Acinetobacter pitei, its microbial agent and application

Abstract

The present invention relates to the field of industrial microbial technology, and specifically discloses a kind of Acinetobacter pittii, its microbial agent and application. The Acinetobacter pittii (Acinetobacter pittii) JW535 has a deposit number of CGMCC No.25479. The bacteria capable of oxidizing methane provided by the present invention belong to Acinetobacter pittii, which breaks through the category that methane oxidizing bacteria are mainly concentrated in the genus Methylobacterium in the past. Acinetobacter pittii JW535 has a fast growth rate and a wide pH tolerance. It can efficiently carry out the methane oxidation process under the condition of environmental pH change, and can also efficiently oxidize low-concentration methane gas. At the same time, the strain has high salt tolerance and strong adaptability to the environment, can effectively reduce the greenhouse effect caused by methane emissions, and can also be used for coal mine gas elimination, playing a dual role of coal mine disaster reduction and atmospheric environmental protection, and has extremely high practical value.

Description

Technical Field

[0001] The invention relates to the technical field of industrial microorganisms, and in particular to Acinetobacter pitei, a microbial agent thereof and application thereof. Background Art

[0002] Methane (CH 4 ) is listed in the International Greenhouse Gas (GHG) list as the second most important greenhouse gas. Its greenhouse effect is second only to carbon dioxide. The global warming potential of methane is 20-25 times that of carbon dioxide. According to statistics, the annual emission of methane currently accounts for 16% of all greenhouse gas emissions from anthropogenic sources. Therefore, taking active and effective measures to reduce methane emissions has a very far-reaching significance for greenhouse gas emission reduction. The methane concentration emitted by landfills and livestock and poultry manure storage facilities is low, generally less than 5% (v / v), and has no energy utilization value. It is difficult to recover energy through combustion or remove it by chemical oxidation. The biological method has the characteristics of simple equipment, low processing cost, and eco-friendly environment, which is very suitable for treating such waste gas.

[0003] Biological purification of methane mainly uses methanotrophic bacteria to achieve the conversion of methane. Therefore, methanotrophic bacteria are the key to biological purification of methane. Methane oxidizing bacteria can grow with methane as the only carbon source and energy source. In addition, methanotrophic bacteria can use methane as a substrate to produce high value-added products such as single-cell protein, methanotrophic bacteria, polyhydroxy fatty acids, etc., which can not only reduce the emission of greenhouse gases such as methane, but also produce valuable metabolites. At present, most common methanotrophic bacteria are related bacteria of the genus Methylobacterium, and there are no reports that other genera can oxidize methane. In addition, methane-containing waste gas contains components such as hydrogen sulfide and ammonia. The conversion of the above components by microorganisms will cause changes in pH, and changes in pH will seriously affect the efficiency of methane oxidation. Therefore, there is a great lack of methane oxidizing strains that can tolerate acidic and alkaline environments and can efficiently convert low-concentration methane. Summary of the invention

[0004] In view of the problems that existing methane oxidizing bacteria cannot tolerate acidic and alkaline environments and have low methane oxidation efficiency, the present invention provides a Acinetobacter piteiris, a microbial agent thereof and applications.

[0005] In order to solve the above technical problems, the technical solution provided by the present invention is:

[0006] The invention relates to Acinetobacter pittii JW535, whose deposit number is CGMCC No.25479.

[0007] Acinetobacter pittii JW535 was screened out from mineralized waste that had been buried in the Baoding landfill for 15 years. It was classified and named Acinetobacter pittii. It was deposited in the General Microbiology Center of the China Microbiological Culture Collection, abbreviated as CGMCC, on August 3, 2022. The strain deposit number is CGMCC No. 25479. The deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] The biological characteristics of the Acinetobacter pituitii JW535 provided by the present invention are as follows: the morphological characteristics on the plate culture medium are white and opaque, the colonies are small and slightly convex, the edges are neat, the surface is smooth, the diameter is about 0.5 to 1.2 mm, and it is white and turbid on the liquid culture medium.

[0009] The Acinetobacter Pittii JW535 is a Gram-negative bacterium that produces H 2 The results of S test, urease test and indole test were negative; the results of methyl red test, catalase test, citrate utilization test, starch hydrolysis test and gelatin liquefaction test were positive.

