A nanobody against cd7, vhh12, and related products, methods and uses thereof

Abstract

The application discloses an anti-CD7 nanobody VHH12 and related products, methods and uses thereof, the related products including a single-nanobody-based chimeric antigen receptor, a double-nanobody-based chimeric antigen receptor, a recombinant expression vector, an engineered host cell, a conjugate, a pharmaceutical composition, a kit, a reagent for detecting cell surface CD7, the nanobody has good affinity with CD7, a CAR-T cell prepared based on the nanobody has strong tumor antigen target recognition ability and high tumor cell killing activity, and has important clinical application value.

Description

[0001] This application is a divisional application of the patent filed on March 30, 2022, with application number 202210331478.7 and invention title "Anti-CD7 Nanobody, Derivatives and Their Application in Tumor Treatment". Technical Field

[0002] This invention belongs to the field of biomedical technology. Specifically, this invention relates to an anti-CD7 nanobody VHH12 and its related products, methods and uses. Background Technology

[0003] CD7 antigen is a single-chain glycoprotein and a marker antigen molecule in T cell development. In addition to thymocytes, T cells, and natural killer cells in healthy individuals, hematopoietic stem and progenitor cells such as lymphoid and myeloid precursor cells also express CD7. Numerous studies have shown that CD7 molecules are expressed in most human T-cell lymphoblastic leukemias and lymphomas (Karube K, Ohshima K, Tsuchiya T, et al. Non-B, non-T neoplasms with lymphoblast morphology: further clarification and classification[J].The American journal of surgical pathology,2003,27(10):1366-1374.; Shiyong Li, Jonathan Juco, Karen P. Mann, et al. Flow Cytometry in the Differential Diagnosis of Lymphocyte-Rich ThymomaFrom Precursor T-Cell Acute Lymphoblastic Leukemia / Lymphoblastic Lymphoma[J].,American Journal of Clinical Pathology,2004,121:268-274.) and CD7 antigen is expressed in approximately 10% of acute myeloid leukemia (AML) (Foon KA, Todd RF. Immunologic classification of Leukemia and lymphoma[J].Blood.1986,68:1-31); In addition, when CD7 molecules bind to their corresponding antibodies, they undergo rapid endocytosis. This characteristic makes CD7 a suitable antigen receptor for targeted delivery of various functional molecules to CD7-positive cells; Related studies have also shown that there is a population of CD7-negative T lymphocytes in the human body. This population of cells can maintain normal immune function in the human body and avoid the loss of immune function caused by the use of CD7 nanobody-related immune cells to clear all CD7-positive cells. It can be seen that targeting CD7 is a very promising direction for anti-tumor treatment.

[0004] Chimeric antigen receptor modified T cells (CAR-T) and chimeric antigen receptor modified NK cells (CAR-NK) immunotherapy are currently the two most rapidly advancing tumor cell immunotherapies. The effective activation of CAR-T / CAR-NK cells heavily depends on the specificity of antibodies recognizing tumor-associated antigens and the affinity of antigen binding. Therefore, given the current maturity of intracellular signal transduction region design for CAR-T / CAR-NK cells, the design of the antigen-binding region has become a key focus and crucial aspect of novel CAR-T technology development. Camels (alpacas, llamas) and sharks possess a naturally occurring heavy chain antibody (HCAb) lacking a light chain; this antibody contains only one heavy chain variable region and two conventional CH2 and CH3 regions. Its heavy chain variable region possesses stability and antigen-binding activity comparable to heavy chain antibodies. Measuring only 2.4 × 4 nm, it is the smallest fragment capable of binding antigens and is called a single-domain antibody (Variable Domain of Heavy Chain, VHH) or nanobody. Compared to traditional antibodies, VHH single-domain antibodies have small molecular weights and high expression levels, good chemical stability, high affinity, high homology with human antibodies, and low immunogenicity. Their small molecular weight facilitates genetic engineering, allowing for the construction of dual or multi-specific single-domain antibody combinations to achieve multi-target or multi-functional effects with a single molecule. VHHs have good tissue permeability, enabling them to reach relatively hidden targets that cannot be accessed by conventional antibodies during tumor treatment. Due to these advantages, utilizing single-domain antibodies as the antigen-binding region of CARs for CAR modification and CAR-T / CAR-NK cell therapy can provide novel tumor treatment strategies in this field. Summary of the Invention

[0005] Therefore, the purpose of this invention is to provide the art with an anti-CD7 nanobody VHH12 and related products, methods and uses.

[0006] The above-mentioned objectives of the present invention are achieved through the following technical solutions:

[0007] A first aspect of the present invention provides an anti-CD7 nanobody.

[0008] Furthermore, the nanobody is VHH12;

[0009] The amino acid sequences of CDR1, CDR2, and CDR3 of the VHH12 are shown in SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7, respectively.

[0010] The amino acid sequences of CDR1, CDR2, and CDR3 of the nanobody VHH12 of the present invention further include amino acid sequences that have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity with the amino acid sequences shown in SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7, respectively.

[0011] Furthermore, the nucleotide sequences of CDR1, CDR2, and CDR3 of the VHH12 are shown in SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8, respectively;

[0012] The nucleotide sequences of CDR1, CDR2, and CDR3 of the nanobody VHH12 of the present invention further include nucleotide sequences having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity with the nucleotide sequences shown in SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8, respectively.

[0013] Preferably, the amino acid sequence of VHH12 is shown in SEQ ID NO:1;

[0014] The amino acid sequence of the nanobody VHH12 of the present invention further includes an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity with the amino acid sequence shown in SEQ ID NO:1.

[0015] More preferably, the nucleotide sequence of the VHH12 is shown in SEQ ID NO:2;

[0016] The nucleotide sequence of the nanobody VHH12 of the present invention further includes a nucleotide sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity with the nucleotide sequence shown in SEQ ID NO:2.

[0017] Furthermore, the humanized nanobody VHH12 prepared using conventional nanobody humanization methods is also included within the scope of protection of this invention.

[0018] Furthermore, CD7 is a very stable marker on the surface of T cells. Both naive and mature T cells express CD7. Therefore, patients with naive T-cell tumors (T-ALL / LBL / NKT cell leukemia) and mature T-cell tumors (peripheral T-cell lymphoma, NKT-cell lymphoma, anaplastic large cell lymphoma) generally express CD7 highly. As a result, CAR-T therapy targeting this marker is one of the fastest-growing technologies in clinical practice.

[0019] A second aspect of the present invention provides a chimeric antigen receptor based on a single nanobody.

[0020] Furthermore, the chimeric antigen receptor comprises the nanobody described in the first aspect of the present invention;

[0021] Preferably, the chimeric antigen receptor further comprises a transmembrane domain;

[0022] Preferably, the chimeric antigen receptor further comprises an intracellular signal transduction domain;

[0023] Preferably, the chimeric antigen receptor further includes a hinge region;

[0024] Preferably, the chimeric antigen receptor further comprises a signal peptide;

[0025] Preferably, the chimeric antigen receptor further includes a co-stimulatory signaling domain;

[0026] Preferably, the chimeric antigen receptor further comprises a promoter EF1α, a self-splitting peptide T2A, and a detection tag / helper element tEGFR;

[0027] Preferably, the chimeric antigen receptor further comprises a tEGFR signal peptide;

[0028] More preferably, the transmembrane domain includes the transmembrane domains of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, and IL-11 receptor;

[0029] More preferably, the intracellular signal transduction domain includes the intracellular signal transduction domains of the following molecules: CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, TCRζ, CD4, CD5, CD8, CD21, CD22, CD79a, CD79b, CD278, FcεRI, DAP10, DAP12, CD66d;

[0030] More preferably, the hinge region includes the hinge regions of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, and IL-11 receptor.

[0031] More preferably, the signal peptide includes signal peptides of the following molecules: α and β chains of T cell receptors, CD3ζ, CD3ε, CD4, CD5, CD8, CD9, CD28, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, GITR, and GM-CSF;

[0032] More preferably, the co-stimulatory signaling domain includes the co-stimulatory signaling domains of the following molecules: 4-1BB (CD137), CD27, CD19, CD4, CD28, ICOS (CD278), CD8α, CD8β, BAFFR, HVEM, LIGHT, KIRDS2, SLAMF7, NKp30, NKp46, CD40, CDS, ICAM-1, B7-H3, OX40, DR3, GITR, CD30, TIM1, CD2, CD7, CD226;

[0033] Most preferably, the transmembrane domain is a CD8α transmembrane domain;

[0034] Most preferably, the intracellular signal transduction domain is the CD3ζ intracellular signal transduction domain;

[0035] Most preferably, the hinge region is a CD8α hinge region;

[0036] Most preferably, the co-stimulation signal structure domain is a 4-1BB co-stimulation signal structure domain;

[0037] Most preferably, the amino acid sequence of the signal peptide is as shown in SEQ ID NO:17 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:17.

