Multiplex KASP Marker Primer Set for Major Gene Controlling Wheat Plant Height and Its Application

By developing multiple KASP marker primers for high-performance genes in wheat plants, the problem of difficulty in detecting Rht-B1 and Rht-D1 genes in the prior art is solved, and efficient and low-cost gene identification is achieved to meet the screening needs of large-scale breeding.

CN115807119BActive Publication Date: 2025-07-25JIANGSU ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211020169.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-24
Publication Date
2025-07-25
Estimated Expiration
2042-08-24

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently and at low cost to detect the high-performance genes of wheat plants Rht-B1 and Rht-D1 at a time, which cannot meet the screening needs of large-scale breeding.

Method used

A set of multiple KASP-marked primer sets of wheat plant high-activity genes were developed, including 2 forward specific primers and 1 reverse universal primer. The simultaneous identification of Rht-B1 and Rht-D1 genes was achieved through PCR amplification and fluorescence detection, improving detection efficiency and reducing costs.

Benefits of technology

The identification of Rht-B1 and Rht-D1 genes was achieved simultaneously in a PCR reaction, which doubled the efficiency and reduced the cost by half, greatly improving the breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115807119B_ABST
    Figure CN115807119B_ABST
Patent Text Reader

Abstract

The present application discloses a multiplex KASP marker primer set for major genes controlling wheat plant height, which consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.10, a reverse primer with a nucleotide sequence as shown in SEQ ID NO.11, and a common primer with a nucleotide sequence as shown in SEQ ID NO.9; this multiplex KASP marker primer set can simultaneously detect the Rht-B1 and Rht-D1 genes in wheat; compared with the existing detection methods, this primer set realizes the simultaneous detection of the Rht-B1 and Rht-D1 genes for the first time, doubles the efficiency, reduces the cost by half, greatly improves the breeding efficiency, and has broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of wheat breeding, in particular to a KASP marker primer set related to wheat plant height and its application. Background Art

[0002] Plant height is an important agronomic trait in wheat, which affects the morphological structure of plants and is closely related to the yield of field populations. The utilization of wheat dwarfing genes is an important part of the Green Revolution and has a profound impact on modern wheat breeding (Hedden P. The genes of the green revolution. Trends in Genetics, 2003, 19: 5-9). Classical genetic studies have shown that plant height in wheat is a complex trait controlled by multiple genes, with major genes and minor loci. To date, 25 Rht genes have been named (Mo Y, Vanzetti L S, Hale I, Spagnolo E J, Guidobaldi F, Al-Oboudi J, Odle N, Pearce S, Helguera M, Dubcovsky J. Identification and characterization of Rht25, a locus on chromosome arm 6AS affecting wheat plant height, heading time, and spike development. Theoretical and Applied Genetics, 2018, 131: 2021-2035; Tian X, Wen W, Xie L, Fu L, Xu D, Fu C, Wang D, Chen X, Xia X, Chen Q, He Z, Cao S. Molecular mapping of reduced plant height gene Rht24 in bread wheat. Frontiers in Plant Science, 2017, https: / / doi.org / 10.3389 / fpls.2017.01379; McIntosh R A, Dubcovsky J, Rogers W J, Morris C, Xia X C. Catalogue of gene symbols for wheat: 2017 supplement. https: / / shigen.nig.ac.jp / wheat / komugi / genes / macgene / sup-plement2017.pdf).Among them, the Rht-B1 and Rht-D1 genes located on chromosomes 4B and 4D are considered to be the major genes controlling wheat plant height, with a significant effect on reducing plant height, and are widely distributed in wheat breeding at home and abroad (Guedira M, Brown-Guedira G, Van Sanford D, Sneller C, Souza E, Marshall D. Distribution of Rht Genes in Modern and Historic Winter Wheat Cultivars from the Eastern and Central USA. Crop Science, 2010, 50: 1811-1822).