[0010] The methane-oxidizing bacteria provided by the present invention belong to Acinetobacter pitei, breaking through the previous category that methane-oxidizing bacteria are mainly concentrated in the genus Methylobacterium. The Acinetobacter pitei JW535 separated and screened by the present invention has a fast growth rate and a wide pH tolerance, and can efficiently carry out the methane oxidation process under the condition of environmental pH changes, and can also efficiently oxidize low-concentration methane gas. At the same time, the strain has high salt tolerance and strong adaptability to the environment, and can effectively reduce the greenhouse effect caused by methane emissions. It can also be used for coal mine gas elimination, playing a dual role of coal mine disaster reduction and atmospheric environmental protection, and has extremely high practical value.

[0011] The present invention also provides the use of the above-mentioned Acinetobacter pituitii JW535 in methane oxidation.

[0012] The present invention also provides the use of the above-mentioned Acinetobacter pituitii JW535 in producing single-cell protein, methanotrophic acid or polyhydroxy fatty acid.

[0013] The present invention also provides a liquid microbial agent, comprising the above-mentioned Acinetobacter pitei JW535.

[0014] The Acinetobacter pituitii JW535 provided by the present invention can grow with greenhouse gas methane as a carbon source, has high pH tolerance and salt tolerance, can effectively reduce methane production, has a good effect on reducing the greenhouse effect, and is made into a microbial agent for easy transportation and use.

[0015] Preferably, the OD of the liquid microbial inoculant is 600It is 0.3~0.4.

[0016] The present invention also provides a method for preparing the liquid microbial agent, comprising the following steps:

[0017] The Acinetobacter Piteri JW535 is inoculated into NMS liquid culture medium, and cultured at 25°C to 40°C and 110 r / min to 130 r / min for 7 to 14 days to obtain the microbial agent.

[0018] Preferably, the NMS liquid culture medium comprises solution A and solution B, wherein solution A comprises: KNO 3 1.000g, Na 2 HPO 4 12H 2 O 0.717 g, KH 2 PO 4 0.272 g, CaCl 2 6H 2 O0.200g, ethylenediaminetetraacetic acid ammonium iron 5.000mg, MgSO 4 7H 2 O 1.000 g, (NH 4 ) 2 SO 4 0.033 g and 1000 mL of water.

[0019] It should be noted that solution A needs to be prepared before use.

[0020] Solution B includes: ZnSO 4 7H 2 O 0.010g, FeSO 4 7H 2 O 0.200g, Na 2 MoO 4 ·2H 2 O3.000mg, H 3 BO 3 0.030g, CoCl 2 6H 2 O 0.020g, CuSO 4 ·5H 2 O 0.030g, EDTA disodium 0.500g, MnCl 2 ·4H 2 O 3.000mg, NiCl 2 6H 2 O 2.000mg and water 1000mL.

[0021] Preferably, the pH of solution B is 6.8.

[0022] Preferably, the volume ratio of solution A to solution B is 1:0.008-0.012.

[0023] Preferably, the pH of the NMS liquid culture medium is 6.8-7.0.

[0024] Exemplarily, the NMS liquid culture medium is sterilized at 121° C. for 30 minutes and then placed in a clean bench for use.

[0025] Exemplarily, the inoculation volume of Acinetobacter pitei JW535 accounts for 10% of the volume of the NMS liquid culture medium.

[0026] Preferably, the culture temperature is 25-40°C, the pH of the NMS liquid medium is 6.8-7.0, and the Cu 2+ The concentration is 18-22 μmol / L.