[0038] Most preferably, the nucleotide sequence of the signal peptide is as shown in SEQ ID NO:18 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:18.

[0039] Most preferably, the amino acid sequence of the CD8α hinge region is as shown in SEQ ID NO:19 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:19.

[0040] Most preferably, the nucleotide sequence of the CD8α hinge region is as shown in SEQ ID NO:20 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:20.

[0041] Most preferably, the amino acid sequence of the CD8α transmembrane domain is as shown in SEQ ID NO:21 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:21.

[0042] Most preferably, the nucleotide sequence of the CD8α transmembrane domain is as shown in SEQ ID NO:22 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:22.

[0043] Most preferably, the amino acid sequence of the 4-1BB co-stimulatory signaling domain is as shown in SEQ ID NO:23 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:23.

[0044] Most preferably, the nucleotide sequence of the 4-1BB co-stimulatory signal domain is as shown in SEQ ID NO:24 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:24.

[0045] Most preferably, the amino acid sequence of the CD3ζ intracellular signal transduction domain is as shown in SEQ ID NO:25 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:25.

[0046] Most preferably, the nucleotide sequence of the CD3ζ intracellular signal transduction domain is as shown in SEQ ID NO:26 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:26;

[0047] Most preferably, the amino acid sequence of T2A is as shown in SEQ ID NO:27 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:27;

[0048] Most preferably, the nucleotide sequence of T2A is as shown in SEQ ID NO:28 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:28;

[0049] Most preferably, the nucleotide sequence of said EF1α is as shown in SEQ ID NO:29 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:29;

[0050] Most preferably, the amino acid sequence of the tEGFR signal peptide is as shown in SEQ ID NO:30 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:30.

[0051] Most preferably, the nucleotide sequence of the tEGFR signal peptide is as shown in SEQ ID NO:31 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:31.

[0052] Most preferably, the amino acid sequence of the tEGFR is as shown in SEQ ID NO:32 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:32.

[0053] Most preferably, the nucleotide sequence of the tEGFR is as shown in SEQ ID NO:33 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:33.

[0054] Most preferably, the chimeric antigen receptor is obtained by sequentially connecting EF1α, a signal peptide, the nanobody described in the first aspect of the present invention, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB co-stimulatory signaling domain, a CD3ζ intracellular signal transduction domain, T2A, a tEGFR signal peptide, and tEGFR.

[0055] A third aspect of the present invention provides a chimeric antigen receptor based on dual nanobodies.

[0056] Furthermore, the chimeric antigen receptor comprises two nanobodies, one of which is the nanobodies described in the first aspect of the present invention, and the other of which is the nanobodies described in the first aspect of the present invention or nanobodies VHH06.

[0057] Preferably, the amino acid sequences of CDR1, CDR2, and CDR3 of VHH06 are as shown in SEQ ID NO:11, SEQ ID NO:13, and SEQ ID NO:15, respectively, or have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity with SEQ ID NO:11, SEQ ID NO:13, and SEQ ID NO:15, respectively.

[0058] More preferably, the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH06 are as shown in SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:16, respectively, or have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity with SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:16, respectively.

[0059] Most preferably, the amino acid sequence of VHH06 is as shown in SEQ ID NO:9 or has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:9;

[0060] Most preferably, the nucleotide sequence of VHH06 is as shown in SEQ ID NO:10 or an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:10;

[0061] Preferably, the chimeric antigen receptor further comprises a transmembrane domain;

[0062] Preferably, the chimeric antigen receptor further comprises an intracellular signal transduction domain;

[0063] Preferably, the chimeric antigen receptor further includes a hinge region;

[0064] Preferably, the chimeric antigen receptor further comprises a signal peptide;

[0065] Preferably, the chimeric antigen receptor further includes a co-stimulatory signaling domain;

[0066] Preferably, the chimeric antigen receptor further comprises a promoter EF1α, a self-splitting peptide T2A, and a detection tag / helper element tEGFR;

[0067] Preferably, the chimeric antigen receptor further comprises a tEGFR signal peptide;

[0068] More preferably, the transmembrane domain includes the transmembrane domains of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, and IL-11 receptor;

[0069] More preferably, the intracellular signal transduction domain includes the intracellular signal transduction domains of the following molecules: CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, TCRζ, CD4, CD5, CD8, CD21, CD22, CD79a, CD79b, CD278, FcεRI, DAP10, DAP12, CD66d;

[0070] More preferably, the hinge region includes the hinge regions of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, and IL-11 receptor.

[0071] More preferably, the signal peptide includes signal peptides of the following molecules: α and β chains of T cell receptors, CD3ζ, CD3ε, CD4, CD5, CD8, CD9, CD28, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, GITR, and GM-CSF;

[0072] More preferably, the co-stimulatory signaling domain includes the co-stimulatory signaling domains of the following molecules: 4-1BB (CD137), CD27, CD19, CD4, CD28, ICOS (CD278), CD8α, CD8β, BAFFR, HVEM, LIGHT, KIRDS2, SLAMF7, NKp30, NKp46, CD40, CDS, ICAM-1, B7-H3, OX40, DR3, GITR, CD30, TIM1, CD2, CD7, CD226;

[0073] Most preferably, the transmembrane domain is a CD8α transmembrane domain;

[0074] Most preferably, the intracellular signal transduction domain is the CD3ζ intracellular signal transduction domain;

[0075] Most preferably, the hinge region is a CD8α hinge region;

[0076] Most preferably, the co-stimulation signal structure domain is a 4-1BB co-stimulation signal structure domain;

[0077] Most preferably, the two nanobodies are linked by a linker peptide.

[0078] Most preferably, the chimeric antigen receptor is formed by sequentially connecting EF1α, a signal peptide, one of the two nanobodies, a linker, the other of the two nanobodies, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB co-stimulatory signaling domain, a CD3ζ intracellular signal transduction domain, T2A, tEGFR signal peptide, and tEGFR.

[0079] Most preferably, the chimeric antigen receptor is obtained by sequentially connecting EF1α, a signal peptide, the nanobody described in the first aspect of the present invention, a linker, the nanobody described in the first aspect of the present invention, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB co-stimulatory signal domain, a CD3ζ intracellular signal transduction domain, T2A, a tEGFR signal peptide, and tEGFR.

[0080] Most preferably, the chimeric antigen receptor is obtained by sequentially connecting EF1α, a signal peptide, a nanobody VHH06, a linker, the nanobody described in the first aspect of the present invention, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB co-stimulatory signaling domain, a CD3ζ intracellular signal transduction domain, T2A, a tEGFR signal peptide, and tEGFR.

[0081] Most preferably, the amino acid and nucleotide sequences of the signal peptide, CD8α hinge region, CD8α transmembrane domain, 4-1BB co-stimulatory signaling domain, CD3ζ intracellular signal transduction domain, T2A, EF1α, tEGFR signal peptide, and tEGFR are as described above.

[0082] A fourth aspect of the present invention provides a nucleic acid molecule.

[0083] Furthermore, the nucleic acid molecule comprises a nucleotide sequence encoding the nanobody described in the first aspect of the present invention, the chimeric antigen receptor described in the second aspect of the present invention, or the chimeric antigen receptor described in the third aspect of the present invention;

[0084] Preferably, the nucleotide sequence of the nanobody described in the first aspect of the present invention is as shown in SEQ ID NO:2;

[0085] Preferably, the nucleotide sequence of the signal peptide in the chimeric antigen receptor of the second aspect of the present invention or the chimeric antigen receptor of the third aspect of the present invention is as shown in SEQ ID NO:18, the nucleotide sequence of the CD8α hinge region is as shown in SEQ ID NO:20, the nucleotide sequence of the CD8α transmembrane domain is as shown in SEQ ID NO:22, the nucleotide sequence of the 4-1BB co-stimulatory signal domain is as shown in SEQ ID NO:24, the nucleotide sequence of the CD3ζ intracellular signal transduction domain is as shown in SEQ ID NO:26, the nucleotide sequence of T2A is as shown in SEQ ID NO:28, the nucleotide sequence of EF1α is as shown in SEQ ID NO:29, the nucleotide sequence of the tEGFR signal peptide is as shown in SEQ ID NO:31, and the nucleotide sequence of tEGFR is as shown in SEQ ID NO:33.

[0086] A fifth aspect of the present invention provides a recombinant expression vector.

