Promoter suitable for Corynebacterium stagnans and its application

By constructing a promoter library suitable for Corynebacterium stagnation, the core region of the promoter of Corynebacterium ATCC13032 pyruvate carboxylase (Pyc) was used to solve the problem of low metabolites and protein expression efficiency in Corynebacterium , and achieve efficient protein expression effect.

CN115806985BActive Publication Date: 2025-09-05STAR LAKE BIOSCI CO INC ZHAOQING GUANGDONG +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211309420.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-25
Publication Date
2025-09-05
Estimated Expiration
2042-10-25

AI Technical Summary

Technical Problem

In Corynebacterium, metabolites and proteins are difficult to express and low expression efficiency.

Method used

A promoter library suitable for Corynebacterium stagnate was constructed, and regions -35 and -10 of the promoter sequence of ATCC13032 pyruvate carboxylase (Pyc) were used to design the BsaⅠ enzyme cleavage site and extended protection sequence, and to introduce Corynebacterium stagnate to increase protein expression.

Benefits of technology

The high-level expression of the protein of the target Corynebacterium stagnant was achieved, and the expression levels of GFP and α-amylase were improved by 2.63-fold and 2.36-fold compared with the existing promoters.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115806985B_ABST
    Figure CN115806985B_ABST
Patent Text Reader

Abstract

The present invention provides a promoter suitable for Corynebacterium stagnantum and its application. The nucleotide sequence of the promoter suitable for Corynebacterium stagnantum is shown in SEQ ID NO: 7, SEQ ID NO: 5, and / or SEQ ID NO: 6. By introducing the promoter into Corynebacterium stagnantum, the present invention achieves high-level expression of a target protein in Corynebacterium stagnantum, overcoming the problems of low strength of existing promoters, difficulty in expressing metabolites and proteins in coryneform bacteria, and low expression efficiency, thereby further improving target protein synthesis and achieving GFP protein and α-amylase expression levels 2.63 and 2.36 times higher than those of the existing Corynebacterium Psod promoter.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and particularly relates to a promoter suitable for Corynebacterium stagnans and its application. Background Art

[0002] Gene expression refers to the process by which genes, through transcription and translation, produce biologically active RNA or protein, expressing their stored genetic information. This process is regulated by factors at multiple levels. In both eukaryotic and prokaryotic organisms, the majority of regulatory events occur at the transcriptional level. Transcription is not only the first step in gene expression but also a key step in controlling gene activity; promoters are crucial players in transcriptional regulation.

[0003] Promoters are DNA sequences that RNA polymerase recognizes and binds to initiate transcription. They contain conserved sequences required for specific RNA polymerase binding and transcription initiation, and most are located upstream of the transcription start site of the structural gene. Such promoters themselves are not transcribed, but some promoters (such as tRNA promoters) are located downstream of the transcription start site, and these DNA sequences can also be transcribed. The activity of promoters is affected by many factors, and in heterologous gene expression, it is often necessary to select promoters with different activities based on actual needs.

[0004] Corynebacterium is an important genus of bacteria. Many rod-shaped bacteria are used as model strains for industrial production, and many are used as hosts for the production of proteins and excellent metabolites. Currently, efficient production of a variety of proteins, amino acids, metabolites, etc. has been achieved. However, there are still problems with the difficulty and low efficiency of metabolite and protein expression in Corynebacterium. Summary of the Invention

[0005] In order to overcome the deficiencies of the prior art, the present invention provides a promoter suitable for Corynebacterium stagnans to solve the problems of difficulty in expressing metabolites and proteins and low expression efficiency in Corynebacterium in the prior art.

[0006] The purpose of the present invention is to provide a promoter suitable for Corynebacterium stagnans, wherein the promoter sequence is any one of SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

[0007] The promoter suitable for Corynebacterium stagnantum is used in the efficient expression of target protein. The promoter of the present invention is introduced into Corynebacterium stagnantum to improve the ability of Corynebacterium stagnantum to produce target protein.

