Application of Rice OsBGAL1 Gene in Regulating Seed Germination

Abstract

The present invention discloses the application of rice OsBGAL1 gene in regulating seed germination. The experiment of the present invention shows that knocking out the OsBGAL1 gene can significantly accelerate the germination of rice seeds. The present invention can provide gene resources for solving the problems of slow germination and uneven seed germination during direct seeding of rice seeds and for cultivating new rice varieties, and has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and particularly relates to the application of rice OsBGAL1 gene in regulating seed germination. Background Art

[0002] Rice is one of the main food crops in China, and more than half of the world's population feeds on rice. Its yield directly affects the basic livelihood issues. The differences in the germination ability and speed of rice seeds will affect the emergence consistency and uniformity, and thus affect the yield formation. At the same time, with the rapid economic and urbanization development, the direct-seeding rice technology that reduces labor, lowers costs, and is convenient for mechanized and simple operation has been paid more and more attention. And the key problem to be overcome for the popularization of direct-seeding technology is the seed germination problem.

[0003] OsBGAL1 belongs to the gene family of β-galactosidase. β-galactosidase degrades galactan and galactose-containing polysaccharides in the cell wall and participates in a series of physiological and biochemical processes, such as plant growth, fruit ripening, flower senescence, fiber development, etc., and is also related to seed germination. At present, most of the research progress on β-galactosidase family genes is about the growth and development periods such as pollen development and fruit ripening. There is only one relevant literature report on the OsBGAL1 gene. This gene is relatively highly expressed in the roots, buds and leaf sheaths of 15-30-day-old plant seedlings, but the function and application of the OsBGAL1 gene in regulating rice seed germination have not been reported. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the above-mentioned defects and deficiencies of the prior art and provide the application of rice OsBGAL1 gene in regulating seed germination.

[0005] The experiments of the present invention found that the rice OsBGAL1 gene is related to rice seed germination. The OsBGAL1 gene and its encoded protein can be used to regulate the phenotypes of seed germination and dormancy. Therefore, the rice OsBGAL1 gene or protein can be applied to plant breeding, and the expression level of the OsBGAL1 gene can be regulated to regulate seed dormancy or germination.

[0006] Therefore, the first object of the present invention is to provide the application of the OsBGAL1 gene in regulating seed germination.

[0007] Preferably, the OsBGAL1 gene is a gene encoding a protein with an amino acid sequence as shown in SEQ ID NO.2. The amino acid sequence of the protein is as shown in SEQ ID NO.2, or is an amino acid sequence with equivalent function formed by substituting, deleting, and / or adding one or several amino acid residues to the amino acid sequence as shown in SEQ ID NO.2. The sequence of the OsBGAL1 gene is as shown in SEQ ID NO.1, or is a gene sequence with equivalent function that encodes the protein shown in SEQ ID NO.2 and is formed by substituting, deleting, and / or adding one or more nucleotides to the sequence shown in SEQ ID NO.1.

[0008] Preferably, the nucleotide sequence of the OsBGAL1 gene is as shown in SEQ ID NO.1. The full length of the OsBGAL1 gene sequence is 2526bp, encoding 841 amino acids.

[0009] Preferably, the application is the application of knocking out the OsBGAL1 gene in accelerating seed germination and increasing the germination rate. The plant species involved in the seeds include other cereal crops such as rice, wheat, corn, sorghum, and millet, and also include some other important economic crops, such as cotton, rapeseed, or tomato.

[0010] Preferably, the seeds are seeds of gramineous plants.

[0011] Preferably, the seeds are rice seeds.

[0012] The present invention also provides a method for obtaining an improved rice with accelerated seed germination and increased germination rate, including the following steps: constructing a knockout vector of the OsBGAL1 gene using the CRISPR / Cas9 genome editing system, the nucleotide sequence of the OsBGAL1 gene is as shown in SEQ ID NO.1, and the two specific target sequences for constructing the knockout vector are target 1: GGTGACGTACGACAAGAAGGCGG and target 2: CGGAGAAGAGAATCCTCCTCTGG; then transferring the knockout vector into rice cells and integrating it into the chromosome, and screening the cells, tissues, or organs with successfully knocked out OsBGAL1 gene to regenerate plants.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] (1) The OsBGAL1 gene and its encoded protein of the present invention can be used to control rice seed germination. The OsBGAL1 gene knockout lines exhibit the phenotype of accelerated seed germination. Therefore, it can provide gene resources for solving problems such as slow germination and uneven seed germination during direct seeding of rice seeds and for cultivating new rice varieties. The present invention is of great significance for solving problems such as difficult seed germination during rice direct seeding and has broad application prospects in plant breeding.

[0015] (2) The OsBGAL1 gene of the present invention is related to rice seed development, provides materials for studying the expression regulation of genes related to the seed embryo, and also helps in the study of the plant seed development mechanism. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the transcriptional expression of the OsBGAL1 gene in the embryo of the seed during rice seed germination.

[0017] Figure 2 It is the biostatistical analysis of the germination rates of WT, osbgal1-12, and osbgal-26; among them, Figure a is the physical picture of the germination rate of rice seeds germinated in water for 6 days; Figure b is the statistical result graph of the rice seed germination rate. DETAILED DESCRIPTION OF THE INVENTION

[0018] The following examples are further descriptions of the present invention, rather than limitations of the present invention.