[0003] Molecular marker-assisted selection breeding can select for target traits at the DNA level. The results are not only stable, but also can be selected at the seedling stage, reducing the cost of phenotypic evaluation and improving the efficiency of wheat breeding. Ellis et al. successfully developed electrophoretic markers for Rht-B1 and Rht-D1, which can distinguish the dwarf genotypes of Rht-B1b and Rht-D1b from the tall genotypes of Rht-B1a and Rht-D1a by PCR / electrophoresis (Ellis M, Spielmeyer W, Gale K, Rebetzke G, Richards R. “Perfect” markers for the Rht-B1b and Rht-D1b dwarfing genes in wheat. Theoretical and Applied Genetics, 2002, 105: 1038-1042). However, the screening method is less efficient. The STS markers based on ordinary PCR amplification and electrophoresis technology can detect up to 96 samples at a time, and the daily throughput is about several hundred, which cannot meet the current needs of large-scale breeding screening.

[0004] The KASP (Kompetitive Allele Specific PCR) genotyping technology is based on the specific matching of the terminal bases of primers for SNP genotyping, which can accurately determine the bialleles of SNP loci. It has the characteristics of low cost and high throughput. Its single amplification throughput is more than ten thousand copies, and electrophoresis amplification is not required. The detection results can be directly obtained through fluorescence genotyping, which is especially suitable for the molecular marker detection of a large number of samples and is in line with breeding selection, having broad application prospects in breeding. Rasheed et al. successfully developed KASP assays for Rht-B1 and Rht-D1 (RASHEED A, WEN W, GAO F, ZHAI S, JIN H, LIU J, GUO Q, ZHANG Y, DREISIGACKER S, XIA X. Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theoretical and Applied Genetics, 2016, 129(10):1-18), and this KASP assay has been widely used in the screening of wheat materials at present (WANG Junchan, WU Xujiang, HU Wenjing, ZHANG Xiao, ZHANG Yong, GAO Derong, BIE Tongde, ZHANG Boqiao. KASP detection of functional genes for important traits in Yangmai series varieties (lines). Jiangsu Journal of Agricultural Sciences, 2019, 35:1271-1283).

[0005] Multiplex PCR can identify multiple gene loci at one time in the same reaction system, greatly saving time and reagents, and being more suitable for large-scale screening in the breeding process (XU Likui, PAN Binrong, YUE Gaohong, MEI Xixue, LIU Yong'an, ZHANG Zongchen, ZHOU Zhihui. Multiplex PCR molecular identification technology for powdery mildew-resistant waxy wheat. Acta Agriculturae Nucleatae Sinica, 2014, 28:1203-1207). Developing multiplex molecular markers based on the KASP assay system can further improve the detection efficiency and reduce costs. However, there are great difficulties in the selection of primers in multiplex KASP development. General primers are needed for amplification, and specific genotyping also needs to be achieved. Therefore, there are relatively few multiplex molecular markers based on the KASP assay system at present, and no multiplex KASP assay for identifying the two genes of Rht-B1 and Rht-D1 has been reported yet. Summary of the Invention

[0006] In view of the above problems, this application provides a set of multiplex KASP assay primer sets for the major genes controlling wheat plant height and their applications. At the same time, the identification of the two genes of Rht-B1 and Rht-D1 is completed, improving the existing detection efficiency and being more suitable for the screening requirements of large-scale breeding.

[0007] Specifically, the present application is achieved through the following technical solutions:

[0008] First, the present application provides a set of multiplex KASP marker primer sets for major wheat plant height genes, and the primer set consists of primer F with a nucleotide sequence as shown in SEQ ID NO.10, primer H with a nucleotide sequence as shown in SEQ ID NO.11, and universal primer R with a nucleotide sequence as shown in SEQ ID NO.9.