[0008] In order to achieve the above object, the present invention adopts the following technical measures:

[0009] In order to obtain a promoter suitable for Corynebacterium stagnans, a promoter library was constructed. The core regions -35 and -10 of the promoter library template were derived from the pyruvate carboxylase (Pyc) promoter sequence of Corynebacterium glutamicum ATCC13032. The promoter core sequence is shown below:

[0010] NNNNNNTTGATTNNNNNNNNNNNNNNNTANNATNNNNNN

[0011] A promoter suitable for Corynebacterium stagnans, wherein the promoter sequence is shown in SEQ ID NO: 5; or SEQ ID NO: 6; or SEQ ID NO: 7:

[0012] SEQ ID NO.5:

[0013] AACCGGTTGATTTAAAGATCCTTAGGATATCATTCAATT;

[0014] SEQ ID NO.6:

[0015] TGAAAATTGATTTAAACTTGGGCATGTTAAGATAAGTGG;

[0016] SEQ ID NO.7:

[0017] AGATTATTGATTTTCCGTGTTAGCCGTTATCATAGTAGC;

[0018] The promoter suitable for Corynebacterium stagnantum is used to increase the expression of target protein in Corynebacterium stagnantum. The promoter provided by the present invention is introduced into Bacillus licheniformis to increase protein expression; the promoter is used to activate the expression of target gene to increase protein expression.

[0019] In the above application, preferably, the target protein is green fluorescent protein and α-amylase;

[0020] In the above application, preferably, the Corynebacterium stagnantum is Corynebacterium stagnantum ATCC6872.

[0021] The promoters suitable for Corynebacterium stagnantum provided in the above examples and their use in efficiently expressing target products have the following beneficial effects:

[0022] 1. The present invention achieves high-level expression of the target protein in Corynebacterium by introducing a promoter into Corynebacterium, overcoming the problems of low strength of existing promoters, difficulty in expressing metabolites and proteins in Corynebacterium, and low expression efficiency, thereby achieving the purpose of further improving the synthesis of the target protein and achieving GFP protein and α-amylase expression levels 2.63 times and 2.36 times higher than those of the existing Corynebacterium Psod promoter.

[0023] 2. By determining the -35 region (6 bp), -10 region (6 bp), and core spacer region (15-18 bp) of the core region of the promoter, a new promoter with expression function is selected and applied to the gene expression and target protein production of Corynebacterium stagnantum, further enabling the promoter-mediated expression of genes to be effectively expressed throughout the fermentation cycle. Moreover, the core region of the promoter used is derived from the pyruvate carboxylase (Pyc) promoter sequence of Corynebacterium glutamicum ATCC13032, so that the promoter can be recognized by the domain of the σ factor in Corynebacterium glutamicum, thereby achieving the goal of increasing the yield of the target protein of Corynebacterium stagnantum by the introduced promoter.

[0024] 3. In constructing the promoter library, BsaⅠ restriction sites and extended protection sequences are artificially designed and added to both ends of the promoter to form a promoter template while ensuring that the core region of the promoter is fixed. The design and addition of BsaⅠ restriction sites at both ends of the promoter are not only flexible and practical, suitable for constructing all simple and complex expression vectors, but also make the subsequent vector construction work fast and efficient, which accelerates the study of the effect of the promoter of the present invention on the production level of the target protein of Corynebacterium stagnantum. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the structures shown in these drawings without paying any creative work.

[0026] Figure 1 Schematic diagram of the effect on GFP secretion expression under the regulation of SEQ ID NO: 5-7 promoter;

[0027] Figure 2 Schematic diagram showing the effect on the secretory expression of α-amylase under the regulation of the promoter of SEQ ID NO: 5-7. DETAILED DESCRIPTION

[0028] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0029] It should be noted that if the embodiments of the present invention involve directional indications (such as up, down, left, right, front, back, etc.), the directional indications are only used to explain the relative position relationship, movement status, etc. between the components under a certain specific posture. If the specific posture changes, the directional indications will also change accordingly.

[0030] In addition, if there are descriptions involving "first", "second", etc. in the embodiments of the present invention, the descriptions of "first", "second", etc. are only for descriptive purposes and cannot be understood as indicating or suggesting their relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features limited to "first" and "second" may explicitly or implicitly include at least one of such features. In addition, if "and / or" or "and / or" appears in the full text, its meaning includes three parallel schemes. Taking "A and / or B" as an example, it includes scheme A, or scheme B, or a scheme in which A and B are satisfied at the same time. In addition, the technical solutions between the various embodiments can be combined with each other, but it must be based on the ability of ordinary technicians in this field to implement. When the combination of technical solutions is mutually contradictory or cannot be implemented, it should be deemed that such a combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0031] The coryneform bacterium of the present invention is Corynebacterium stagnans ATCC6872.