[0087] Furthermore, the recombinant expression vector comprises the nucleic acid molecule described in the fourth aspect of the present invention;

[0088] Preferably, the expression vector includes a DNA vector, an RNA vector, a plasmid, a transposon vector, a CRISPR / Cas9 vector, or a viral vector; more preferably, the viral vector includes a lentiviral vector, an adenovirus vector, or a retroviral vector.

[0089] A sixth aspect of the invention provides engineered host cells.

[0090] Furthermore, the engineered host cells express the nanobody described in the first aspect of the present invention, the chimeric antigen receptor described in the second aspect of the present invention, or the chimeric antigen receptor described in the third aspect of the present invention;

[0091] Preferably, the engineered host cell comprises the recombinant expression vector described in the fifth aspect of the present invention;

[0092] Preferably, the engineered host cells comprise engineered immune cells; more preferably, the engineered immune cells comprise T cells, NK cells, iNKT cells, CTL cells, monocytes, macrophages, dendritic cells, and NKT cells.

[0093] The seventh aspect of the present invention provides a conjugate or pharmaceutical composition or kit or reagent for detecting CD7 protein.

[0094] Furthermore, the conjugate comprises the nanobody described in the first aspect of the present invention, and a modification portion attached to the nanobody, the modification portion comprising a detectable label or a therapeutic agent;

[0095] Preferably, the detectable markers include enzymes, radionuclides, fluorescent dyes, luminescent substances, and biotin;

[0096] Preferably, the therapeutic agent comprises a drug or cytotoxic agent with antitumor activity;

[0097] Preferably, the pharmaceutical composition or kit comprises the nanobody described in the first aspect of the present invention, the chimeric antigen receptor described in the second aspect of the present invention, the chimeric antigen receptor described in the third aspect of the present invention, the nucleic acid molecule described in the fourth aspect of the present invention, the recombinant expression vector described in the fifth aspect of the present invention, the engineered host cell described in the sixth aspect of the present invention, or the conjugate.

[0098] Preferably, the reagent for detecting CD7 protein comprises the nanobody or the conjugate described in the first aspect of the present invention.

[0099] Furthermore, the pharmaceutical composition also contains additional pharmaceutically active agents; preferably, the additional pharmaceutically active agents include additional antibodies, fusion proteins, or drugs (such as antitumor drugs, drugs for radiotherapy, or chemotherapeutic drugs).

[0100] Furthermore, the pharmaceutical composition also contains a pharmaceutically acceptable carrier and / or excipient.

[0101] The eighth aspect of the present invention provides any of the following methods:

[0102] (1) A method for detecting CD7 protein for non-diagnostic purposes, the method comprising the following steps:

[0103] ① Obtain samples containing CD7 protein;

[0104] ② Contact the sample collected in step ① with the nanobody described in the first aspect of the present invention or the conjugate described in the seventh aspect of the present invention;

[0105] ③ Detect the presence of antibody-antigen complexes;

[0106] (2) A method for preparing engineered host cells according to the sixth aspect of the present invention, the method comprising the following steps: introducing the recombinant expression vector according to the fifth aspect of the present invention into host cells;

[0107] Preferably, the method of introduction includes lipid transfection, microinjection, electroporation, DNA vector, RNA vector, retroviral vector, lentiviral vector, poxvirus vector, herpes simplex virus vector, adenovirus vector, and adeno-associated virus vector.

[0108] The ninth aspect of the present invention provides for application in any of the following aspects:

[0109] (1) The application of the nanobody described in the first aspect of the present invention in the detection of CD7 protein for non-diagnostic and therapeutic purposes;

[0110] (2) The application of the nanobody described in the first aspect of the present invention in the preparation of reagents or kits for detecting CD7 protein;

[0111] (3) The application of the nanobody described in the first aspect of the present invention, the chimeric antigen receptor described in the second aspect of the present invention, the chimeric antigen receptor described in the third aspect of the present invention, the nucleic acid molecule described in the fourth aspect of the present invention, the recombinant expression vector described in the fifth aspect of the present invention, or the engineered host cell described in the sixth aspect of the present invention in the preparation of antitumor drugs;

[0112] (4) The application of the nucleic acid molecule described in the fourth aspect of the present invention or the recombinant expression vector described in the fifth aspect of the present invention in the preparation of engineered host cells, wherein the engineered host cells are the engineered host cells described in the sixth aspect of the present invention;

[0113] Preferably, the antitumor drug includes antitumor immune cell therapy agents and antitumor gene therapy drugs;

[0114] Preferably, the tumor is a CD7-expressing tumor;

[0115] More preferably, the tumor is a T-lymphocyte lineage hematologic malignancy;

[0116] Most preferably, the tumor includes acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T-cell lymphoma (PTCL), NKT cell lymphoma, and anaplastic large cell lymphoma (ALCL).

[0117] The present invention also provides a method for preventing and / or treating subjects with CD7-expressing tumors.

[0118] Furthermore, the method includes administering to the subject an effective amount of the engineered host cell described in the sixth aspect of the present invention or the pharmaceutical composition described in the seventh aspect of the present invention.

[0119] Furthermore, the engineered host cells comprise immune cells expressing anti-CD7 based chimeric antigen receptors (CARs) based on single nanobodies as described in the second aspect of the present invention or chimeric antigen receptors based on dual nanobodies as described in the third aspect of the present invention.

[0120] Preferably, the immune cells include T cells, NK cells, iNKT cells, CTL cells, monocytes, macrophages, dendritic cells, and NKT cells; more preferably, the engineered host cells are CAR-T cells.

[0121] Furthermore, the engineered host cells described herein were administered to the subject in amounts selected from the following:

[0122] (1) If the subject's weight is less than 100 kg and age is less than 18 years, then the value is approximately 0.05 × 10⁻⁶. 6 The number of CAR-T cells / kg of the subject's body weight was at least 5.0 × 10⁻⁶. 7 The number of CAR-T cells / kg of the subject's body weight;

[0123] (2) If the subject's weight is 100 kg or greater, or their age is greater than 18 years, then the value is approximately 0.05 × 10⁻⁶. 6 The number of CAR-T cells / kg of the subject's body weight was at least 5.0 × 10⁻⁶. 8 The number of CAR-T cells per kg of the subject's body weight.

[0124] In some embodiments of the invention, the CAR-T cell therapy is performed via autologous transfer, wherein cells are isolated and / or otherwise prepared from a subject receiving the cell therapy or from a sample derived from such a subject. Thus, in some aspects, the cells are derived from a subject requiring treatment (e.g., a patient), and the cells are administered to the same subject after isolation and processing.

[0125] In other embodiments of the invention, the CAR-T cell therapy is performed via allogeneic transfer, wherein cells are isolated and / or otherwise prepared from a subject other than the subject to receive or ultimately receive the cell therapy (e.g., a first subject). In such embodiments, the cells are then administered to a different subject of the same species, such as a second subject. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.

[0126] In specific embodiments of the invention, the CAR-T cells can be administered by any suitable method, such as by bolus infusion, injection (e.g., intravenous or subcutaneous injection, intraocular injection, periocular injection, subretinal injection, intravitreal injection, transseptal injection, subscleral injection, intrachoroidal injection, anterior chamber injection, subconjunctival injection, sub-Tenon injection, retroocular injection, periocular injection, or posterior juxtascleral delivery). In some embodiments, they are administered via parenteral, intrapulmonary, and intranasal administration, as well as (if necessary for local treatment) intralesional administration. Parenteral infusion includes intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In some embodiments, a given dose is administered by a single bolus injection of the cells. In some embodiments, a given dose is administered by, for example, multiple bolus injections of the cells over a period not exceeding 3 days, or by continuous infusion of the cells. In some implementations, the administration of cell doses or any other therapy (e.g., lymphocyte clearance therapy, intervention therapy, and / or combination therapy) is performed via outpatient delivery.

[0127] Furthermore, for the prevention or treatment of a disease, the appropriate dosage may depend on the type of disease to be treated, the type of cells, the severity and course of the disease, whether the cells are administered for preventative or therapeutic purposes, prior treatment, the subject's clinical history and response to the cells, and the attending physician's decision. In some embodiments, it is suitable to administer the pharmaceutical composition and / or CAR-T cells to the subject once or in a series of treatments.