[0027] The Acinetobacter pituitii JW535 provided by the present invention has a good ability to adapt to the environment. In an environment with changed environmental pH and high salinity, it can still efficiently oxidize low-concentration methane gas, thereby effectively reducing the emission of methane gas and mitigating the greenhouse effect. It has a high application value in places such as landfills and livestock farms that emit low-concentration methane gas. At the same time, it can also be used for coal mine gas elimination and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The colony morphology of Acinetobacter Piteri JW535 of the present invention on NMS solid culture medium;

[0029] Figure 2 This is the phylogenetic tree of Acinetobacter pitei JW535 constructed based on ITS gene sequence similarity in Example 1. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0031] Culture medium used in the examples:

[0032] The NMS liquid culture medium includes solution A and solution B, wherein solution A includes: KNO 3 1.000g, Na 2 HPO 4 12H 2 O0.717g, KH 2 PO 4 0.272 g, CaCl 26H 2 O 0.200g, EDTA ferric ammonium 5.000mg, MgSO 4 7H 2 O1.000g, (NH 4 ) 2 SO 4 0.033g, add the above components to 1000mL distilled water to make up to volume, the solution needs to be prepared before use;

[0033] Solution B includes: ZnSO 4 7H 2 O 0.010g, FeSO 4 7H 2 O 0.200g, Na 2 MoO 4 ·2H 2 O3.000mg, H 3 BO 3 0.030g, CoCl 2 6H 2 O 0.020g, CuSO 4 ·5H 2 O 0.030g, EDTA disodium 0.500g, MnCl 2 ·4H 2 O 3.000mg, NiCl 2 6H 2 O 2.000 mg, add the above components to 1000 mL of distilled water to make up to volume, and adjust the pH value to 6.8;

[0034] Add 1 mL of solution B to 1 L of solution A, mix well, adjust the pH to 6.8-7.0, sterilize at 121°C for 30 min, and place the sterilized culture medium on a clean bench for later use.

[0035] NMS solid culture medium: prepare NMS liquid culture medium according to the above method, then add 2% agar thereto, mix well, sterilize at 121°C for 30 min, cool to 45-50°C, add 0.5% anhydrous methanol, cool to room temperature to obtain NMS solid culture medium, and put it into the clean bench for use.

[0036] Example 1

[0037] 1. Initial screening of Acinetobacter pitei

[0038] The mineralized garbage used for screening bacteria in this embodiment was taken from the mineralized garbage that had been buried in the Baoding landfill for 15 years. When sampling, the covering soil of about 1 cm on the surface of the landfill was first removed, and then the covering soil of the upper 20 cm was taken. The soil sample was freed of grass roots and other debris, and then passed through a 2 mm sieve and frozen in a -20°C refrigerator for later use.

[0039] Weigh 5 g of the soil sample and place it in a 250 mL serum bottle filled with 50 mL NMS liquid medium. Seal the bottle mouth with an isobutyl rubber stopper and inject 2 mL of 10% methane gas with a sterile syringe to maintain the methane concentration in the serum bottle at 350-400 mg / m 3 , placed in a constant temperature shaker at 30℃ and 150r / min, the headspace gas of the serum bottle was collected every 24h, and the methane concentration in the headspace gas of the serum bottle was determined by gas chromatography. In order to eliminate the influence of the culture medium on methane absorption, a blank control without soil sample was set up at the same time. The enrichment culture process is a cycle of 7 days. After each cycle, the enrichment culture solution is inoculated into fresh NMS liquid culture medium at a ratio of 10% (v / v). When the methane removal efficiency no longer increases and remains stable, the strain enrichment process is completed.

[0040] 2. Isolation of Acinetobacter pitei

[0041] The enriched culture fluid was inoculated onto the NMS solid medium for cultivation, and then the NMS solid medium was placed in an anaerobic tank filled with a mixture of methane and air (1:1, v / v). The control group was inoculated with the enriched culture fluid and placed in an anaerobic tank with only air, and cultured at 30°C until a single colony grew. The colonies that grew well in the mixed gas but not in the air were retained for separation and purification.

[0042] 3. Purification of Acinetobacter pituitus

[0043] The grown single colony was picked into NMS liquid medium, cultured at 30℃, 150r / min shaking table for 7-14 days, then 5mL of culture solution was inoculated into NMS liquid medium, cultured under the same conditions for 3 days, and repeated 3 times. The enriched culture solution obtained after 3 repetitions was used as the inoculum, inoculated into NMS solid medium by plate partitioning and streaking method, cultured for 5 days, picked the single colony on the plate and inoculated into fresh NMS solid medium for culture, repeated 3 times, and the purified strain obtained was Acinetobacter Pitt JW535.