[0009] Second, the present application provides the application of the above multiplex KASP markers in simultaneously detecting Rht-B1 and Rht-D1 genes in wheat. That is, PCR amplification is performed on a wheat sample with the multiplex KASP marker primer set, and then fluorescence detection is performed on the amplification product; if the fluorescence detection result is type A (blue), it indicates that the genotype of the sample wheat is Rht-B1b / Rht-D1a (i.e., containing both Rht-B1b and Rht-D1a allelic variations), if the fluorescence detection result is type B (red), it indicates that the genotype of the sample wheat is Rht-B1a / Rht-D1b (i.e., containing both Rht-B1a and Rht-D1b allelic variations), if the fluorescence detection result is type C (green), it indicates that the genotype of the sample wheat is Rht-B1b / Rht-D1b (i.e., containing both Rht-B1b and Rht-D1b allelic variations), and if the fluorescence detection result is type D (black), it indicates that the genotype of the sample wheat is Rht-B1a / Rht-D1a (i.e., containing both Rht-B1a and Rht-D1a allelic variations) or blank.

[0010] The PCR amplification refers to: the total PCR reaction system is 5 μL, including 2.5 μL of 2×KASP Master Mix, 0.07 μL of KASP Assay Mix, and 2.43 μL of wheat template DNA with a concentration of 20 ng / μL;

[0011] Among them, every 100 μL of the KASP Assay Mix includes: 12 μL of primer F with a concentration of 100 μM, 12 μL of primer H with a concentration of 100 μM, 30 μL of primer R with a concentration of 100 μM, and supplemented to 100 μL with ddH2O.

[0012] The PCR reaction procedure is: 94°C for 15 min; 94°C for 20 s, 61 - 55°C for 1 min, with a decrease of 0.6°C for each cycle, for a total of 10 cycles; 94°C for 20 s, 55°C for 1 min, for a total of 26 cycles;

[0013] As shown in the embodiments, the KASP marker primers developed in this application have a wide range of sources, such as wheat seeds in the middle and lower reaches of the Yangtze River wheat region, the Huanghuai wheat region, the southwestern wheat region, the northern winter wheat region, and their hybrid offspring. Therefore, this KASP marker primer set is applicable to all varieties of wheat.

[0014] Compared with the existing PCR / electrophoresis detection method, this application adopts the multiplex KASP technology. The disclosed KASP marker primer set contains 2 forward specific primers and 1 reverse universal primer. The 2 forward specific primers can specifically bind to the target sequence for amplification, thereby realizing genotyping. The identification of two genes, Rht-B1 and Rht-D1, is completed simultaneously in one PCR reaction. Compared with the ordinary KASP marker detection, the efficiency is doubled and the cost is reduced by half, greatly improving the breeding efficiency and having a wide application prospect. Brief Description of the Drawings

[0015] Figure 1 It is a schematic diagram of differential SNPs;

[0016] Figure 2 It is the primer evaluation result;

[0017] Figure 3 It is the detection result of diagnostic markers and multiplex KASP markers P1, P2, and P3;

[0018] Figure 4 It is the detection result of 360 advanced generation lines. Detailed Embodiments

[0019] The sources of the test materials involved in the following embodiments:

[0020] Twenty-two wheat varieties and materials, including Ningmai 9 (Rht-B1b / Rht-D1a), Mianmai 37 (Rht-B1a / Rht-D1b), and Yangmai 5 (Rht-B1a / Rht-D1a), are all conventional wheat varieties (as disclosed in the following literature: Jiang Peng, Zhang Peng, Yao Jinbao, Wu Lei, He Yi, Li Chang, Ma Hongxiang, Zhang Xu. Analysis of the Trait Characteristics and Related Gene Loci of Ningmai Series Wheat Varieties. Scientia Agricultura Sinica, 2022, 55: 233-247; Wang Junchan, Wu Xujiang, Hu Wenjing, Zhang Xiao, Zhang Yong, Gao Derong, Bie Tongde, Zhang Boqiao. KASP Detection of Important Trait Functional Genes in Yangmai Series Varieties (Lines). Acta Agriculturae Jiangsuensis, 2019, 35: 1271-1283; Zhou Qiang, Yuan Zhongwei, Ou Junmei, Ren Yong, Du Xiaoying, Tao Jun, Li Shengrong, Liu Dengcai. Molecular Identification of Main Dwarfing Genes in Sichuan Wheat. Journal of Triticeae Crops, 2015, 35(12): 1624-1630). The specific wheat names involved in the examples are shown in Table 1, and some of the materials are set as replicates. The 360 advanced-generation lines are from the field seed selection nursery of the Academy of Agricultural Sciences (F5 generation). These materials are all obtained by crossing existing bred varieties or lines and continuous multi-generation field selection. The details of their sources are shown in Table 4. All the materials in the following examples are preserved and provided by the Wheat Genetics and Breeding Team of Jiangsu Academy of Agricultural Sciences.