[0128] In some embodiments, the CAR-T cells are administered as part of a combination therapy, such as simultaneously or sequentially with another or additional therapeutic intervention (e.g., antibodies or engineered cells or receptors or agents, such as cytotoxic agents or therapeutic agents). In some embodiments, the CAR-T cells are administered co-administered with one or more additional therapeutic agents or in combination with another therapeutic intervention (simultaneously or sequentially). In some embodiments, the additional therapeutic agent is any interventional preparation or agent known to those skilled in the art for use in tumor interventional therapy, and in some embodiments, the cells are administered prior to the one or more additional therapeutic agents. In some embodiments, the cells are administered after the one or more additional therapeutic agents. In some embodiments, the one or more additional agents include cytokines such as IL-2 to, for example, enhance persistence. In some embodiments, the method includes administering a chemotherapy agent. In some embodiments, the method includes administering a chemotherapy agent (e.g., a conditioning chemotherapy agent) prior to the administration, for example, to reduce tumor burden. In some embodiments, preconditioning the subject with immune clearance (e.g., lymphocyte clearance) therapy can improve the efficacy of cell therapy.

[0129] In some embodiments, the methods and applications provided involve administering all or part of CAR-T cells or pharmaceutical compositions, such as engineered immune cells expressing chimeric antigen receptors (CARs) as described in the second aspect of the invention or the chimeric antigen receptors as described in the third aspect of the invention. In some embodiments, a specific amount or number of cells, or a specific amount of pharmaceutical composition containing said specific amount or number of cells, is administered to a subject. In some embodiments, one or more cell doses containing said specific amount or number of cells or a specific amount of pharmaceutical composition containing said specific amount or number of cells are administered to a subject. In some embodiments, a dose of cells is administered to a subject according to the provided method and / or using the provided article or composition. In some embodiments, the size, amount, or timing of the dose is determined based on the age of the subject. In some embodiments, the size, amount, or timing of the dose is determined based on the weight of the subject. In some embodiments, the size, amount, or timing of the dose is determined based on the specific type of tumor in the subject.

[0130] The present invention also provides a method for diagnosing whether a subject has a CD7-expressing tumor.

[0131] Furthermore, the method includes the following steps:

[0132] (1) Provide samples from subjects suspected of having CD7-expressing tumors;

[0133] (2) Contact the sample with the nanobody described in the first aspect of the present invention;

[0134] (3) Detect the formation of the complex containing the nanobody and the antigen, obtain the amount of CD7 in the sample from the subject, compare the amount of CD7 in the sample from the subject with its amount in a known standard or reference sample, and determine whether the CD7 level in the sample from the subject falls within the tumor-associated CD7 level.

[0135] Preferably, the sample may be selected from urine, blood, serum, plasma, saliva, ascites, circulating cells, circulating tumor cells, non-tissue-associated cells, tissues, or histological preparations;

[0136] Preferably, the tumor is a T-cell hematologic malignancy; more preferably, the tumor includes acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T-cell lymphoma (PTCL), NKT cell lymphoma, and anaplastic large cell lymphoma (ALCL).

[0137] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows:

[0138] This invention provides an anti-CD7 nanobody, VHH12, which exhibits good affinity for CD7. The nanobody is modified with a chimeric antigen receptor, serving as the antigen-binding region of a chimeric antigen receptor, and then used in CAR-T cell therapy. Compared to traditional CAR-T cells constructed based on monoclonal antibodies (scFv), the CAR-T cells constructed based on single or dual nanobodies of this invention offer several advantages. They effectively avoid the common defects of traditional scFv-based CAR-T cells, such as expression difficulties and poor stability, and significantly enhance the ability of immune cells to target and recognize tumor antigens, thereby strengthening their killing activity against tumor cells. This invention shows broad application prospects. Attached Figure Description

[0139] Figure 1 Image showing the SDS-PAGE results of CD7 antigen purification;

[0140] Figure 2 Flowchart of alpaca immunization process;

[0141] Figure 3 This image shows the results of the first round of PCR amplification during the construction of the nanobody library.

[0142] Figure 4 This image shows the results of the second round of PCR amplification during the construction of the nanobody library.

[0143] Figure 5 The image shows the PCR results for detecting the diversity of the nanobody library.

[0144] Figure 6 A graph showing the ratio of positive to negative phage groups after phage screening;

[0145] Figure 7 A graph showing the statistical results of OD values ​​for monoclonal antibody screening;

[0146] Figure 8 A graph showing the statistical results of monoclonal screening and identification;

[0147] Figure 9 This is a schematic diagram of a single VHH CAR-T structure;

[0148] Figure 10 Flowchart for lentivirus packaging;

[0149] Figure 11 CAR-T cell culture flowchart;

[0150] Figure 12 A representative image of flow cytometry results for single VHH CAR-T cells;

[0151] Figure 13 A statistical graph showing the average MFI results of CD7+ cells from single VHH CAR-T cells;

[0152] Figure 14 A graph showing the statistical results of the killing ratio of single VHH CAR-T cells;

[0153] Figure 15 A graph showing the statistical results of the average MFI value of a single VHH K562 cell line;

[0154] Figure 16 This is a graph showing the results of a single VHH specificity detection.

[0155] Figure 17 A representative image of flow cytometry results for single VHH CAR-T cells;

[0156] Figure 18 The image shows the average MFI results for CD7+ cells in single VHH CAR-T cells.

[0157] Figure 19 The image shows the alignment results of the source sequence with DP-47, template h-NbBcII10PGLA, and the original sequence, highlighting the mutation sites.

[0158] Figure 20 This is a schematic diagram of a dual VHH CAR-T structure;

[0159] Figure 21A representative image of flow cytometry results for dual VHH CAR-T cells;

[0160] Figure 22 Statistical graph of average MFI results for CD7+ cells in single VHH CAR-T cells and double VHH CAR-T cells;

[0161] Figure 23 The graph shows the expansion curve results of dVHH-D CAR-T cells;

[0162] Figure 24 The image shows the killing results of dVHH-D CAR-T cells;

[0163] Figure 25 The graph shows the expansion curve results of dVHH-E CAR-T cells;

[0164] Figure 26 The image shows the killing effect of dVHH-E CAR-T cells. Detailed Implementation

[0165] The present invention will be further illustrated below with reference to specific embodiments. These embodiments are for illustrative purposes only and should not be construed as limiting the invention. Those skilled in the art will understand that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention. The scope of the invention is defined by the claims and their equivalents. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the reagents and materials used in the following embodiments are commercially available unless otherwise specified.

[0166] Example 1 Antigen Preparation

[0167] 1. Experimental Methods

[0168] RNA was extracted from T cells using an RNA extraction kit. (Refer to SuperScript) TM II. Following the instructions for using Reverse Transcriptase, reverse transcription was performed using random primers to obtain cDNA. Using the cDNA as a template, the extracellular region gene sequence of the CD7 antigen was obtained by PCR. The CD7 extracellular region gene sequence was ligated into a protein expression vector for expression, followed by Ni column purification to obtain purified CD7-His protein.

[0169] 2. Experimental Results

[0170] See results Figure 1The results showed that, after SDS-PAGE analysis, the present invention successfully prepared a CD7 antigen with a size of 17.2 kDa and a purity of >90%, which can be used for subsequent alpaca immunization.

[0171] Example 2: Construction of Nanobody Library

[0172] 1. Experimental Methods

[0173] (1) Alpaca were immunized using the CD7-His protein purified independently in this invention as described in Example 1. The specific alpaca immunization flowchart is shown below. Figure 2 Immunization was performed once a week for a total of 6 consecutive immunizations; (3) 100 mL of peripheral blood was collected 7 days after the last immunization, peripheral blood mononuclear cells were separated by Ficoll density gradient centrifugation, RNA was extracted, and cDNA was prepared using a reverse transcription kit; (4) VHH fragments were obtained by SOE-PCR and ligated into the pMES4 phage display vector; (5) The ligation product was electroporated into electrocompetent TG1 cells, and the resulting bacterial library was the constructed CD7 single-domain heavy chain antibody phage display library with a library size of 3.37 × 10⁻⁶. 8 (6) After the library was constructed, in order to test the insertion efficiency of the library, 25 clones were randomly selected and colony PCR was performed using primers MP57 and GⅢ, and the PCR products were sequenced by Sanger sequencing.

[0174] 2. Experimental Results

[0175] The results of the first round of PCR amplification are shown in the figure. Figure 3 The results showed that after the first round of PCR, a DNA fragment of approximately 700 bp was recovered. The results of the second round of PCR amplification are shown in the figure below. Figure 4 The results showed that after the second round of PCR, a DNA fragment of approximately 400 bp was recovered. After library construction, to test the insertion efficiency, 25 clones were randomly selected for colony PCR using primers MP57 and GⅢ, and the PCR products were subjected to Sanger sequencing. The results showed an insertion rate of approximately 95% (see...). Figure 5 ).