[0044] Morphological observation and physiological and biochemical identification

[0045] The Acinetobacter pitei JW535 was inoculated into NMS solid culture medium, and the NMS solid culture medium was cultured in an anaerobic tank into which methane and oxygen were introduced. The anaerobic tank was placed in a constant temperature incubator at 30°C and cultured for about 96 hours. The colony morphology, color, transparency, and ridges of the colony edges on the culture medium were observed.

[0046] Acinetobacter pituitii JW535 is characterized by white opaque colonies on NMS solid medium, small and slightly convex colonies with neat edges and smooth surfaces, and a diameter of about 0.5 to 1.2 mm (e.g. Figure 1 Acinetobacter pituitii JW535 appears white and turbid in NMS liquid culture medium.

[0047] According to the Manual of Identification of Common Bacteria, the obtained Acinetobacter Pittii JW535 was subjected to Gram staining, methyl red test, H production test, and 2 S test, catalase test, citrate utilization test, indole test, starch hydrolysis test, gelatin liquefaction test and urease assay test. The results are shown in Table 1.

[0048] Table 1 Physiological and biochemical characteristics of Acinetobacter pitei JW535

[0049]

[0050]

[0051] Molecular Biology Identification

[0052] The identification of Acinetobacter pittii JW535 was completed by Sangon Biotech (Shanghai) Co., Ltd. The bacterial DNA was extracted using the SK8255 kit, and the 16SrRNA amplification primers were 27F (AGTTTGATCMTGGCTCAG) and 1492R (GGTTACCTTGTTACGACT T). The PCR reaction system was: 0× Buffer: 2.5 μL, Mg 2+ : 2mM, dNTP: 0.5μl (10mmo l / mL), Taq enzyme: 0.5μl (5U / μl), template: 30-50ng, primers: 1μl each (10μmol / L), ddH 2O: add to 25 μL. PCR cycle conditions: first pre-denaturation at 95℃ for 5min, then denaturation at 95℃ for 30s, annealing at 55℃ for 30s, primer extension at 72℃ for 90s, a total of 32 cycles, and finally repair extension at 72℃ for 10min, and then lower the temperature to 4℃ to terminate the reaction. The amplified product was subjected to 1% agarose gel electrophoresis to obtain the electrophoresis band of 16SrRNA, and the target band was purified and recovered. The PCR product was sequenced by Sangon Biotech (Shanghai) Co., Ltd. The amplification results of 16SrRNA are as follows:

[0053]

[0054] The 16S rDNA sequence of the Acinetobacter pitei strain JW535 was compared with the sequence in GenBank to obtain the 16S rDNA sequence of the similar standard strain of Acinetobacter pitei, and the evolutionary distance between this Acinetobacter pitei and related strains was obtained and a phylogenetic tree was constructed, such as Figure 2 Based on the 16S rDNA sequence similarity analysis, the JW535 strain was identified as Acinetobacter pittii.

[0055] The Pitt bacteria JW535 was deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration, abbreviated as CGMCC, on August 3, 2022. The strain deposit number is CGMCC No. 25479, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing.

[0056] The first step of methane oxidation by methanotrophic bacteria is to oxidize methane to methanol under the action of methane oxidation monooxygenase. In order to verify the methane oxidation function of methanotrophic bacteria Acinetobacter pittii JW535, q-PCR was used to verify the expression of methane oxidation functional genes of the strain. There are two types of methane oxidation monooxygenase: dissolved methane monooxygenase and particulate methane monooxygenase. The characteristic gene expressing dissolved methane monooxygenase is mmoX, and mmoXA (ACCAAGGARCARTTCAAG) and mmoXB (TG GCACTCRTARCGCTC) are used for amplification. The characteristic gene expressing particulate methane monooxygenase is pmoA, and A189gc (GGNGACTGGGACTTCTGG) and mb661 (CCGGMGCAACGTCYTTA CC) are used for amplification.

