Method for establishing DRD2 gene-edited model dog

Abstract

The present invention relates to a method for establishing a DRD2 gene-edited model dog, and specifically to a method for preparing a DRD2 gene-knockout model dog using gene editing technology, as well as the obtained DRD2 gene-knockout model dog and its cells, tissues and organs, making it feasible to use dogs as animal models for neuropsychiatric diseases research.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and in particular relates to a method for establishing a DRD2 gene-edited model dog. Background Art

[0002] Mental illness affects more than 25% of the world's population, causing huge economic losses and social costs, and has become the second largest disease burden in the world. Although mental illness has become a serious social problem, there is currently no effective treatment for this type of disease, and the therapeutic effects of existing drugs vary significantly from person to person. In addition, the development of new treatments for mental illness is slow, and the success rate of new drugs for the central nervous system is extremely low.

[0003] Around highly heritable psychiatric diseases such as bipolar disorder, autism, attention deficit hyperactivity disorder, schizophrenia and major depression, genome-wide association studies, copy number variation studies and whole exome sequencing studies have identified a large number of genetic risk loci that affect the development of psychiatric diseases. Among them, the DRD2 (Dopamine receptor D2) gene is one of the most widely studied and important genes in psychiatric diseases. It is considered to be a potential candidate gene for autism, bipolar disorder, major depression and schizophrenia, and is an important drug target for psychiatric diseases.

[0004] Animal models are an important means to study the pathological mechanisms of mental illness and screen related drugs, but existing animal models have many limitations. The rodent models currently widely used in the study of mental illness have been separated from humans in evolution as early as 100 million years ago, and there are huge differences between rodents and humans in brain structure and function. Therefore, many behavioral symptoms of human mental illness are difficult or impossible to simulate in rodents. Previous studies have pointed out that D2R2 knockout mice (DRD2- / -) can skillfully perform complex motor coordination tasks, which is significantly different from the impairment of all motor skills after complete blockade of D2 dopamine receptors in human patients with mental illness, and the clinical treatment effect of psychiatric drugs developed based on rodents is minimal. Non-human primates are ideal modeling animals for the study of mental illness, but this model also has certain limitations, such as high difficulty in development technology and slow reproduction. At the same time, the significant individual differences of non-human primates, animal ethics and animal protection issues restrict the widespread application of this type of model, and there is currently no non-human primate model available for the study of this gene.

[0005] The DRD2 gene is an important pharmacological target for typical and atypical antipsychotics. The target genes of neuroleptics (N05, including antipsychotics and antianxiety drugs) all interact with the DRD2 gene. In addition, clinically effective antipsychotics have the ability to block the D2 dopamine receptor, which can cause serious and potentially life-threatening side effects. For example, although antipsychotics can improve the positive symptoms of schizophrenia after blocking the D2 receptor, persistent D2 dopamine receptor blockade is associated with worsening clinical responses in some patients. In patients with mental illness who require antipsychotics and dopamine agonists, there are also clinical interactions that adversely affect the patient's prognosis. It is urgent to use animal models to study the pathological mechanisms of DRD2-related mental illnesses and develop drugs. Summary of the invention

[0006] The present invention provides a method for establishing a DRD2 (dopamine receptor D2 subtype) gene knockout model dog by gene editing technology. The present invention also relates to the established DRD2 gene knockout dog model, and its cells and tissues.

[0007] In a first aspect, the present invention provides a method for establishing a DRD2 gene-edited model dog, the method comprising using gene editing technology to obtain a DRD2 gene-knockout canine fertilized egg or canine somatic cell.

[0008] In some embodiments, the gene editing technology is selected from BE3 single-base editing technology, CRISPR, TALEN and ZFN, preferably CRISPR / Cas9.

[0009] In some embodiments, the method comprises the steps of:

[0010] (1) Based on the canine DRD2 gene sequence, the targeting site was determined based on the sequence of exon 1;

[0011] (2) synthesizing an sgRNA sequence according to the targeting site determined in step (1), and connecting the synthesized sgRNA sequence to a backbone vector to construct an sgRNA targeting vector;

[0012] (3) Obtaining in vitro transcription products of sgRNA and CRISPR / Cas9 respectively through in vitro transcription;

[0013] (4) Introducing the sgRNA obtained in step (3) and the in vitro transcription product of CRISPR / Cas9 into canine fertilized eggs or canine somatic cells to obtain canine fertilized eggs or canine somatic cells with DRD2 gene knockout.

