and the total reaction system is 20 μl.

4. The method for identifying red-leaf dwarf cotton in upland cotton according to claim 3, characterized in that, The PCR amplification program is: ① Pre-denaturation at 95°C for 5 min; ② Denaturation at 95°C for 30 s; ③ Annealing at 60°C for 30 s; ④ Extension at 72°C for 30 s; among which ②-④ are 32 cycles; ⑤ Final extension at 72°C for 10 min; ⑥ Store the amplification product at 4°C.

5. Use of an InDel molecular marker in selective breeding for red-leaf dwarf traits in upland cotton, characterized in that, the nucleotide sequences of the InDel molecular marker are shown in SEQ ID NO.1 and SEQ ID NO.2, wherein the genotype of the InDel locus is ACT or A.

Images