[0057] The PCR reaction system is 10×Buffer: 2.5 μL, Mg 2+ : 2mM, dNTP: 0.5μl (10mmol / mL), Taq enzyme: 0.5μl (5U / μL), template: 30ng, primers: 1μl each (10μM), ddH 2 O: add to 25 μL. PCR cycle conditions: first pre-denaturation at 95°C for 5 min, then 30 cycles, each cycle lowering by 0.5°C (first denaturation at 95°C for 30 s, then annealing at 65°C-50°C for 20 s, then primer extension at 72°C for 60 s), then 10 cycles (first denaturation at 95°C for 30 s, then annealing at 50°C for 20 s, then primer extension at 72°C for 60 s), finally repair extension at 72°C for 8 min, then lowering to 4°C to terminate the reaction.

[0058] The results showed that Acinetobacter pittii JW535 was able to express the pmoA gene, further verifying the methane oxidation function of the strain. The amplification results of the pmoA gene were:

[0059] AAAGCTTACCGAAGGTGCGCAGCGTGCCGCGCTCGACATGCGGATGTATTCCGGCATCGACGTGCGGACGAAGTGGAAGCCGATCAGATCCGCAAGCGTCATCAGCTGGCCATGCTGCTCC GTCGCCTGGTGGAACGCCGCAATCGCCGGCCAGTTGTTCGGATAGAACAACAGACCCCAGCCCAGCGAACCAACAATCGCCGTGATCACATAGGAGCCCGACAGAAGCAGGATCACGTCAAGCC AGATCGCCGGAACGATCAGAGCGGACGGGAACACAAGGCTGATCGGGAAGTAGGTCCAGCCCCAGAAGTTGACGTAGCGGTTGATCCACTCGCCAATCAGGAGGCCGAGAGCCGCGAACACCG CGCCGAACGGCAGACGGAAGTTCACCCACCAGAACGCCTGCGACGCCGCGAAAGGTCACGCCAAGAATCGGCACGTCGGCCACATACGACGATCCTTCCAGTCAACCCAGAAGTCCC.

[0060] Example 2

[0061] Comparative test of growth performance of Acinetobacter pitei JW535 and methanotrophic bacteria Methylosinus trichosporium OB3b:

[0062] Acinetobacter peutiensis JW535 and methanotrophic bacteria Methylosinustrichosporium OB3b stored at -4°C were inoculated into 250mL serum bottles containing 50mL NMS liquid culture medium, the headspace was evacuated, and then a mixture of pure methane and pure oxygen in a volume ratio of 1:1 was filled in, and the bottles were placed in a shaker at 30°C and 120r / min for constant temperature culture for 7 to 14 days. Then, 5mL of activated Acinetobacter peutiensis JW535 bacterial solution and methanotrophic bacteria Methylosinustrichosporium OB3b bacterial solution were taken respectively, inoculated into 250mL serum bottles containing 50mL NMS liquid culture medium, sealed with butyl rubber stoppers and screw caps, and a mixture of methane and oxygen in a volume ratio of 1:1 was passed in, the methane concentration in the serum bottle was controlled to be 100000ppm, and the bottles were placed in a shaker at 30°C and 120r / min for constant temperature culture, and the liquid phase OD was measured every 12h. 600 The concentrations are shown in Table 2.

[0063] Table 2 Comparison of growth curves of Acinetobacter pitei JW535 and methanotrophic bacteria Methylosinus trichosporium OB3b

[0064]

[0065] The results show that under the same culture conditions, the maximum OD of the control strain Methylosinus trichosporium OB3b 600 The maximum OD600 value of the Acinetobacter pitei JW535 of the present invention is 0.39, indicating that the Acinetobacter pitei JW535 of the present invention has a more excellent growth ability.

[0066] Example 3

[0067] Effects of pH on the growth and methane oxidation performance of Acinetobacter pitei JW530:

[0068] 5 mL of the activated Acinetobacter Pitt JW535 bacterial solution in Example 2 was inoculated into 7 250 mL serum bottles containing 50 mL of NMS liquid medium, and the initial pH of the NMS liquid medium was set to 4, 5, 6, 7, 8, 9, and 10, respectively. The bottles were sealed with butyl rubber stoppers and screw caps, and a mixed gas of methane and oxygen in a volume ratio of 1:1 filtered by a filter membrane was introduced to control the methane concentration in the serum bottle to be 100000 ppm. The bottles were placed in a shaker at 30°C and 120 r / min for constant temperature culture, and the liquid phase OD was measured after 96 h of culture. 600 The results are shown in Table 3.