[0014] In some embodiments, the sgRNA sequence and its complementary sequence include:

[0015] sgRNA sequence: GACAGGTTCAGTGGATCCATCGG (SEQ ID NO: 2);

[0016] sgRNA complementary sequence: CCGATGGATCCACTGAACCTGTC (SEQ ID NO: 3).

[0017] In some embodiments, the canine somatic cells are from the following tissues or organs: fetal tissue, skin, muscle, ear, mammary gland, fallopian tube, ovary, blood, urine, fat, bone marrow, blood vessels and luminal endothelium.

[0018] In some embodiments, the canine somatic cell is selected from the group consisting of fetal fibroblasts, skin cells, epithelial cells, ear cells, fibroblasts, endothelial cells, muscle cells, mammary cells, fallopian tube cells, ovarian cells, cumulus cells, neural cells, and osteoblasts.

[0019] In some embodiments, the method further comprises transplanting the obtained DRD2 gene knockout canine fertilized egg into the fallopian tube of a recipient female dog, thereby preparing a DRD2 gene-edited model dog.

[0020] In some embodiments, the method further comprises transplanting the nucleus of the obtained DRD2 gene knockout canine somatic cell into a canine enucleated oocyte, and then transplanting the canine enucleated oocyte after nuclear transplantation into the fallopian tube of a recipient female dog, thereby preparing a DRD2 gene-edited model dog.

[0021] In some embodiments, the present invention utilizes gene editing technology to select a targeting site sequence according to the exons of the canine DRD2 gene sequence, and constructs an sgRNA targeting vector and a CRISPR / Cas9 expression vector according to the targeting site sequence. After the vector is verified to be effective, it is transcribed into mRNA in vitro, and then the mRNA is injected into a canine fertilized egg by cytoplasmic injection. The canine fertilized egg is then transplanted into one of the fallopian tubes of a female dog whose bilateral fallopian tubes have been flushed with embryos, thereby preparing a DRD2 gene knockout and DRD2 gene editing model dog.

[0022] In a second aspect, the present invention provides canine somatic cells, tissues or organs of a DRD2 gene-edited model dog obtained by the method described in the first aspect.

[0023] In some embodiments, the canine somatic cell, tissue or organ comprises the sequence shown in SEQ ID NO:12.

[0024] In some embodiments, the canine somatic cell, tissue or organ comprises the nucleotide sequence shown below: (SEQ ID NO: 12).

[0025] In some embodiments, the classification of the somatic cells is named DRD2 gene knockout positive cell line, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC) with the deposit number CGMCC No.45183 and the deposit date of June 9, 2022.

[0026] In a fourth aspect, the present invention provides a canine DRD2 gene knockout targeting vector, which is composed of a sgRNA sequence designed for a targeting site sequence of exon 3 of the DRD2 gene and a backbone vector.

[0027] In some embodiments, the sgRNA sequence and its complementary sequence include:

[0028] sgRNA sequence: GACAGGTTCAGTGGATCCATCGG (SEQ ID NO: 2);

[0029] sgRNA complementary sequence: CCGATGGATCCACTGAACCTGTC (SEQ ID NO: 3).

[0030] In a fifth aspect, the present invention provides a primer pair, the sequence of the primer pair is as follows:

[0031] Forward primer: 5'-GAACTGAAAATCCTGAGGCTGG-3' (SEQ ID NO: 10); and

[0032] Reverse primer: 5'-CTGAGCCCAGAGTGGAGGAA-3' (SEQ ID NO: 11).

[0033] In a sixth aspect, the present invention provides a kit, the kit comprising a primer pair, the sequence of the primer pair being as follows:

[0034] Forward primer: 5'-GAACTGAAAATCCTGAGGCTGG-3' (SEQ ID NO: 10); and

[0035] Reverse primer: 5'-CTGAGCCCAGAGTGGAGGAA-3' (SEQ ID NO: 11).

