Application of a polypeptide in preparing an adjuvant for Newcastle disease vaccine or an immune potentiating product
By using polypeptides with specific amino acid sequences as adjuvant for chicken Newcastle vaccines, the problem of low titers for vaccine immune antibodies is solved, and the immune effect of Newcastle vaccines is significantly improved.
Patent Information
- Application Number
- CN202211439719.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-17
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2042-11-17
AI Technical Summary
At this stage, the Chicken Newcastle epidemic has spread and the titer of vaccine immune antibodies is relatively low. The existing immune adjuvants and synergists are unstable under different feeding methods.
The polypeptide with a specific amino acid sequence of NPEVILPVPAFNVINGGSH is used as an immune adjuvant or synthesizing product for the chicken Newcastle vaccine, and is encoded and synthesized through E. coli or yeast expression vectors, and is used for spot drops or subcutaneous injection of the live chicken Newcastle vaccine.
The immunization effect of the Newcastle vaccine was significantly improved. The NDV HI antibody level in the polypeptide group was significantly higher than that in the control group on days 3, 7 and 14 after immunization, and the effect was particularly obvious on days 7 and 14 of the high-dose group.
Smart Images

Figure 202980DEST_PATH_IMAGE003 
Figure 285839DEST_PATH_IMAGE001 
Figure 559881DEST_PATH_IMAGE005
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of veterinary biological products, and particularly relates to the application of a polypeptide in preparing an adjuvant for Newcastle disease vaccine or an immune enhancing product. Background Art
[0002] Newcastle disease (ND), also known as Asian fowl plague, is an acute, highly contagious and virulent infectious disease of poultry mainly caused by the virulent Newcastle disease virus (NDV), which affects more than 250 different kinds of poultry such as chickens, turkeys, pigeons, various wild birds and ornamental birds. The typical symptoms of Newcastle disease are acute onset, dyspnea, purple-black head crest, diarrhea, bleeding and necrosis of the cloaca, bleeding at the junction of the glandular stomach papillae, glandular stomach and muscular stomach, and duodenum. The symptoms of chronic cases are more complex, often with respiratory symptoms or multiple symptoms such as nerves.
[0003] Newcastle disease is the most serious disease among the 11 serotypes of avian paramyxovirus. The World Organization for Animal Health (OIE) lists it as a notifiable disease (classified as Class A disease before 2005). During 2006 - 2009, Newcastle disease outbreaks were reported in 56 countries (a total of 167 countries and regions reported to the OIE). Among the 71 most important animal diseases in the world, Newcastle disease ranks second. The Ministry of Agriculture of China lists it as a Class I animal disease and it is one of the priority prevention and control diseases determined in the "National Medium- and Long-Term Animal Disease Prevention and Control Plan (2012 - 2020)". Newcastle disease not only brings devastating disasters to poultry (the mortality rate of non-immunized chicken flocks can be as high as 100%), but also seriously affects international trade. Once the disease occurs, the economic losses are huge. It is one of the most important and dangerous poultry diseases currently seriously endangering the poultry industry in China, directly restricting the development of the poultry industry and the export of poultry products, and posing a serious threat to food safety and human health.
[0004] Most countries in the world generally adopt a combination of immunization and culling to prevent and control Newcastle disease. Especially since the 1980s, live attenuated vaccines and inactivated vaccines for Newcastle disease have been promoted and applied, and the prevalence of the disease has been controlled to a certain extent. However, due to different economic development levels in different countries and diverse ways of raising poultry, the phenomenon of immune failure occurs from time to time, and the disease has become an endemic disease in many countries around the world.
[0005] To improve the immune effect of Newcastle disease vaccines for chickens, a variety of immune adjuvants and immune potentiators have been studied and applied. Immune adjuvants mainly include classical adjuvants based on aluminum hydroxide gel, alum, emulsions, and lipids, as well as biological immune adjuvants such as polypeptides, glycoproteins, and TLR agonists. Commercially available veterinary immune potentiators include transfer factor oral solution, porcine spleen transfer factor injection, recombinant chicken interleukin-2 injection, astragalus polysaccharide injection, etc. Regarding polypeptide immune adjuvants / potentiators, CN201210295586.X reported a heteropeptide bursin adjuvant and its preparation method and application, which is a heteropeptide sequence composed of the amino acid sequence Lys-His-Gly-NH2 of 14 bursin tripeptides, the amino acid sequence Lys-Asn-Pro-Tyr of 2 active tetrapeptides, and 6 histidines. It requires hybrid gene engineering treatment and its application is in the preparation of bursa of Fabricius vaccines. Summary of the Invention
[0006] In view of the sporadic occurrence of Newcastle disease in chickens in China at the current stage and the problem of low immune antibody titers of vaccines, the present invention synthesizes a polypeptide, which can be used as an immune adjuvant for Newcastle disease vaccines for chickens and can also be used as an immune potentiating product.