[0032] LB medium (g / l): tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0033] LBB medium (g / l): tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, BHI 10 g / L.

[0034] LBHis medium (g / L): peptone 5 g / L, yeast extract 2.5 g / L, NaCl 5 g / L, BHI 18.5 g / L, sorbitol 91 g / L, agar 16 g / L.

[0035] GFP expression level detection method:

[0036] 0.2 mL of the strain fermentation broth was added to the EP tube, and then 1.8 mL of deionized water was added to the EP tube. After mixing evenly, the biomass was measured using a visible light spectrophotometer, and the fluorescence intensity was detected using a microplate reader and the corresponding fluorescence value was recorded three times.

[0037] α-amylase (amyE) expression level detection method:

[0038] The strain was inoculated into 2 ml of LBB medium (kanamycin was added to the resistant strain at a final concentration of 20 μg / mL) and cultured overnight, then transferred to 10 ml of LBB medium and cultured at 30°C and 220 rpm for 24 hours to obtain cell fermentation broth. The amylase activity was determined using EnzChek TM Amylase Assay Kit (Cat. No. E33651). The reaction substrate is the supernatant of cell disruption, obtained by centrifugation of the fermentation broth at 6000 rpm. One unit of enzyme activity (U / ml) is defined as the amount of enzyme required to release 1 mg of maltose from starch in 3 minutes at 20°C and pH 6.9. Three biological replicates were performed for each strain.

[0039] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0040] Unless otherwise specified, the technical solutions described in the present invention are all conventional solutions in the field; the reagents or materials described are all from commercial channels unless otherwise specified.

[0041] Secondly, the term "one embodiment" or "embodiment" herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in various places throughout this specification does not necessarily refer to the same embodiment, nor does it constitute a separate or selective embodiment that is mutually exclusive with other embodiments.

[0042] Example 1

[0043] Obtaining a promoter suitable for Corynebacterium stagnans

[0044] The promoter of the present invention is derived from the pyruvate carboxylase (Pyc) promoter sequence of Corynebacterium glutamicum ATCC13032, and its core region -35 and -10 regions are determined to generate a promoter library, the library sequence of which is:

[0045] TAGCTNNNNNNATNNTANNNNNNNNNNNNNNNAATCAANNNNNNNCAGGT

[0046] Furthermore, a BsaⅠ restriction site and an extension protection sequence were designed and added to both ends of the promoter to form a template (the promoter library was synthesized by Jinweizhi Biotechnology Co., Ltd.). The promoter nucleotide sequence library is as follows:

[0047] AAAGGTCTCTAGCTNNNNNNATNNTANNNNNNNNNNNNNNNAATCAANNNNNNNCAGGTGAGACCCGTGAGCTA

[0048] S1: Use primer Promoter-F (SEQ ID NO. 1) to anneal and amplify the obtained promoter library to obtain double-stranded promoter fragments. Use NanoDrop Spectrophotometer to measure the nucleic acid concentration, 70 ng / μL for future use.

[0049] S2: The obtained double-stranded promoter fragment was GoldenGate-ligated with the P19_PTP_KanR_BsaI plasmid vector (SEQ ID NO. 2) using T4 ligase and BsaⅠ restriction endonuclease to obtain the recombinant plasmid P19_Promoter_GFP containing the promoter.

[0050] S3: The obtained recombinant plasmid P19_Promoter_GFP was transformed into Escherichia coli DH5α and spread on LB solid medium containing 40 μL / mL kanamycin for overnight culture. The colonies grown on the plate were washed with 2 mL of LB liquid medium containing 40 μL / mL kanamycin and transferred to a test tube for another overnight culture. The plasmid was extracted and the concentration was detected using a NanoDrop Spectrophotometer and stored at 201 ng / μL at -20°C.