[0036] In the seventh aspect, the present invention provides the use of the primer pair according to the fifth aspect or the kit according to the sixth aspect in detecting a DRD2 gene-edited model dog having a genomic sequence comprising a sequence fragment shown in SEQ ID NO:12.

[0037] The applicant conducted a homology comparison analysis of the DRD2 gene encoding proteins of humans, dogs and mice and found that the protein sequences of the DRD2 genes of dogs and humans are more homologous than those of mice. The DRD2 (Dopamine receptor D2) gene is one of the most widely studied and important genes in mental illness. Dopamine is a neurotransmitter in the brain. The DRD2 gene encodes the dopamine receptor D2 subtype, which is widely expressed in the striatum, nucleus accumbens, olfactory tubercle, substantia nigra, ventral tegmental area, hypothalamus, cortex, amygdala and hippocampus. It is involved in regulating emotions, moods and reward mechanisms and is related to a variety of mental illnesses such as attention deficit hyperactivity disorder, schizophrenia and major depression.

[0038] The present invention obtains a DRD2 gene-edited model dog by using CRISPR / Cas9, realizes effective editing of the DRD2 gene in the genome, and enriches the canine disease model biological sample library. In addition, in terms of neuropsychiatric diseases, the gene-edited dog model can more accurately simulate human diseases than the rat model. The development of the DRD2 gene-edited model dog will provide a reliable large animal model for studying the mechanism of action of the DRD2 gene product, and the pathogenesis and early intervention of neuropsychiatric diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The PCR identification results of newborn puppies No. 210113 to 210118 in Example 1 of the present application are shown.

[0040] Figure 2 Figures a and b respectively show the comparison results of the PCR peak graphs of the gene-edited dog No. 210114 and the wild-type dog in Example 1 of the present application.

[0041] Figure 3 The comparison results of the DRD2 gene characteristic sequences of the gene-edited dog No. 210114 and the wild-type dog in Example 1 of the present application are shown.

[0042] Figure 4 A photo of the gene-edited dog No. 210114 obtained in Example 1 of the present application is shown.

[0043] Figure 5 Shown are the results of three-box behavioral experiments on the gene-edited dog No. 210114 obtained in Example 1 of the present application. DETAILED DESCRIPTION

[0044] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments and drawings. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation to the present invention. In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0045] Example:

[0046] 1. Construction and identification of targeting vector

[0047] The canine DRD2 gene sequence was searched in Genbank, and a target site was designed based on exon 1 of the canine DRD2 gene. The target site sequence was the sequence shown in SEQ ID NO: 1: (SEQ ID NO: 1).

[0048] sgRNA was designed for the targeting site, and the sgRNA sequence is shown in Table 1. The sgRNA in Table 1 was used for cell editing, and the results of cell editing efficiency are shown in Table 1. As can be seen from Table 1, the sgRNA shown in SEQ ID NO: 2 has a higher cell editing efficiency. Therefore, the present invention uses the sgRNA shown in sgRNA01 for subsequent experiments.

[0049] Table 1

[0050]

[0051] The vector plasmid px330 was cut to linearize, 1% agarose gel electrophoresis was performed, and the gel was cut and recovered to determine the concentration. According to the system with a molar ratio of 1:3 between the linearized vector and the DRD2 gene targeting sgRNA, T4 DNA ligase was used to connect overnight at 16°C. The ligation product was transformed into an ampicillin-resistant LB plate for screening, colony PCR was used to identify positive clones, and the shake bacteria were inoculated and the plasmid was extracted using a plasmid extraction kit. 20 μL of the recombinant plasmid was taken and handed over to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. Snapgene analysis was then used to compare the sequencing results, and the plasmid with the correct sequencing comparison was saved for later use.