[0021] Table 1 Biological Material Information

[0022]

[0023]

[0024] Germinate the seeds of all the test materials in Table 1 at room temperature for about 7 days, cut the young leaves, and extract genomic DNA using the conventional CTAB method (this extraction method is a conventional method, and the extraction method used in this example refers to the literature "Porebski S, Bailey L, Baum B. Modification of CTAB DNA Extraction Protocol for Plants Containing High Polysaccharide and Polyphenol Components. Plant Molecular Biology Reporter, 1997, 15: 8-15").

[0025] The diagnostic markers for the major plant height genes Rht - B1 and Rht - D1 were synthesized according to the report of RASHEED et al. (refer to the literature "RASHEED A, WEN W, GAO F, ZHAI S, JIN H, LIU J, GUO Q, ZHANG Y, DREISIGACKER S, XIA X. Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theoretical and Applied Genetics, 2016, 129(10): 1 - 18").

[0026] The gene sequences of Rht - B1a (FR668586.2), Rht - B1b (FN649763.1), Rht - D1a (AJ242531.1) and Rht - D1b (JF930281.1) were obtained from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) (the gene sequences can also be referred to the content disclosed in the literature "(Ellis M, Spielmeyer W, Gale K, Rebetzke G, Richards R. “Perfect” markers for the Rht - B1b and Rht - D1b dwarfing genes in wheat. Theoretical and Applied Genetics, 2002, 105: 1038 - 1042)"). Through sequence alignment, sequences with a length of about 20 bp were artificially selected at the differential SNPs as specific primers, and sequences with a length of about 20 bp were selected in the homologous sequence region as universal primers. Finally, the Primer 6.0 software was used to evaluate the artificially designed primers.

[0027] The obtained primers are shown in Table 2. The KASP marker system contains 2 specific primers (F / H) and one universal primer (R). When performing fluorescence detection, a specific sequence GAAGGTGACCAAGTTCATGCT that can bind to FAM fluorescence was added to the 5' end of primer F shown in Table 2; a specific sequence GAAGGTCGGAGTCAACGGATT that can bind to HEX fluorescence was added to the 5' end of primer H shown in Table 2. These primer sequences were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0028] The total volume of the KASP (PCR) reaction system is 5 μL, including 2.5 μL of 2× KASP Master Mix (LGC Biosearch Technologies), 0.07 μL of KASP Assay Mix, and 2.43 μL of template DNA with a concentration of 20 ng / μL;

[0029] Among them, every 100 μL of the KASP Assay Mix includes: 2 μL of primer F1 with a concentration of 100 μM, 2 μL of primer H1 with a concentration of 100 μM, 30 μL of primer R with a concentration of 100 μM, and the balance is made up with ddH2O.

[0030] The KASP Assay Mix KASP (PCR) reaction procedure is 94 °C for 15 min; 94 °C for 20 s, 61 - 55 °C for 1 min, with a decrease of 0.6 °C for each cycle, for a total of 10 cycles; 94 °C for 20 s, 55 °C for 1 min, for a total of 26 cycles. The PCR results are scanned and analyzed by a KASP fluorescence analyzer (model PHERAstarplus from LGC).

[0031] Example 1 Development and verification of multiplex KASP markers for Rht - B1 and Rht - D1

[0032] 1. Development of multiplex KASP markers for Rht - B1 and Rht - D1

[0033] Use the AlignX functional module of Vector NTI software to perform sequence alignment on Rht - B1a, Rht - B1b, Rht - D1a, and Rht - D1b. There is a C / T base difference between Rht - B1a and Rht - B1b at 190 bp, and a G / T base difference between Rht - D1a and Rht - D1b at 181 bp ( Figure 1 ), with a relatively short distance. Primers are designed for these two SNP differences. Through multiple rounds of adjustment of sequence positions and lengths, Primer 6.0 software is used for primer evaluation (the evaluation results are as Figure 2 shown), and finally three groups of primers P1, P2, and P3 are determined (Table 2).