[0007] The technical solution of the present invention is as follows:
[0008] Use of a polypeptide in the preparation of an adjuvant for Newcastle disease vaccines or an immune potentiating product, wherein the amino acid sequence of the polypeptide is as shown in SEQ ID NO:1; specifically: NPEVILPVPAFNVINGGSH.
[0009] Another object of the present invention is to protect a set of nucleotides, which are used to encode the polypeptide of claim 1, and the nucleotide sequence is SEQ ID NO:2; specifically: AATCCTGAAGTTATTTTACCTGTTCCTGCTTTTAATGTTATTAATGGTGGTTCTCAT.
[0010] Preferably, an Escherichia coli expression vector pET-NPE is used to carry the nucleotides for encoding.
[0011] Another object of the present invention is to protect a set of nucleotides, which are used to encode the polypeptide of claim 1, and the nucleotide sequence is SEQ ID NO:3; specifically: AACCCAGAGGTTATCTTGCCAGTTCCAGCTTTCAACGTTATCAACGGTGGTTCTCAC.
[0012] Preferably, a yeast expression shuttle vector pAUR123-NPE is used to carry the nucleotides for encoding.
[0013] Preferably, the molecular structure of the polypeptide is Formula 1,
[0014]
[0015] Formula 1.
[0016] Advantages of the present invention
[0017] When chickens are immunized with Newcastle disease live vaccine by eye drop and nasal drip, and NH-19 polypeptide is orally administered or subcutaneously injected at the same time, the immune effect of Newcastle disease vaccine can be improved, and it can be used as an immune adjuvant or immune enhancer. After vaccination, good specific antibodies are produced. On the 3rd, 7th and 14th days after immunization, the NDV HI antibody levels in the polypeptide group are higher than those in the healthy control group and the vaccine control group, indicating that the polypeptide improves the immune effect of NDV live vaccine. Among them, the antibody levels in the high-dose oral polypeptide group on the 7th and 14th days are significantly higher than those in the immunization control group (P < 0.05), while the antibody level in the high-dose injected polypeptide group on the 14th day is significantly higher than that in the vaccine control group (P < 0.05), indicating that the effect of the polypeptide is related to the dose and time. Specific embodiments
[0018] Example 1
[0019] Application of a polypeptide in the preparation of an adjuvant for Newcastle disease vaccine or an immune enhancing product. The amino acid sequence of the polypeptide is as shown in SEQ ID NO:1; specifically: NPEVILPVPAFNVINGGSH. The polypeptide is encoded by an expression vector pET-NPE carrying nucleotide SEQ ID NO:2 on Escherichia coli. The nucleotide sequence is SEQ ID NO:2, specifically AATCCTGAAGTTATTTTACCTGTTCCTGCTTTTAATGTT ATTAATGGTGGTTCTCAT.
[0020] Example 2
[0021] Application of a polypeptide in the preparation of an adjuvant for Newcastle disease vaccine or an immune enhancing product. The amino acid sequence of the polypeptide is as shown in SEQ ID NO:1; specifically: NPEVILPVPAFNVINGGSH. The polypeptide is encoded by an expression shuttle vector pAUR123-NPE carrying nucleotide SEQ ID NO:3 on yeast.
[0022] The nucleotide sequence is SEQ ID NO:3, specifically AACCCAGAGGTTATCTTGCCAGTTCCAGCTTTCAACGTTATCAACGGTGGTTCTCAC.
[0023] Example of implementation effect 1 Safety test of polypeptide
[0024] 1 Materials and Methods
[0025] 1.1 Materials
[0026] 1.1.1 Polypeptide (NH-19): The polypeptide NPEVILPVPAFNVINGGSH was chemically synthesized by BGI Genomics Co., Ltd. and diluted to 40 mg / ml with sterile normal saline. Each chicken was orally administered or subcutaneously injected with 0.025 ml (containing 1 mg of polypeptide), 0.05 ml, or 0.1 ml.
[0027] 1.1.2 Experimental animals: 40 five-day-old commercial broiler chickens, and the complete feed for chicks was provided by Huimin Tianxi Animal Husbandry Co., Ltd.