[0052] 2. In vitro transcription:

[0053] First, the CRISPR / Cas9 plasmid was linearized. The reaction system was: 30 μg plasmid, 5 μL restriction endonuclease AflII; 10 μL 10× Buffer and ddH 2 O, the total volume is 100μL. Then add 100μL phenol: chloroform: isoamyl alcohol (25:24:1) to purify the linearized plasmid DNA, centrifuge at 12000g for 5min; pipette 50μl supernatant into a 1.5ml centrifuge tube without RNase, add 1 / 10 volume of sodium acetate and 3 times volume of anhydrous ethanol to precipitate the plasmid DNA, centrifuge at 12000g for 5min; discard the supernatant, try to discard the remaining supernatant, add 150μL 70% ethanol to wash the plasmid, centrifuge at 12000g for 5min; dry in air for 3-5min, wash with 15μL RNase-free ddH 2 Dissolve the DNA in 4% O and determine the concentration.

[0054] In vitro transcription kit method (thermofisher mMESSAGE T7Ultra Kit):

[0055] The in vitro transcription system was: 1 μg linearized plasmid DNA, 10 μL 2×NTP / CAP, 2 μL 10×Buffer, 2 μL RNA synthase and ddH 2 O, total volume 20μL. After mixing, incubate at 37℃ for 1hr; add 1μL TURBO DNase to digest the plasmid template and incubate at 37℃ for 30min. Then add 20μL in vitro transcription product, 20μL 10× Reaction Buffer, 10μL ATP (10mM), 2.5μL RNase inhibitor, 2μL Poly(A) polymerase and nuclease-free ddH 2O to prepare a total volume of 100μL in vitro transcribed mRNA plus polyA system, and incubate at 37℃ for 1hr. After incubation, add 350μL binding buffer to the reaction system and mix by pipetting; then add 250μL anhydrous ethanol and mix evenly; then transfer the sample to the mRNA purification column and centrifuge at 10000g for 1min at room temperature; discard the filtrate, reinstall the column, rinse the column with 500μL elution solution, and centrifuge at 10000g for 1min at room temperature; repeat the rinse once, discard the filtrate, and centrifuge the empty column for 1min to elute impurities such as proteins; then put the column into a new centrifuge tube, add 50μL RNA elution solution to the center of the column, cover the lid and incubate at 65℃ for 10min, and centrifuge at 10000g for 1min at room temperature; detect RNA quality and concentration.

[0056] CRISPR / Cas9 mRNA and sgRNA mRNA were mixed to a final concentration of 20 ng / μL for sgRNA and 200 ng / μL for Cas9, and stored at -80°C for cytoplasmic injection.

[0057] 3. Preparation and verification of gene-edited dogs

[0058] Cas9 mRNA and sgRNA mRNA were mixed in a ratio of 2:1, and fertilized eggs of beagle dogs were injected into the cytoplasm. A total of 10 embryo transfers were performed, 10 transplant recipients, 20 puppies were born, and 1 gene editing positive dog was performed (see Table 2 below). The specific operation included: a total of 10 naturally estrous beagle female dogs were used as fertilized egg donors and embryo transplant recipients for experiments. Blood was collected from all female dogs to test the progesterone concentration in serum. When the progesterone concentration reached 4-7ng / mL, it could be determined as the ovulation period. Natural mating was performed 48h after ovulation, and then fertilized embryos were flushed. A total of 44 fertilized eggs were obtained from 10 female dogs. After collecting the fertilized eggs, the cumulus granulosa cells were removed using TCM199 medium containing 0.1% hyaluronidase, and then placed in a microdroplet of HEPES-buffered TCM199 medium (HM, GIBCO11150), and then placed on an inverted microscope equipped with a micromanipulator. A mixture containing the mRNA of the sgRNA prepared above and the mRNA of Cas9 in a ratio of 4:1 by volume was drawn up with a microinjection needle and then injected into the cytoplasm of the fertilized egg. The oviduct was flushed with 10 mL of HEPES-buffered TCM199 medium (HM, GIBCO11150) containing 10% fetal bovine serum, and the oviduct flushing fluid flowed out from the injection needle ligated at the fimbria of the oviduct and collected in a 10 mL centrifuge tube. After the cytoplasmic injection was completed, the embryo was placed in an embryo transfer tube, and the embryo in the embryo transfer tube was injected from the fimbria into the oviduct on the side with less bleeding during the embryo flushing. A total of 20 puppies were finally born.