[0034] Table 2 KASP primer sequences

[0035]

[0036] Three newly developed markers (P1, P2, and P3) in Table 2 were used to genotype 22 randomly selected materials (with some materials having replicates) in Table 1. That is, PCR amplification was performed using the primers of markers P1, P2, and P3 respectively, and then the PCR results were scanned and analyzed using a KASP fluorescence analyzer (model PHERAstar plus from LGC).

[0037] PCR reaction system (5 μL): 2.5 μL of 2×KASP Master Mix (LGC Biosearch Technologies), 0.07 μL of KASP Assay Mix, and 2.43 μL of wheat template DNA with a concentration of 20 ng / μL;

[0038] The PCR reaction program was: 94°C for 15 min; 94°C for 20 s, 61 - 55°C for 1 min, with a decrease of 0.6°C in each cycle, for a total of 10 cycles; 94°C for 20 s, 55°C for 1 min, for a total of 26 cycles.

[0039] Among them, the preparation method of KASP Assay Mix for marker P1 was: every 100 μL of KASP Assay Mix included: 12 μL of primer P1F with a concentration of 100 μM, 12 μL of primer P1H with a concentration of 100 μM, 30 μL of primer P1R with a concentration of 100 μM, and the balance was made up with ddH2O.

[0040] The preparation method of KASP Assay Mix for marker P2 was: every 100 μL of KASP Assay Mix included: 12 μL of primer P2F with a concentration of 100 μM, 12 μL of primer P2H with a concentration of 100 μM, 30 μL of primer P2R with a concentration of 100 μM, and the balance was made up with ddH2O.

[0041] The preparation method of KASP Assay Mix for marker P3 was: every 100 μL of KASP Assay Mix included: 12 μL of primer P3F with a concentration of 100 μM, 12 μL of primer P3H with a concentration of 100 μM, 30 μL of primer P3R with a concentration of 100 μM, and the balance was made up with ddH2O.

[0042] 2. Verification of the Rht - B1 and Rht - D1 multiplex KASP markers

[0043] Table 3 Primer sequences of the control group

[0044]

[0045] Meanwhile, the diagnostic markers of Rht-B1 and Rht-D1 were used as the control group (the primer sequences are shown in Table 3) to detect the above 22 materials (the primer sequences in Table 3 can be found in the literature "RASHEEDA, WEN W, GAO F, ZHAI S, JIN H, LIU J, GUO Q, ZHANG Y, DREISIGACKER S, XIA X. Development and validation of KASPassays for genes underpinning key economic traits inbread wheat. Theoreticaland Applied Genetics, 2016, 129(10): 1-18"). The fluorescence detection results are as Figure 3 shown.

[0046] As Figure 3 shown in (a) below, the diagnostic marker of Rht-B1 distinguishes between two allelic variations, Rht-B1a and Rht-B1b (blue for Rht-B1a and red for Rht-B1b); as Figure 3 shown in (b) below, the diagnostic marker of Rht-D1 distinguishes between two allelic variations, Rht-D1a and Rht-D1b (blue for Rht-D1a and red for Rht-D1b). The fluorescence detection results are as Figure 3 shown; Figure 3 in (c), (d), and (e) below are the genotyping results of P1, P2, and P3 respectively. It can be seen that all the materials of P1 and P2 were amplified into one group and the genotyping was not successfully completed; the genotyping of P3 was successfully completed: type A (Rht-B1b / Rht-D1a, blue), type B (Rht-B1a / Rht-D1b, red), type C (Rht-B1b / Rht-D1b, green), type D (Rht-B1a / Rht-D1a and blank, black), Figure 3 The detection results are listed in Table 1. Ningmai 8, Ningmai 9, etc. are of type A, Mianmai 37, Huaimai 33, etc. are of type B, P59 is of type C, Yangmai 5, amada, etc. are of type D. The repeated detection results of the same material are consistent, indicating that the multiplex KASP marker P3 can replace the diagnostic markers of Rht-B1a and Rht-B1b.