[0176] Example 3: Enrichment and Screening of Nanobodies

[0177] 1. Amplification of phage nanobody library

[0178] (1) Transfer the TG1 E. coli nanobody library to 2-YT liquid medium and incubate at 37°C and 200 rpm until the OD value reaches 0.5. Then, add helper phage VCSM13 to infect the cells. After gently mixing, incubate at 37°C for 30 minutes. Centrifuge the bacterial culture to remove trace amounts of glucose, and then resuspend the precipitate in 2-YT medium containing both ampicillin and kanamycin resistance. Incubate overnight at 37°C and 200 rpm to amplify the phage displaying the nanobody. (2) Transfer the overnight culture to a 50 mL centrifuge tube, centrifuge to collect the supernatant, and add 20% (wt / vol) PEG6000 / 2.5M NaCl solution to precipitate the phage. Centrifuge and discard the supernatant, resuspend the precipitate in PBS, centrifuge to collect the supernatant in a new centrifuge tube, add 20% (wt / vol) PEG6000 / 2.5M NaCl solution to reprecipitate the phage. Centrifuge and discard the supernatant, and resuspend the precipitate in 1 mL PBS. After centrifugation, the supernatant was transferred to a new centrifuge tube, and glycerol was added to a final concentration of 20% and stored at -80℃; (3) phage nanobody library titer determination: phages were diluted in a 10-fold gradient, and phages of different dilutions were used to infect TG1 bacteria in the logarithmic growth phase. The bacteria were cultured overnight at 37℃, and the titer of the phage nanobody library was calculated based on the number of plaques on the second day.

[0179] 2. Phage enrichment and screening

[0180] (1) The nanobodies were panned by ELISA. The recombinant CD7-His protein was coated onto the microplate and incubated overnight at 4°C. (2) The microplate was washed three times with 250 μL PBST, and 200 μL blocking buffer was added. The microplate was incubated at room temperature for 2 h. (3) The corresponding phage was added to each well and incubated at room temperature for 2 h. (4) The microplate was washed 15 times with 250 μL PBST. (5) 100 μL of 0.25 mg / mL trypsin was added to each well and incubated at 700 rpm for 0.5 h at room temperature. (6) The phage was eluted with AEBSF. (7) The titer of the eluted phage was determined and the phage infection was amplified. (8) When the number of eluted phages was ≥100 (positive: negative), the panning was stopped.

[0181] 3. Experimental Results

[0182] The selection results are shown in Table 1 and Figure 6 After two rounds of selection, the ratio of positive to negative groups reached 438 times, meeting the criteria for screening monoclonal clones. Therefore, after two rounds of selection, the selection process was stopped, and the next step of screening and identification of monoclonal clones was carried out.

[0183] Table 1. Phage panning results

[0184] Number of filters CD7 blank Proportion First screening <![CDATA[8×10 6 ]]> <![CDATA[2×10 5 ]]> 40 Second screening <![CDATA[3.51×10 8 ]]> <![CDATA[8×10 5 ]]> 438

[0185] Example 4: Screening and Identification of Positive Monoclonal Clones

[0186] 1. Experimental Methods

[0187] (1) Select single clones from the TG1 E. coli library obtained after 2-3 rounds of screening for expansion culture, and use helper phage VCSM13 for infection to prepare single-clone phages. (2) Use an appropriate amount of nanobody phages and K562-CD7 positive cells, and incubate at room temperature for 2 hours. (3) After washing the plate with PBST, add HA-HRP antibody and incubate at room temperature for 1 hour. (4) After washing the plate with PBST, add 100 μL of LMB single-component chromogenic solution, incubate at room temperature for 30 minutes, and then add 100 μL of stop solution. (5) Use an ELISA reader to detect the absorbance at 450 nm. (6) When the OD450 value of the sample well is greater than 2 compared with the blank control, it is judged as a positive clone. (7) Perform bacterial PCR on the positive clones and perform Sanger sequencing. (8) Use DNAMAN software to align the sequences of the single clones after Sanger sequencing. And screen out the clones with sequence specificity.

[0188] 2. Experimental Results

[0189] This embodiment screened 864 single clones across 9 96-well plates. The OD values ​​of the single clones are as follows: Figure 7 As shown, calculations were performed according to the calculation principles, and 231 positive clones and 17 sequence-specific clones were identified. Figure 8As shown, the sequence-specific nanobodies are numbered VHH01-VHH20 (excluding VHH02, VHH05, and VHH11), namely VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19, and VHH20. The amino acid sequences of CDR1, CDR2, and CDR3 of VHH12 are shown in SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7, respectively. The nucleotide sequences of CDR1, CDR2, and CDR3 of VHH12 are shown in SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8, respectively. The amino acid sequence of VHH12 is shown in SEQ ID NO:4. As shown in NO:1, the nucleotide sequence of VHH12 is shown in SEQ ID NO:2; the amino acid sequences of CDR1, CDR2, and CDR3 of VHH06 are shown in SEQ ID NO:11, SEQ ID NO:13, and SEQ ID NO:15, respectively; the nucleotide sequences of CDR1, CDR2, and CDR3 of VHH06 are shown in SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:16, respectively; the amino acid sequence of VHH06 is shown in SEQ ID NO:9; and the nucleotide sequence of VHH06 is shown in SEQ ID NO:10.

[0190] Example 5: Preparation and in vitro functional verification of single VHH CAR-T cells

[0191] 1. Construction of a single VHH CAR structure

[0192] (1) Constructing single VHH CAR structures from sequence-specific clones. First, the VHH sequence of positive clones was amplified using PCR. The primers for the first round of PCR were:

[0193] NCAR-F1: 5'-CTGCAGGAGTCTGGRGGAGG-3'

[0194] NCAR-R1: 5'-TGAGGAGACGGTGACCTGGG-3'

[0195] After the first round of PCR, the PCR products from the first round were used as templates for the second round of PCR. The primers for the second round of PCR were:

[0196] NCAR-F2: 5'-TTTCTGCTGATCCCCCAGGTGCAGCTGCAGGAGTCTGGRGGAGG-3'

[0197] NCAR-R2: 5'-TAGGAGCCGGGGTGGGCGGCCGCGTCTGGGGTAGTTGAGGAGACGGTGACCTGGG-3'

[0198] (2) The second-round PCR product was ligated into the vector Senl-S88BZ via homologous recombination, and the vector was digested with Not I. At this point, the CAR structure containing a single VHH targeting CD7 was successfully constructed. A total of 17 single VHH sequences were constructed, named VHH01 to VHH20 (excluding 02, 05, and 11). A schematic diagram of the constructed single VHH CAR-T structure is shown below. Figure 9 As shown, EF1α is the promoter of elongation factor 1α, leader is the coding sequence of the signal peptide, VHH is the coding sequence of the anti-CD7 nanobody, CD8H+TM is the CD8 hinge region and transmembrane region, and 4-1BB and CD3ζ intracellular signal regions are intracellular co-stimulatory domains. The extracellular region of tEGFR is expressed through T2A peptide so that CAR expression can be detected after viral transduction.

[0199] The amino acid sequence of the signal peptide in the CAR is shown in SEQ ID NO:17, and the nucleotide sequence is shown in SEQ ID NO:18; the amino acid sequence of the CD8α hinge region is shown in SEQ ID NO:19, and the nucleotide sequence is shown in SEQ ID NO:20; the amino acid sequence of the CD8α transmembrane domain is shown in SEQ ID NO:21, and the nucleotide sequence is shown in SEQ ID NO:22; the amino acid sequence of the 4-1BB co-stimulatory signal domain is shown in SEQ ID NO:23, and the nucleotide sequence is shown in SEQ ID NO:24; the amino acid sequence of the CD3ζ intracellular signal transduction domain is shown in SEQ ID NO:25, and the nucleotide sequence is shown in SEQ ID NO:26; the amino acid sequence of T2A is shown in SEQ ID NO:27, and the nucleotide sequence is shown in SEQ ID NO:28; the nucleotide sequence of EF1α is shown in SEQ ID NO:29; the amino acid sequence of the tEGFR signal peptide is shown in SEQ ID NO:30, and the nucleotide sequence is shown in SEQ ID NO:31; the amino acid sequence of tEGFR is shown in SEQ ID NO:32, and the nucleotide sequence is shown in SEQ ID NO:39. Shown in NO:33.