[0059] After the puppies were born, ear tissue (E) and tail tissue (T) were collected for identification. After the tissue blocks were cut into pieces in a centrifuge tube, proteinase K was added to the centrifuge tube and lysed in a water bath at 56°C for 1-3 hours. Then 700μL of Genomic Lysis Buffer was pipetted and added to the lysis system, mixed evenly by inversion, and centrifuged at 10,000g for 1 minute. The supernatant was pipetted to the purification column, centrifuged at 10,000g for 1 minute at room temperature, and centrifuged for 1 minute. A new collection tube was replaced, 200μL of DNA Pre-Wash Buffer was added to the centrifuge column, centrifuged at 10,000g for 1 minute at room temperature, and the waste liquid was discarded. 400μL of g-DNA Wash Buffer was added to the centrifuge column, centrifuged at 10,000g for 1 minute at room temperature, and the waste liquid was discarded. The purification column and collection tube were centrifuged again at 10,000g for 2 minutes. Replace the purification column into a new 1.5 mL centrifuge tube, add 50 μL of Elution Buffer to elute the DNA, and place at room temperature for 2 minutes. Centrifuge at 12000 rpm for 1 minute to obtain the canine genomic DNA solution.

[0060] Canine genomic DNA was used as a template for PCR and PCR product sequencing. The sequences of the PCR identification primer pairs are as follows:

[0061] DRD2-JDF1: GAACTGAAAATCCTGAGGCTGG (SEQ ID NO:10)

[0062] DRD2-JDR1:CTGAGCCCAGAGTGGAGGAA(SEQ ID NO:11)

[0063] PCR reaction system (30 μL system):

[0064]

[0065] PCR reaction conditions:

[0066] 95℃5min; (95℃30s, 58℃30s, 72℃30s) 35 cycles; 72℃7min; store at 4℃.

[0067] Table 2. Cytoplasmic injection experiment records

[0068]

[0069] Figure 1The PCR identification results of newborn puppies No. 210113 to 210118 are shown, where E stands for Ear (ear tissue) and T stands for Tail (tail tissue). The amplified product has a single band, and it can be seen that there is no large fragment deletion in the target gene. The PCR product was further sequenced to analyze the gene editing results. The sequencing results were compared with the wild-type sequence to determine the mutation type of the Notch3 gene.

[0070] Figure 2 The comparison results of the gene sequencing peak graphs of the ear tissue and tail tissue of the DRD2 gene-edited dog No. 210114 and the wild-type dog are shown. Figure 3The results of DRD2 gene editing in the gene-edited dog No. 210114 compared with the wild-type dog are shown. According to sequencing and sequence information comparison, the DRD2 gene editing type of the male dog No. 210114 is a single allele 4bp base sequence (GGAT,) deletion, the base deletion position is located at the G base of the start codon ATG, no new ATG is formed after the mutation, and normal transcription and translation cannot be performed, resulting in the loss of DRD2 protein. The sequence after the base deletion is: GAACTGAAAATCCTGAGGCTGGAGAAGTCTACTAACTGCCGGTGGTTGATTTCAGCTCTGGAGCTTTCCACGGGAGGCAGCACGCTTTGGGAGGTCCTCCTACTCACTTCCTGTGTCCCCGTGTCCATTTTCCCTGACCAGAGCCTGGCCACCCAGTGGCCCCGCTGCCCCGAT----CCACTGAACCTGTCCTGGTACGATGATGATCTGGAGAGCCAGAACTGGAGCCGGCC CTTCAACGGGTCCGAAGGAAAGCCCGGCAAGCCCCACTACAACTACTACGCCATGCTGCTTACCCTGCTCATCTTCATCATCGTCTTCGGCAATGTGCTGGTGTGCATGGCCGTGTCCCGCGAGAAGGCGCTGCAGACCACCACCAACTACCTGATTGTCAGCCTTGCTGTGGCCGAC CTCCTGGTGGCCACGCTCGTCATGCCCTGGGTTGTCTACCTGGAGGTAGGTCTGCACCCCCGCCTGGAAGGAGCTGCCCGGGGGCCTGGAGTCCAGGCTCTGTGCTGGTTCCTGCCAACAAGTTGCCCGGTGCCTTCTCAGCTGGCCTGGCCTCTTCCTCCACTCTGGGCTCAG(SEQ ID NO: 12, where the dotted line is the position where the base sequence is deleted).