[0051] S4: The promoter plasmid obtained from S3 was used to introduce P19_Promoter_GFP into Corynebacterium stagnantum ATCC6872 by electroporation, and the culture was plated on LBHis solid culture medium. Kanamycin was used as a selection marker to obtain a recombinant strain that fluoresces under blue light.

[0052] S5: A total of 101 recombinant strains obtained from S4 were selected and inoculated into a well plate containing LBB liquid medium. The culture was carried out at 800 rpm / min for 22 hours. The fermentation broth was diluted 20 times with water, and the OD600 and fluorescence intensity (excitation wavelength 485 nm, emission wavelength 515 nm) were measured respectively. The standardized GFP expression level was expressed as the fluorescence intensity ratio OD600. Finally, three recombinant strains were determined and named C.Sta_P1_GFP, C.Sta_P2_GFP, and C.Sta_P3_GFP. Colony PCR was performed using primers PF (SEQ ID NO.3) PR (SEQ ID NO.4), and the nucleotide sequences of promoters P1, P2, and P3 were obtained by sequencing. The nucleotide sequences are shown in SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7.

[0053] Example 2: Expression of GFP exogenous protein in Corynebacterium stagnantum using promoters P1-P3

[0054] SS1: Primers Psod-F (SEQ ID NO.8) and Psod-R (SEQ ID NO.9) were used to amplify a nucleotide fragment containing the promoter Psod coding sequence of superoxide dismutase of Corynebacterium glutamicum as shown in SEQ ID NO.10.

[0055] SS2: The obtained double-stranded promoter fragment was GoldenGate-ligated with the P19_PTP_KanR_BsaI plasmid vector using T4 ligase and BsaⅠ restriction endonuclease to obtain the recombinant plasmid P19_Psod_GFP containing the Psod promoter.

[0056] SS3: The recombinant plasmid P19_Psod_GFP obtained in SS2 was transformed into Corynebacterium Stagnantium ATCC6872, plated on LBHis solid culture medium, and kanamycin was used as a selection marker to obtain the recombinant strain C.Sta-GFP-Psod that fluoresces under blue light.

[0057] SS4: Activation of recombinant strain seeds: The stagnant bacillus C.Sta_P0_GFP carrying an empty plasmid was used as a negative control, and the recombinant strains C.Sta-GFP-Psod, C.Sta_P1_GFP, C.Sta_P2_GFP, and C.Sta_P3_GFP were inoculated into 2 mL of LBB liquid culture medium (20 μL / mL kanamycin) and cultured at 30°C and 220 rpm for 12 hours to obtain seed culture solution.

[0058] The fermentation medium is LBB medium.

[0059] SS5: The seed culture in SS4 was inoculated into a 50 mL Erlenmeyer flask containing 10 mL of LBB fermentation medium at the same initial OD, and the culture was shaken at 30°C and 220 rpm for 24 h to obtain a fermentation broth.

[0060] SS6: GFP expression level assay: Add 0.2 mL of the fermentation broth to an EP tube. Add 1.8 mL of deionized water to the tube and mix thoroughly. Measure biomass (OD600) using a visible light spectrophotometer. Measure fluorescence intensity using a microplate reader and record the corresponding fluorescence values ​​three times. Normalized GFP expression levels are expressed as the ratio of fluorescence intensity to OD600.

[0061] SS7: See Figure 1 The experiment showed that: using C.Sta_P0_GFP with an empty plasmid as a negative control, the relative fluorescence intensity was 1.19×10 3 The relative fluorescence intensity of GFP expressed under promoter P1 was 1.30×10 4 The relative fluorescence intensity of GFP expressed under promoter P2 was 2.09×10 4 The relative fluorescence intensity of GFP expressed under promoter P3 was 3.92×10 4 The relative fluorescence intensity of GFP mediated by the promoter Psod was 1.66×10 4 , promoter P3 had the best effect, and the GFP fluorescence intensity mediated by promoter Psod increased by 2.63 times.

[0062] Example 3: Promoters P1-P3 increase the expression of α-amylase protein in Corynebacterium stagnantum

[0063] S101: Using primers amy-F (SEQ ID NO.11) and amy-R (SEQ ID NO.12) and the Bacillus subtilis genome as a template, amplify the gene sequence containing α-amylase (α-amylase EC3.2.1.1) as shown in SEQ ID NO.13.