[0047] In this experiment, the nucleoside sequences of primer F', primer H' containing fluorescent sequences and the universal primer R actually used in group P3 are shown in SEQ ID NO.10 (GAAGGTGACCAAGTTCATGCTCCCATGGCCATCTCCAGCTA), SEQ ID NO.11 (GAAGGTCGGAGTCAACGGATTATGGCCATCTCGAGCTGCTA), and SEQ ID NO.9 respectively.

[0048] Application of Multiplex KASP Marker P3 in Example 2

[0049] 360 advanced-generation lines were rapidly identified using multiplex KASP marker P3. The sources of these 360 wheat samples are described in Table 4, and the detection results are shown in Table 4 and Figure 4 as follows.

[0050] Table 4 Genotyping Results of Wheat Materials

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065] The detection results are as Figure 4As shown, a total of 331 Rht-B1b / Rht-D1a types (blue), 18 Rht-B1a / Rht-D1b types (red), 3 Rht-B1b / Rht-D1b types (green), and 8 Rht-B1a / Rht-D1a types (black) were identified in the experiment. In this detection, only 1 384-well plate was used for 1 amplification reaction, while STS markers require 4 amplifications and 4 electrophoresis detections. Ordinary KASP markers require double the consumables and reagents. Therefore, the multiplex KASP marker P3 can greatly improve efficiency and reduce costs.

Claims

1. A multiplex KASP marker primer set for a group of major genes controlling wheat plant height, characterized in that, The primer set consists of primer F with a nucleotide sequence as shown in SEQ ID NO.10, primer H with a nucleotide sequence as shown in SEQ ID NO.11, and universal primer R with a nucleotide sequence as shown in SEQ ID NO.

9.

2. Use of the multiplex KASP marker primer set according to claim 1 in simultaneously detecting the genotypes of Rht-B1 and Rht-D1 in wheat; the Rht-B1 genotype is Rht-B1a genotype or Rht-B1b genotype, and the Rht-D1 genotype is Rht- D1a genotype or Rht-D1b genotype.

3. The application according to claim 2, wherein The application refers to performing PCR amplification on a wheat sample using the multiplex KASP marker primer set, and then performing fluorescence detection on the amplification product; if the fluorescence detection result is blue, it indicates that the genotype of the sample wheat is Rht-B1b / Rht-D1a ; if the fluorescence detection result is red, it indicates that the genotype of the sample wheat is Rht-B1a / Rht-D1b ; if the fluorescence detection result is green, it indicates that the genotype of the sample wheat is Rht- B1b / Rht-D1b ; if the fluorescence detection result is black, it indicates that the genotype of the sample wheat is Rht-B1a / Rht-D1a or blank.

4. The application according to claim 3, characterized in that, The PCR amplification refers to: PCR reaction system: 0.07 μL of KASP Assay Mix, 2.43 μL of wheat template DNA with a concentration of 20 ng / μL, and supplemented to 5 μL with 2×KASP Master Mix; Among them, every 100 μL of the KASP Assay Mix includes: 12 μL of primer F with a concentration of 100 μM, 12 μL of primer H with a concentration of 100 μM, 30 μL of universal primer R with a concentration of 100 μM, and supplemented to 100 μL with ddH2O; PCR reaction procedure: 94°C for 15 min; 94°C for 20 s, 61 - 55°C for 1 min, with a decrease of 0.6°C for each cycle, for a total of 10 cycles; 94°C for 20 s, 55°C for 1 min, for a total of 26 cycles.

Citation Information

Patent Citations

  • SSR marker Xgwm537 in close linkage with wheat dwarf gene RhtDC20 and application thereof

    CN103834647A

  • 2RL chromosome-specific codominant KASP molecular mark for rye and its application

    CN109234449A