[0200] 2. Preparation of single VHH CAR-T cells

[0201] Before preparing CAR-T cells, lentiviruses were packaged: (1) the target plasmid and three helper plasmids (pMD2.G, pRSV-REV, pMDLg) were co-transfected into 293FT cells under the action of PEI-Pro; (2) the medium was changed after 6 hours of packaging; (3) the lentiviruses were harvested after 48 hours of packaging; (4) the harvested lentivirus stock solution was concentrated by ultracentrifugation, the lentivirus particles were resuspended in DMEM high-glucose medium, and then dispensed for use; the lentivirus packaging process is as follows Figure 10 As shown;

[0202] After lentivirus packaging, CAR-T cell preparation is performed: (1) peripheral blood mononuclear cells (PBMCs) are collected from patients or healthy donors; (2) αβT cells are sorted using CD3 magnetic beads; (3) the sorted αβT cells are cultured in TexMACS GMP medium (MACS); (4) lentivirus transduction is performed after 2 days; (5) CAR-T cells are harvested after 12-14 days to obtain CD7-targeting VHH NS CAR-T cells (named VHH01-VHH20, excluding VHH02, VHH05 and VHH11). The CAR-T cell culture process is as follows: Figure 11 As shown; (6) Flow cytometry was performed during the culture process to determine the proportion of CAR+ cells and the average MFI value of CD7+ cells.

[0203] 3. In vitro functional validation of single VHH CAR-T cells

[0204] To verify the in vitro biological activity of the anti-CD7 VHH CAR-T cells prepared in this embodiment, an in vitro killing experiment was performed during the culture process: First, target cells MOLM-13-Luci-GFP (MOLM-13 cell line is a human acute myeloid leukemia cell line) were collected, centrifuged at 2000 rpm for 5 min, resuspended in DPBS, and counted at a ratio of 1×10⁻⁶. 5 Cells were added to 96-well plates at a ratio of E:T = 3:1. Then, appropriate amounts of effector cells were added to the target cells, and the mixture was incubated for 4 hours. The corresponding luciferase substrate was added, and the luciferase levels in the 96-well plates were read using an electrochemiluminescence immunoassay reader. The killing ratio was calculated based on the changes in the luciferase levels. Additionally, on day 12 of culture of the 17 single-VHH CAR-T cell lines, the 17 single-VHH CAR-T cells and blank T cells were subjected to cell killing experiments with the CD7-positive cell line MOLM-13-Luci-GFP at an E:T ratio of 3:1.

[0205] 4. Experimental Results

[0206] Representative results of flow cytometry analysis of single VHH CAR-T cells and their mean CD7+ MFI results are shown below. Figure 12 and Figure 13 The results showed that the CAR positivity rates of VHH01 to VHH20 (excluding VHH02, VHH05, and VHH11) were 61.04%, 96.2%, 78.9%, 83%, 85%, 72.72%, 89%, 95.6%, 90.98%, 68.38%, 65%, 84.1%, 79.6%, 54.4%, 89.2%, 72.6%, and 62.15%, respectively; blank T cell C The mean MFI value of D7 positive cells was 2588. The mean MFI values ​​of CD7 positive cells in CAR-T cells from VHH01 to VHH20 (excluding VHH02, VHH05 and VHH11) were 2257, 694, 1281, 498, 1566, 2362, 841, 197, 190, 2010, 1473, 1077, 1300, 2054, 1117, 1391 and 2041, respectively.

[0207] The results of the in vitro functional verification are shown in Figure 14 The results showed that the killing rate of blank T cells was 13.65%, while the killing rates of VHH01 to VHH20 (excluding VHH02, VHH05, and VHH11) CAR-T cells were 4.79%, 75.7%, 57%, 62.19%, 61.63%, 68.52%, 71.47%, 91.36%, 78.18%, 1.18%, 60.44%, 56.77%, 72.87%, 8.58%, 74.52%, 61.71%, and 9.38%, respectively.

[0208] Example 6: Detection of Affinity and Specificity of Nanoantibodies

[0209] 1. Affinity test

[0210] The 17 single VHH CAR structures identified in Example 4 were transduced into the human myeloid leukemia cell line K562. On day 4 post-transduction, flow cytometry was performed using CD7-His protein to detect the average MFI value of positive cells. The average MFI value of positive cells varied depending on the affinity of each VHH for CD7; a higher MFI value indicated a higher affinity of the corresponding nanobody for the CD7 antigen. Three parallel experiments were conducted.

[0211] 2. Specificity detection

[0212] (1) The VHH fragments of different clones obtained by sequencing were cloned into the prokaryotic expression vector PET-28a-SUMO; (2) After the sequencing was correct, the plasmid was extracted and then transformed into Escherichia coli strain BL21, and protein expression was performed under IPTG induction; (3) The bacterial cells were lysed by ultrasonication to obtain crude protein; (4) The nanobodies were purified by nickel column affinity chromatography; (5) The binding of 17 nanobodies to K562 and K562-CD7 cell lines was detected by flow cytometry using the purified nanobodies as primary antibodies and HIS-FITC antibodies as secondary antibodies.

[0213] 3. Experimental Results

[0214] The results of the nanobody affinity assay are shown below. Figure 15 The results showed that all 17 single VHH structures specifically bound to CD7-His, with VHH03, VHH06, VHH10, and VHH12 showing stronger affinity. This indicates that the 17 single VHH structures identified in Example 4 of this invention have good affinity for CD7.

[0215] The results of the nanobody specificity test are shown in Figure 16 The results showed that all 17 VHHs could specifically bind to CD7, indicating that the 17 single VHHs obtained by screening and identification in Example 4 of this invention have good specificity.

[0216] Example 7: Construction of humanized nanobody (hVHH06)

[0217] 1. Experimental Methods

[0218] (1) Using the universal humanization framework h-NbBcII10FGLA reported in the literature as a reference (see: Vincke, C., et al., General strategy to humanize a camelid single-domain antibody and identification of a universal humanized nanobody scaffold. J Biol Chem, 2009, 284(5): p.3273-3284), and by comparing with DP-47, the residues at key positions of VHH06 were humanized. The modified nanobody was named hVHH06. The sequence comparison of the three structures (humanized sequence and DP-47, template h-NbBcII10PGLA and original sequence) is as follows: Figure 19As shown, the amino acid sequences of CDR1, CDR2, and CDR3 of hVHH06 are shown in SEQ ID NO:139, SEQ ID NO:141, and SEQ ID NO:143, respectively; the nucleotide sequences of CDR1, CDR2, and CDR3 are shown in SEQ ID NO:140, SEQ ID NO:142, and SEQ ID NO:144, respectively; the amino acid sequence of hVHH06 is shown in SEQ ID NO:137; and the nucleotide sequence is shown in SEQ ID NO:149. NO:138; (2) hVHH06 and VHH06 were packaged into lentiviruses simultaneously according to the aforementioned method and CAR-T cells were prepared; (3) Flow cytometry was performed on the 6th day of CAR-T culture; (4) On the 10th day of CAR-T culture, MOLM-13-Luci-GFP (MOLM-13 cell line is a human acute myeloid leukemia cell line) was used as the target cell, and the effector-target ratio was set to E:T = 5:1, 10:1, and 20:1 according to the aforementioned method to carry out the killing experiment.

[0219] 2. Experimental Results

[0220] The results of flow cytometry analysis are shown below. Figure 17 The results showed that the transduction rates of VHH06 and hVHH06 were 12.4% and 21%, respectively, and the CD7 positivity rates were 0.249% and 0.157%, respectively; the results of the killing assay are shown in […]. Figure 18 The results showed that when E:T = 5:1, 10:1, and 20:1, the average killing values ​​of blank T cells against MOLM-13-Luci-GFP cells were 27.40%, 28.00%, and 26.80%, respectively; the average killing values ​​of VHH06 against MOLM-13-Luci-GFP cells were 69.90%, 79.80%, and 79.70%, respectively; and the average killing values ​​of hVHH06 against MOLM-13-Luci-GFP cells were 70.80%, 81.20%, and 89.60%, respectively. These results indicate that humanization did not affect the antibody's characteristics, demonstrating that VHH06 was successfully humanized in this embodiment.

[0221] Example 8: Preparation of dual VHH CAR-T cells

[0222] 1. Construction of Dual VHH CAR Structure

[0223] (1) The VHHs (VHH03, VHH06, VHH10, VHH12) with better function selected in Example 6 were used to construct a CAR target plasmid with dual VHHs. The schematic diagram of the structure is shown below. Figure 20As shown, the amino acid and nucleotide sequences of the signal peptide, CD8α hinge region, CD8α transmembrane domain, 4-1BB co-stimulatory signaling domain, CD3ζ intracellular signal transduction domain, T2A, EF1α, tEGFR signal peptide, and tEGFR in the CAR are as described in Example 5. First, the VHH sequence of the positive clone was amplified using PCR. The primers for the first round of PCR were:

[0224] dNCAR-F1: 5'-CAGGTGCAGCTGCAGGAG-3'

[0225] dNCAR-R1: 5'-TGAGGAGACGGTGACCTGG-3'

[0226] After the first round of PCR, the PCR products from the first round were used as templates for the second round of PCR. The primers for the second round of PCR were:

[0227] dNCAR-F2: 5'-CCAGGTCACCGTCTCCTCAGGAGGAGGAGGATCCGGAGGAGGAGGATCTGGCGG CGGCGGCAGTGGCGGCGGCGGCTCCGGCGGCGGCGGCTCTCAGGTGCAGCTGCAGGAG-3'

[0228] dNCAR-R2: 5'-TAGGAGCCGGGGTGGGCGGCCGCGGTGCTGGGGTAGTTGAGGAGACGGTGACCTGG-3'

[0229] Then, the second-round PCR products were ligated into the vector VHH-XX (XX represents the sequence number of the CAR structure targeting CD7 single VHH) via homologous recombination, and the vector was digested with Not I. Specifically, the dual VHH structures constructed using VHH-06 as the vector with VHH03 and VHH12 were named dVHH-B and dVHH-C, respectively. The dual VHH structures constructed using VHH-10 as the vector with VHH12 and VHH10 were named dVHH-D and dVHH-E, respectively. The dual VHH structure constructed using VHH12 as the vector with VHH12 was named dVHH-F.