[0019] Example 1: Construction of the OsBGAL1 gene knockout vector and obtaining of rice gene knockout plants

[0020] 1. Construction of homozygous mutant plants of OsBGAL1

[0021] The OsBGAL1 gene in wild-type rice (Nipponbare) was edited using the CRISPR / Cas9 genome editing system to obtain gene knockout mutant plants. The exon sequences of the target gene OsBGAL1 (gene ID: Os03t0165400-01, whose CDS sequence is shown in SEQ ID NO.1, with a full length of 2526 bp and the encoded protein sequence shown in SEQ ID NO.2, 841 amino acids) were analyzed using the CRISPR-P v2.0 website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), and two specific target sequences were selected, namely target 1: GGTGACGTACGACAAGAAGGCGG and target 2: CGGAGAAGAGAATCCTCCTCTGG. Two expression cassettes U6a-target 1-sgRNA and U3-target 2-sgRNA connected to sgRNA were obtained by overlapping PCR respectively. Using the characteristic that the cleavage site and recognition site of BsaI enzyme do not overlap, these two expression cassettes were ligated into the pYLCRISPR / Cas9Pubi-H vector to generate the pCRISPR-OsBGAL1 vector containing the OsBGAL1 specific target, and it was transformed into DH5α competent cells. After extracting the plasmid from the positive clone, it was sent to the company for sequencing, and the pCRISPR-OsBGAL1 plasmid with correct results was selected to regenerate gene knockout mutant plants by the method of Agrobacterium-mediated infection of rice callus.

[0022] 2. Identification of homozygous mutant plants of OsBGAL1

[0023] The total genomic DNA of individual T0 transgenic plants was extracted and used as a template. Primers located at both flanks of the OsBGAL1 target (F: CAGCATCAGCAGCAGTTCACTGTCACTC; R: CACATCCAAGCCTCCATCTTTAGCCTTCTC) were used to perform PCR amplification on the sequences containing target 1 and 2. The amplification products with a single and clear target band were recovered and sent to the company for sequencing. After sequencing, the sequencing results were decoded and analyzed using the DSDecodeM website (http: / / skl.scau.edu.cn / dsdecode / ). Homozygous OsBGAL1 gene knockout mutant lines osbgal1-12 and osbgal1-26 with different independent mutation sites were selected for subsequent experiments.

[0024] Example 2: Analysis of the expression of OsBGAL1 at the mRNA level during rice seed germination by qPCR technology

[0025] RNA extraction was carried out with reference to the instruction manual of the Baitaike Polysaccharide Polyphenol RNA Plant Extraction Kit (containing DNase); for the synthesis of the first strand of reverse transcribed cDNA, calculate the volume of the 1000 ng RNA template required, mix it with the solution in the kit and gently shake to mix evenly, centrifuge briefly at 37 °C for 5 min to remove the residual DNA in the RNA genome; after the above reaction, carry out the synthesis of the first strand of cDNA, add the reagent in the kit to the reaction solution for removing genomic DNA and centrifuge briefly, keep it at 42 °C for 15 min, heat at 85 °C for 5 min until Star Script II RT Mix is inactivated to obtain the cDNA solution. After the reaction is completed, dilute the obtained cDNA by 10 times; design specific amplification primers with Primer Premier 5, and the upstream and downstream primers of OsBGAL1 are: F: AAGCACACAGAAAGCGATGC, R: CACTCCATCCCAGGACCAAC; use the internal reference gene eF1a in rice seeds (F: GTCAAGTTTGCTGAGCTGGTG, R: CAGCATCACCGTTCTTGAGGA) as a control. Respectively put the seeds of wild-type rice plants WT, OsBGAL1 gene knockout mutant plants osbgal1-12, and osbgal1-26 into a transparent square germination box covered with two layers of wet filter paper, and place them in an incubator at 28 °C with a light / dark cycle of 12 h / 12 h. Detect the transcriptional expression level of the OsBGAL1 gene ( Figure 1 ) during rice germination. The results showed that the expression level of OsBGAL1 increased continuously and then decreased as the rice seeds imbibed, and reached the highest level at 48 h of imbibition; the expression level of OsBGAL1 in the embryos of the rice seeds of the OsBGAL1 gene knockout mutant lines osbgal1-12 and osbgal1-26 was lower than that of the wild-type seeds.

[0026] Example 3: Phenotypic analysis of OsBGAL1 - Analysis test of transgenic plant seed germination

[0027] Respectively put the seeds of wild-type rice plants WT, OsBGAL1 gene knockout mutant plants osbgal1-12, and osbgal1-26 into a transparent square germination box covered with two layers of wet filter paper, and place them in an incubator at 28 °C with a light / dark cycle of 12 h / 12 h. Set 4 biological replicates, with 100 rice seeds in each replicate. Observe the germination of the seeds at irregular intervals, taking the complete breakthrough of the germinal bud through the seed coat as the standard, and calculate the germination rate, germination rate = number of germinated seeds / total number * 100%. The experiment showed that the germination rate of the seeds of the OsBGAL1 gene knockout mutant lines was faster than that of the wild-type seeds ( Figure 2 ), and the germination rate in the early stage was higher and more uniform.

Claims

1. Application of knocking out the OsBGAL1 gene in accelerating rice seed germination and improving germination rate, wherein the nucleotide sequence of the OsBGAL1 gene is shown in SEQ ID NO.

1.

2. A method for obtaining improved rice with accelerated seed germination and increased germination rate, characterized in that: The following steps are involved: The knockout vector of the OsBGAL1 gene is constructed by using the CRISPR / Cas9 genome editing system. The nucleotide sequence of the OsBGAL1 gene is shown in SEQ ID NO.

1. Two specific target sequences used to construct the knockout vector are target 1: GGTGACGTACGACAAGAAGGCGG and target 2: CGGAGAAGAGAATCCTCCTCTGG. The knockout vector is then transferred into rice cells and integrated into chromosomes, and cells, tissues or organs in which the OsBGAL1 gene is successfully knocked out are screened to regenerate plants.

Images