[0069] Table 3 Effect of pH on the growth OD of Acinetobacter Pittii JW535600 and methane oxidation performance

[0070]

[0071] The results show that the Acinetobacter pituitii JW535 provided by the present invention has very excellent acid-base tolerance, can grow rapidly in the pH range of 4-10, and has a methane removal efficiency of more than 90%, and the optimal growth pH is 7.0.

[0072] Example 4

[0073] Effects of temperature on the growth and methane oxidation performance of Acinetobacter pitei JW535:

[0074] 5 mL of the activated Acinetobacter Pitt JW535 bacterial solution in Example 2 was inoculated into 6 250 mL serum bottles containing 50 mL of NMS liquid culture medium, respectively, and sealed with butyl rubber stoppers and screw caps, and a mixed gas of methane and oxygen in a volume ratio of 1:1 filtered by a filter membrane was introduced to control the methane concentration in the serum bottle to be 100000 ppm, and the cells were placed in different shakers for constant temperature culture, with a shaker speed of 120 r / min and the shaker temperatures set to 20°C, 25°C, 30°C, 35°C, 40°C, and 45°C, respectively. After 96 h of culture, the liquid phase OD was measured 600 The results are shown in Table 4.

[0075] Table 4 Effect of temperature on the growth OD of Acinetobacter pitei JW535 600 and methane oxidation performance

[0076]

[0077] The results show that the optimum temperature range of the Acinetobacter pituitii JW535 provided by the present invention is 25-40° C., and within this range, the methane oxidation efficiency can reach 90%.

[0078] Example 5

[0079] Effects of copper ion concentration on the growth and methane oxidation performance of Acinetobacter pitei JW535:

[0080] 5 mL of the activated Acinetobacter Pitt JW535 bacterial solution prepared in Example 2 was inoculated into 6 250 mL serum bottles containing 50 mL of NMS liquid medium. The CuSO 4The concentrations were 0 μmol / L, 5 μmol / L, 10 μmol / L, 20 μmol / L, 30 μmol / L, and 40 μmol / L, respectively. The bottles were sealed with butyl rubber stoppers and screw caps. A mixed gas of methane and oxygen with a volume ratio of 1:1 filtered by a filter membrane was introduced. The methane concentration in the serum bottle was controlled to be 100,000 ppm. The bottles were placed in a shaker at 30°C and 120 r / min for constant temperature culture. The liquid phase OD was measured after 96 h of culture. 600 The results are shown in Table 5.

[0081] Table 5 Effect of copper ion concentration on the growth OD of Acinetobacter Pittii JW535 600 and methane oxidation performance

[0082]

[0083] The results show that a certain Cu 2 + has a promoting effect on the growth of Acinetobacter Pittii JW535, among which Cu 2 When the concentration of + was 20umol / L, the growth of Acinetobacter Pittii JW535 was the highest, OD 600 It is 0.44.

[0084] Example 6

[0085] 5 mL of the activated Acinetobacter Pitt JW535 bacterial solution in Example 2 was inoculated into 5 250 mL serum bottles containing 50 mL of NMS liquid culture medium, and the NaCl concentrations in the NMS liquid culture medium were set to 0.01%, 0.1%, 0.5%, 1%, and 2%, respectively. The bottles were sealed with butyl rubber stoppers and screw caps, and a mixed gas of methane and oxygen in a volume ratio of 1:1 filtered by a filter membrane was introduced to control the methane concentration in the serum bottle to be 100000 ppm. The bottles were placed in a constant temperature shaker at 30°C and 120 r / min for culture, and the liquid phase OD was measured after 96 h of culture. 600 The results are shown in Table 6.

[0086] Table 6 Effects of NaCl concentration on the growth OD600 and methane oxidation performance of Acinetobacter pitei JW535

[0087] NaCl concentration (%) 0 0.01 0.1 0.5 1 2 OD600 0.35 0.34 0.35 0.34 0.11 0.09 Methane oxidation efficiency 92％ 100％ 100％ 96％ 0％ 0％

[0088] The results showed that the optimal NaCl concentration range for Acinetobacter terrestris JW535 was 0-0.5%, which could achieve a methane oxidation efficiency of more than 90%.