[0230] 2. Preparation of dual VHH CAR-T cells

[0231] The preparation process for dual VHH CAR-T cells is the same as that for single VHH CAR-T cells in Example 5, and the lentivirus packaging process is as follows: Figure 10 As shown, the cultivation process is as follows: Figure 11As shown. CAR-T cells, VHH10 CAR-T cells, and VHH12 CAR-T cells prepared from five double VHH structures and transduced T cells were cultured for 6 days and then analyzed by flow cytometry.

[0232] 3. Experimental Results

[0233] This embodiment constructs a total of 5 dual VHH structures, named dVHH-B to dVHH-F (VHH-06+VHH-03, VHH-06+VHH-12, VHH-10+VHH-12, VHH-10+VHH-10, VHH-12+VHH-12), as shown in the figure. Figure 20 As shown, EF1α is the promoter of elongation factor 1α, leader is the coding sequence of the signal peptide, VHH is the coding sequence of the anti-CD7 nanobody, CD8H+TM is the CD8 hinge region and transmembrane region, and 4-1BB and CD3ζ intracellular signal regions are intracellular co-stimulatory domains. The extracellular region of tEGFR is expressed through T2A peptide so that CAR expression can be detected after viral transduction.

[0234] The results corresponding to the proportion of CAR+ cells and CD7 MFI values ​​are shown in the figures below. Figure 21 and Figure 22 The results showed that the CAR positivity rates of dVHH-B to dVHH-F were 22.59%, 53.6%, 68.68%, and 55.34%, respectively; the positivity rate of VHH10 was 72.2%; and the positivity rate of VHH12 was 86.7%. The mean MFI value of blank T cell CD7 positive cells was 10109. The mean MFI values ​​of CAR-T cell CD7 positive cells of dVHH-B to dVHH-F were 708, 797, 648, 577, and 1057, respectively. The mean MFI value of CAR-T cell CD7 positive cells of VHH10 was 2302, and the mean MFI value of CAR-T cell CD7 positive cells of VHH12 was 1238.

[0235] Example 9: Culture and in vitro functional verification of dual VHH CAR-T cells (dVHH-D)

[0236] 1. Preparation of dVHH-D double VHH CAR-T cells

[0237] The dVHH-D, VHH10, and VHH12 structures were cultured in vitro using the CAR-T cell preparation method described in Example 8, and the cell expansion fold during the culture process was statistically analyzed.

[0238] 2. In vitro functional verification of dVHH-D double VHH CAR-T cells

[0239] To compare the in vitro function of dVHH-D and single VHH CAR-T cells, on day 12 of dVHH-D, VHH10, and VHH12 CAR-T cells, CAR-T cells and blank T cells were cultured with the CD7-positive cell line CCRF-CEM (leukemia T-lymphoma cells) at an E:T ratio of 2:1 for cell killing experiments. First, target cells were collected, centrifuged at 2000 rpm for 5 min, resuspended in DPBS, counted, stained with CFSE, and added to 96-well plates at a ratio of 1E5 / well. Then, appropriate amounts of effector cells were added to the target cells according to different effector-target ratios (E:T = 0.5:1, 1:1, 2:1), and incubated for 4 hours. The cell killing ratio was then detected by flow cytometry.

[0240] 3. Experimental Results

[0241] The dVHH-D amplification curve is shown below. Figure 23 The results showed that by day 14, the average amplification fold of dVHH-D was 46.35, the average amplification fold of VHH-12 was 26.3, and the average amplification fold of VHH-10 was 22.75. It can be seen that the amplification fold of dVHH-D is significantly better than that of single VHH CAR-T.

[0242] The results of the in vitro functional verification of dVHH-D are shown in the figure. Figure 24 The results showed that when the kill ratios were 0.5:1, 1:1, and 2:1, the mean kill values ​​of dVHH-D against CCRF-CEM were 86.925%, 92.115%, and 94.465%, respectively; the mean kill values ​​of VHH10 against CCRF-CEM were 45.55%, 69.95%, and 85.85%, respectively; and the mean kill values ​​of VHH12 against CCRF-CEM were 58.65%, 80.9%, and 82.95%, respectively. This indicates that dVHH-D has a high kill rate against CCRF-CEM.

[0243] Example 10: Culture and in vitro functional verification of dual VHH CAR-T cells (dVHH-E)

[0244] 1. Preparation of dVHH-E double VHH CAR-T cells

[0245] The dVHH-E, VHH10, and VHH12 structures were cultured in vitro using the CAR-T cell preparation method described in Example 8, and the cell expansion fold during the culture process was statistically analyzed.

[0246] 2. In vitro functional verification of dVHH-E double VHH CAR-T cells

[0247] The in vitro functional assay of dVHH-E dual VHH CAR-T was performed using the method described in Example 9.

[0248] 3. Experimental Results

[0249] The dVHH-E amplification curve is shown below. Figure 25 The results showed that by day 13, the average amplification fold of dVHH-E was 45.875, the average amplification fold of VHH-12 was 19.775, and the average amplification fold of VHH-10 was 21.36. It can be seen that the amplification fold of dVHH-E is significantly better than that of single VHH CAR-T.

[0250] The results of the in vitro functional verification of dVHH-E are shown in the figure. Figure 26 The results showed that when the kill ratios were 0.5:1, 1:1, and 2:1, the mean kill values ​​of dVHH-E against CCRF-CEM were 58.15%, 84.385%, and 91.775%, respectively; the mean kill values ​​of VHH10 against CCRF-CEM were 45.55%, 69.95%, and 85.85%, respectively; and the mean kill values ​​of VHH12 against CCRF-CEM were 58.65%, 80.9%, and 82.95%, respectively. It can be seen that dVHH-E exhibits relatively high lethality against CCRF-CEM.

[0251] Example 11: Determination of antibody (dVHH-D, dVHH-E, VHH10, VHH12) affinity by SPR method

[0252] 1. Experimental Methods

[0253] In this embodiment, the SPR method (surface plasmon resonance) was used to determine the affinity of the antibodies. The CD7-His protein prepared in Example 1 was immobilized on a CM5 chip by amino coupling. The antibodies (dVHH-D, dVHH-E, VHH10, VHH12) were used as analytes to conduct experiments and detect the affinity between each antibody and the CD7 antigen.

[0254] 2. Experimental Results

[0255] The results showed that the affinity constant between dVHH-D and CD7-His protein was 3.35E-09M, the affinity constant between dVHH-E and CD7-His protein was 4.51E-09M, the affinity constant between VHH10 and CD7-His protein was 9.99E-08M, and the affinity constant between VHH12 and CD7-His protein was 1.34E-09M (see Table 2). These results further indicate that dVHH-D, dVHH-E, VHH10, and VHH12 can all specifically bind to the CD7 antigen and have strong affinity.

[0256] Table 2. Statistical analysis of antibody affinity determination by SPR method.

[0257]

[0258] The above description of the embodiments is only for understanding the method and core idea of ​​the present invention. Several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. An anti-CD7 nanobody, characterized in that, The nanobody is VHH12; The amino acid sequences of CDR1, CDR2, and CDR3 of VHH12 are shown in SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7, respectively.

2. The nanobody according to claim 1, characterized in that, The amino acid sequence of VHH12 is shown in SEQ ID NO:

1.

3. A chimeric antigen receptor based on a single nanobody, characterized in that, The chimeric antigen receptor comprises the nanobody as described in claim 1 or 2.

4. The chimeric antigen receptor according to claim 3, characterized in that, The chimeric antigen receptor includes a transmembrane domain selected from the transmembrane domains of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, and IL-11 receptor.