[0028] 1.2 Methods
[0029] The experiment was divided into 7 groups, with 10 chickens in each group, including: high-dose (4 mg / chicken), medium-dose (2 mg / chicken), and low-dose (1 mg / chicken) oral polypeptide groups, high-dose (4 mg / chicken), medium-dose (2 mg / chicken), and low-dose (1 mg / chicken) subcutaneous injection polypeptide groups, and a healthy control group. After administration, the chickens were continuously observed for 14 days to observe their behavioral manifestations, food intake, and water intake. The body weight was measured weekly, and the internal organs were observed by autopsy after the experiment.
[0030] Results
[0031] The survival rate of each group was 100%. No abnormalities were found after the use of the polypeptide. After autopsy observation at the end of the experiment, there were no significant differences in the glandular stomach, muscular stomach, small intestine, cecum, colon, heart, liver, lung, spleen, kidney, and trachea of the chickens in each experimental group compared with the healthy group. The body weight is shown in Table 1.
[0032] Table 1 Average body weight of chickens in each experimental group
[0033]
[0034] Implementation Effect 2: Application as an immune adjuvant for Newcastle disease vaccine in chickens
[0035] 1 Materials and Methods
[0036] 1.1 Materials
[0037] 1.1.1 Polypeptide (NH-19): The polypeptide NPEVILPVPAFNVINGGSH was diluted to 10 mg / ml with sterile normal saline. Each chicken was orally administered or subcutaneously injected with 0.1 ml (containing 1 mg of polypeptide).
[0038] 1.1.2 Live Newcastle disease vaccine (HB1 strain): Provided by Guangdong Yongshun Biopharmaceutical Co., Ltd., dissolved and diluted with 30 ml of normal saline for standby.
[0039] 1.1.3 Test animals: 90 commercial broilers at 13 days old, provided by Huimin Tianxi Animal Husbandry Co., Ltd.
[0040] 1.1.4 Standard antigen: Standard antigen of NDV Lasota strain (Harbin Veterinary Research Institute).
[0041] 1.2 Methods
[0042] Randomly group and immunize according to Table 2. Each group starts the experiment at 13 days old, collects blood on the 3rd, 7th, and 14th days after immunization. 8 samples are collected each time for each group to detect the NDV HI antibody titer. Statistically analyze the antibody changes. The obtained data are statistically analyzed, and P < 0.05 indicates a significant difference.
[0043] Table 2 Experimental design
[0044]
[0045] 2 Results
[0046] Table 3 shows that good specific antibodies were produced after vaccination. On the 3rd, 7th, and 14th days after immunization, the NDV HI antibody levels in the polypeptide group were higher than those in the healthy control group and the vaccine control group, indicating that the polypeptide improved the immune effect of the NDV live vaccine. Among them, the antibody levels in the high-dose oral polypeptide group on the 7th and 14th days were significantly higher than those in the immunization control group (P < 0.05), while the antibody level in the high-dose injection polypeptide group on the 14th day was significantly higher than that in the vaccine control group (P < 0.05), indicating that the effect of the polypeptide is related to the dose and time.
[0047] Table 3 Production of NDV HI antibodies after immunization
[0048]
[0049] Note: Data marked with * in the same column indicate a significant difference between the polypeptide group and the vaccine control group (P < 0.05).
[0050] Conclusion
[0051] When chickens are immunized with NDV live vaccine by injection, and orally or subcutaneously injected with NH-19 polypeptide at the same time, it can improve the immune effect of the NDV vaccine and can be used as an immune adjuvant or immune enhancer.
Claims
1. Use of a polypeptide in the preparation of a Newcastle disease vaccine adjuvant or an immune enhancement product, characterized in that, The amino acid sequence of the polypeptide is as shown in SEQ ID NO: 1; specifically: NPEVILPVPAFNVINGGSH.
2. A nucleic acid encoding the polypeptide of claim 1, characterized in that, The nucleic acid sequence is SEQ ID NO: 2, specifically: AATCCTGAAGTTATTTTACCTGTTCCTGCTTTTAATGTTATTAATGGTGGTTCTCAT.
3. A nucleic acid encoding the polypeptide of claim 1, wherein, The nucleic acid sequence is SEQ ID NO: 3, specifically: AACCCAGAGGTTATCTTGCCAGTTCCAGCTTTCAACGTTATCAACGGTGGTTCTCAC.
Citation Information
Patent Citations
Hybrid peptide bursin adjuvant and preparation method and application thereof
CN102796200B
Fabricius bursa active hexapeptide for promoting immunoreaction of avian influenza and / or Newcastle disease bivalent vaccine and use thereof
CN109180784A
Fabricius bursa activity pentapeptide for promoting immune response of AIV and / or NDV vaccine and application thereof
CN109705194A