[0071] The gene-edited canine somatic cells numbered 210114 were classified and named DRD2 gene knockout positive cell line, and deposited in the General Microbiology Center of China Culture Collection (CGMCC), the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing (postal code 100101), the deposit number is CGMCC No.45183, and the deposit date is June 9, 2022.

[0072] 4. Verification of behavioral phenotype of DRD2 gene-edited dogs

[0073] The photo of the DRD2 gene-edited dog No. 210114 obtained above is as follows Figure 4 shown.

[0074] Three behavioral experiments were conducted on the DRD2 gene-edited dog No. 210114. The results are as follows: Figure 5 As shown, "Str1" represents the social time of the wild-type dog and the DRD2 gene-edited dog No. 210114 with the stranger dog No. 1 in the first stage or the second stage, "Object" represents the social time of the wild-type dog and the DRD2 gene-edited dog No. 210114 with the empty cage of the object in the first stage, and "Str2" represents the social time of the wild-type dog and the DRD2 gene-edited dog No. 210114 with the stranger dog No. 2 in the second stage. "ns" means p value>0.05, no statistical difference; "**" means p value>0.01, significant difference; "***" means p value>0.001, significant difference. The results show that the DRD2 gene-edited positive dog No. 210114 has obvious defects in the same social interaction, which further verifies that the present invention obtains DRD2 gene-edited dogs.

[0075] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A method for establishing a DRD2 gene-edited model dog, the method comprising the following steps: (1) Based on the sequence of the canine DRD2 gene, the target site was determined based on the sequence of exon 1; (2) Synthesizing the sgRNA sequence according to the targeting site determined in step (1), and connecting the synthesized sgRNA sequence to the backbone vector to construct an sgRNA targeting vector; (3) Obtaining in vitro transcription products of sgRNA and CRISPR / Cas9 respectively through in vitro transcription; (4) introducing the sgRNA obtained in step (3) and the in vitro transcription product of CRISPR / Cas9 into canine fertilized eggs or canine somatic cells to obtain canine fertilized eggs or canine somatic cells with DRD2 gene knockout; The method further comprises transplanting the obtained DRD2 gene knockout canine fertilized egg into the oviduct of a recipient female dog, thereby preparing a DRD2 gene-edited model dog; or transplanting the nucleus of the obtained DRD2 gene knockout canine somatic cell into a canine enucleated oocyte, and then transplanting the canine enucleated oocyte after nuclear transplantation into the oviduct of a recipient female dog, thereby preparing a DRD2 gene-edited model dog; in, The sgRNA sequence and its complementary sequence are the following sequences: sgRNA sequence: GACAGGTTCAGTGGATCCATCGG (SEQ ID NO: 2); sgRNA complementary sequence: CCGATGGATCCACTGAACCTGTC (SEQ ID NO: 3).

2. The method according to claim 1, It is characterized in that The canine somatic cells are derived from the following tissues or organs: fetal tissue, skin, muscle, ear, mammary gland, fallopian tube, ovary, blood, urine, fat, bone marrow, blood vessel and luminal endothelium.

3. Canine somatic cells, tissues or organs of a DRD2 gene-edited model dog obtained by the method of claim 1 or 2.

4. The canine somatic cell, tissue or organ according to claim 3, It is characterized in that The canine somatic cell, tissue or organ comprises the sequence shown in SEQ ID NO:

12.

5. The canine somatic cell, tissue or organ according to claim 3, It is characterized in that The classification of the somatic cells is named DRD2 gene knockout positive cell line, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC) with the deposit number CGMCC No.45183 and the deposit date June 9, 2022.

6. A canine DRD2 gene knockout targeting vector, the targeting vector comprising an sgRNA sequence designed for the targeting site sequence of exon 1 of the DRD2 gene and a backbone vector, in, The sgRNA sequence and its complementary sequence are the following sequences: sgRNA sequence: GACAGGTTCAGTGGATCCATCGG (SEQ ID NO: 2); sgRNA complementary sequence: CCGATGGATCCACTGAACCTGTC (SEQ ID NO: 3).

Images