5. The chimeric antigen receptor according to claim 4, characterized in that, The chimeric antigen receptor includes an intracellular signal transduction domain selected from the intracellular signal transduction domains of the following molecules: CD3ζ, FcRγ.

6. The chimeric antigen receptor according to claim 5, characterized in that, The chimeric antigen receptor includes a hinge region selected from the hinge regions of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, and IL-11 receptor.

7. The chimeric antigen receptor according to claim 6, characterized in that, The chimeric antigen receptor comprises a signal peptide selected from the following molecules: α and β chains of T cell receptors, CD3ζ, CD3ε, CD4, CD5, CD8, CD9, CD28, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, GITR, and GM-CSF.

8. The chimeric antigen receptor according to claim 7, characterized in that, The chimeric antigen receptor includes a co-stimulatory signaling domain selected from the co-stimulatory signaling domains of the following molecules: 4-1BB, CD28, ICOS, ICAM-1, OX40, and CD27.

9. The chimeric antigen receptor according to claim 8, characterized in that, The chimeric antigen receptor also includes EF1α, T2A, and tEGFR.

10. The chimeric antigen receptor according to claim 9, characterized in that, The chimeric antigen receptor also contains the tEGFR signal peptide.

11. The chimeric antigen receptor according to claim 4, characterized in that, The transmembrane domain is a CD8α transmembrane domain.

12. The chimeric antigen receptor according to claim 5, characterized in that, The intracellular signal transduction domain is the CD3ζ intracellular signal transduction domain.

13. The chimeric antigen receptor according to claim 6, characterized in that, The hinge region is the CD8α hinge region.

14. The chimeric antigen receptor according to claim 8, characterized in that, The co-stimulation signal structure domain is the 4-1BB co-stimulation signal structure domain.

15. The chimeric antigen receptor according to claim 14, characterized in that, The chimeric antigen receptor is obtained by sequentially connecting EF1α, a signal peptide, the nanobody as described in claim 1 or 2, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB co-stimulatory signaling domain, a CD3ζ intracellular signal transduction domain, T2A, a tEGFR signal peptide, and tEGFR.

16. A nucleic acid molecule, characterized in that, The nucleic acid molecule contains a nucleotide sequence encoding the nanobody of claim 1 or 2 or the chimeric antigen receptor of any one of claims 3-15.

17. The nucleic acid molecule according to claim 16, characterized in that, The nucleotide sequences of the nanobody's CDR1, CDR2, and CDR3 are shown in SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8, respectively.

18. The nucleic acid molecule according to claim 16, characterized in that, The nucleotide sequence of the nanobody is shown in SEQ ID NO:

2.

19. The nucleic acid molecule according to claim 16, characterized in that, The nucleotide sequence of the signal peptide in the chimeric antigen receptor is shown in SEQ ID NO:

18.

20. The nucleic acid molecule according to claim 16, characterized in that, The nucleotide sequence of the CD8α hinge region in the chimeric antigen receptor is shown in SEQ ID NO:

20.

21. The nucleic acid molecule according to claim 16, characterized in that, The nucleotide sequence of the CD8α transmembrane domain in the chimeric antigen receptor is shown in SEQ ID NO:

22.

22. The nucleic acid molecule according to claim 16, characterized in that, The nucleotide sequence of the 4-1BB co-stimulatory signaling domain in the chimeric antigen receptor is shown in SEQ ID NO:

24.

23. The nucleic acid molecule according to claim 16, characterized in that, The nucleotide sequence of the CD3ζ intracellular signal transduction domain in the chimeric antigen receptor is shown in SEQ ID NO:

26.

24. The nucleic acid molecule according to claim 16, characterized in that, The nucleotide sequence of T2A in the chimeric antigen receptor is shown in SEQ ID NO:

28.

25. The nucleic acid molecule according to claim 16, characterized in that, The nucleotide sequence of EF1α in the chimeric antigen receptor is shown in SEQ ID NO:

29.

26. The nucleic acid molecule according to claim 16, characterized in that, The nucleotide sequence of the tEGFR signal peptide in the chimeric antigen receptor is shown in SEQ ID NO:

31.

27. The nucleic acid molecule according to claim 16, characterized in that, The nucleotide sequence of tEGFR in the chimeric antigen receptor is shown in SEQ ID NO:

33.

28. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid molecule according to any one of claims 16-27.

29. The recombinant expression vector according to claim 28, characterized in that, The expression vector is a DNA vector, an RNA vector, or a CRISPR / Cas9 vector.

30. The recombinant expression vector according to claim 29, characterized in that, The DNA vector is a plasmid, transposon vector, or DNA viral vector.

31. The recombinant expression vector according to claim 30, characterized in that, The DNA viral vector is an adenovirus vector.

32. The recombinant expression vector according to claim 29, characterized in that, The RNA vector is an RNA virus vector.

33. The recombinant expression vector according to claim 32, characterized in that, The RNA viral vector is a lentiviral vector or a retroviral vector.

34. An engineered host cell, characterized in that, The engineered host cells express the nanobody of claim 1 or 2 or the chimeric antigen receptor of any one of claims 3-15.

35. The engineered host cell according to claim 34, characterized in that, The engineered host cell comprises the recombinant expression vector according to any one of claims 28-33.

36. The engineered host cell according to claim 35, characterized in that, The engineered host cells are engineered immune cells.

37. The engineered host cell according to claim 36, characterized in that, The immune cells are T cells, NK cells, monocytes, macrophages, or dendritic cells.

38. The engineered host cell according to claim 37, characterized in that, The T cells are either CTL cells or NKT cells.

39. The engineered host cell according to claim 38, characterized in that, The NKT cells mentioned are iNKT cells.

40. The engineered host cell according to claim 36, characterized in that, The immune cells mentioned are T cells.

41. A conjugate, characterized in that, The conjugate comprises the nanobody of claim 1 or 2, and a modification portion attached to the nanobody, the modification portion being a detectable label.

42. The conjugate according to claim 41, characterized in that, The detectable markers are radionuclides, fluorescent dyes, luminescent substances, or biotin.

43. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the nanobody of claim 1 or 2, the chimeric antigen receptor of any one of claims 3-15, the nucleic acid molecule of any one of claims 16-27, the recombinant expression vector of any one of claims 28-33, the engineered host cell of any one of claims 34-40, or the conjugate of claim 41 or 42.

44. A reagent kit, characterized in that, The kit comprises the nanobody of claim 1 or 2, the chimeric antigen receptor of any one of claims 3-15, the nucleic acid molecule of any one of claims 16-27, the recombinant expression vector of any one of claims 28-33, the engineered host cell of any one of claims 34-40, or the conjugate of claim 41 or 42.

45. A reagent for detecting CD7 protein, characterized in that, The reagent for detecting CD7 protein comprises the nanobody as described in claim 1 or 2 or the conjugate as described in claim 41 or 42.

46. ​​A method for detecting CD7 protein for non-diagnostic purposes, characterized in that, The method includes the following steps: ① Obtain samples containing CD7 protein; ② Contact the sample collected in step ① with the nanobody as described in claim 1 or 2 or the conjugate as described in claim 41 or 42; ③ Detect the presence of antibody-antigen complexes.

47. A method for preparing engineered host cells according to any one of claims 34-40, characterized in that, The method includes the following steps: introducing the recombinant expression vector of any one of claims 28-33 into a host cell.

48. The method according to claim 47, characterized in that, The introduced methods include lipid transfection, microinjection, electroporation, DNA vector-mediated, or RNA vector-mediated.

49. The method according to claim 48, characterized in that, The DNA vector is a poxvirus vector, herpes simplex virus vector, adenovirus vector, or adeno-associated virus vector.

50. The method according to claim 48, characterized in that, The RNA vector is a retroviral vector or a lentiviral vector.

51. The use of the nanobody according to claim 1 or 2 in the detection of CD7 protein for non-diagnostic and therapeutic purposes.

52. The use of the nanobody according to claim 1 or 2 in the preparation of reagents or kits for detecting CD7 protein.

53. The use of the chimeric antigen receptor of any one of claims 3-15 or the engineered host cell of any one of claims 34-40 in the preparation of antitumor drugs; The engineered host cell is a host cell expressing the chimeric antigen receptor as described in any one of claims 3-15; The tumor is a CD7-expressing tumor; The tumor is acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T-cell lymphoma (PTCL), NKT cell lymphoma, or anaplastic large cell lymphoma (ALCL).

54. The application according to claim 53, characterized in that, The anti-tumor drug is an anti-tumor immune cell therapy agent or an anti-tumor gene therapy drug.

55. The use of any nucleic acid molecule of claims 16-27 or any recombinant expression vector of claims 28-33 in the preparation of engineered host cells, wherein the engineered host cells are the engineered host cells of any claims 34-40.

Images