[0064] S102: Use P19-fra1-R (SEQ ID NO.14) and P19-fra1-F (SEQ ID NO.15) to PCR on P19_PTP_KanR_BsaI to obtain fragment 1, and use P19-fra2-F (SEQ ID NO.16) and P19-fra2-R (SEQ ID NO.17) to PCR on P19_PTP_KanR_BsaI to obtain fragment 2. The obtained fragments 1 and 2 and the gene fragment of SEQ ID NO.13 were Gibson assembled to obtain P19-PTP-amy-kanR_BsaI. Then the promoters psod, P1, P2, P3 and P19_PTP_amy_kanR_BsaI were GoldenGate-ed to obtain plasmids P19_psod_amy, P19_P1_amy, P19_P2_amy, and P19_P3_amy, respectively.

[0065] S103: The recombinant plasmid obtained in S102 was transformed into Corynebacterium stagnantum ATCC6872, spread on LBHis solid culture medium, and kanamycin was used as a screening marker. The recombinant strains C.Sta_Psod_Amy, C.Sta_P1_Amy, C.Sta_P2_Amy, and C.Sta_P3_Amy were obtained by sequencing.

[0066] S104: Activation of recombinant strain seeds: Using the C.sta_P0_amy strain carrying an empty plasmid as a negative control, the recombinant strains C.Sta_Psod_Amy, C.Sta_P1_Amy, C.Sta_P2_Amy, and C.Sta_P3_Amy were inoculated into 2 mL of LBB liquid culture medium (20 μL / mL kanamycin) and cultured at 30°C and 220 rpm for 12 hours to obtain seed culture solution.

[0067] The fermentation medium is LBB medium.

[0068] S105: The seed culture solution in S103 was inoculated into a 50 mL Erlenmeyer flask containing 10 mL of LBB fermentation medium at the same initial OD, and fermented in a shaker at 30° C. and 220 rpm for 24 hours to obtain a fermentation solution.

[0069] S106: α-Amylase (amyE) Expression Level Detection: Amylase activity was measured using the EnzChek™ Amylase Assay Kit (Cat. No. E33651). The fermentation broth was disrupted and centrifuged at 6000 rpm, and the supernatant was collected. One unit of enzyme activity (U / ml) was defined as the amount of enzyme required to release 1 mg of maltose from starch in 3 minutes at 20°C and pH 6.9. Three biological replicates were performed for each strain.

[0070] S107: Please refer to Figure 2 Experiments have shown that the enzyme activity of the α-amylase of the stagnant bacterium carrying an empty plasmid is 4.3U / mL; the enzyme activity of the recombinant strain α-amylase mediated by promoter P1 is 6.99U / mL; the enzyme activity of the recombinant strain α-amylase mediated by promoter P2 is 8.7U / mL; the enzyme activity of the recombinant strain α-amylase mediated by promoter P3 is 17.91U / mL; the enzyme activity of the recombinant strain α-amylase mediated by promoter Psod is 7.59U / mL. Promoter P3 has the best effect, and the enzyme activity of the α-amylase mediated by promoter Psod is increased by 2.36 times.

[0071] The above description is only a preferred embodiment of the present invention and does not limit the patent scope of the present invention. All equivalent structural transformations made by using the contents of the present description and drawings under the inventive concept of the present invention, or direct / indirect application in other related technical fields are included in the patent protection scope of the present invention.

Claims

1. A promoter suitable for Corynebacterium stagnans, characterized in that The nucleotide sequence thereof is shown in SEQ ID NO:

7.

2. Use of the promoter according to claim 1 in increasing the expression of a target protein in Corynebacterium stagnantum.

3. The use according to claim 2, characterized in that The target protein is any one of fluorescent protein and amylase.

4. The use according to claim 3, characterized in that The target protein is enhanced green fluorescent protein or α-amylase.

5. The use according to claim 2, characterized in that The stagnant bacterium is stagnant bacterium ATCC6872.

Citation Information

Patent Citations

  • Recombinant plasmid and application thereof in electro-transformation of corynebacterium stagnation

    CN118460588A