[0089] Example 7

[0090] Experiment on treating low concentration methane waste gas with Acinetobacter Pitt JW535:

[0091] 5 mL of the activated Acinetobacter Pitt JW535 bacterial liquid in Example 2 was inoculated into 5 250 mL serum bottles containing 50 mL of NMS liquid culture medium, respectively, and sealed with butyl rubber stoppers and screw caps, and a mixed gas of methane and oxygen in a volume ratio of 1:1 filtered by a filter membrane was introduced to control the methane concentration in the serum bottle to be 500 ppm, 5000 ppm, 10000 ppm, 50000 ppm, and 100000 ppm, respectively. Three replicates were set for each treatment, and the cells were placed in a constant temperature shaker at 30°C and 120 r / min for culture. The headspace methane concentration was measured after 96 h of culture, and the methane oxidation efficiency was calculated. The results are shown in Table 7.

[0092] Table 7 Experimental results of treating low-concentration methane waste gas with Acinetobacter pituitiensis JW535

[0093] Methane concentration 500 5000 10000 50000 100000 Methane oxidation efficiency 100％ 100％ 99％ 95％ 92％

[0094] The results showed that when the methane concentration was 500ppm~100000ppm, Acinetobacter pituitii JW535 could achieve a methane oxidation efficiency of more than 90%.

[0095] In summary, the Acinetobacter Pittii with the accession number CGMCC No. 25479 provided by the present invention has a fast growth rate, high oxidation efficiency for low-concentration methane gas, and a wide pH tolerance, and has very high application value in places such as landfills and livestock and poultry farms that emit low-concentration methane gas.

[0096] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Acinetobacter pittii JW535, It is characterized in that Its deposit number is CGMCC No.25479.

2. Use of Acinetobacter Pittii JW535 according to claim 1 in methane oxidation.

3. A liquid microbial agent, It is characterized in that It comprises the Acinetobacter Piteri JW535 described in claim 1.

4. The liquid microbial agent according to claim 3, It is characterized in that The OD of the liquid microbial inoculant 600 It is 0.3~0.

4.

5. The microbial agent according to claim 3 or 4, It is characterized in that The preparation method thereof comprises the following steps: The Acinetobacter Piteri JW535 is inoculated into NMS liquid culture medium, and cultured at 25°C to 40°C and 110 r / min to 130 r / min for 7 to 14 days to obtain the microbial agent.

6. The liquid microbial agent according to claim 5, It is characterized in that The NMS liquid culture medium comprises solution A and solution B, wherein solution A comprises: KNO 3 1.000g, Na 2 HPO 4 12H 2 O 0.717 g, KH 2 PO 4 0.272 g, CaCl 2 6H 2 O0.200g, ethylenediaminetetraacetic acid ammonium iron 5.000mg, MgSO 4 7H 2 O 1.000 g, (NH 4 ) 2 SO 4 0.033 g and 1000 mL of water; Solution B includes: ZnSO 4 7H 2 O 0.010g, FeSO 4 7H 2 O 0.200g, Na 2 MoO 4 ·2H 2 O3.000mg, H 3 BO 3 0.030g, CoCl 2 6H 2 O 0.020g, CuSO 4 ·5H 2 O 0.030g, EDTA disodium 0.500g, MnCl 2 ·4H 2 O3.000mg, NiCl 2 6H 2 O 2.000mg and water 1000mL.

7. The liquid microbial agent according to claim 6, It is characterized in that The volume ratio of the solution A to the solution B is 1:0.008-0.012, and the pH of the NMS liquid culture medium is 6.8-7.

0.

8. A method for oxidizing methane using the Acinetobacter pitei JW535 according to claim 1, It is characterized in that Acinetobacter pitei JW535 was activated, and the activated bacterial liquid was inoculated into NMS liquid culture medium, and then the NMS liquid culture medium was placed in a closed container into which a mixed gas of methane and oxygen was introduced for cultivation.

9. The method according to claim 8, It is characterized in that The culture temperature is 25-40°C, the pH of the NMS liquid medium is 6.8-7.0, and the Cu 2+ The concentration is 18-22 μmol / L.

Images