An extracellular polysaccharide-producing microalgae and its application in improving saline-alkali soil
By screening and applying the extracellular polysaccharide microalgae YJ-2, the problem of high cost and limited effect in improving saline-alkali earth is solved, and effective improvement of saline-alkali earth is achieved, reducing the pH and conductivity of saline-alkali earth, and improving the organic matter and enzyme activity of the soil.
Patent Information
- Application Number
- CN202210853462.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-08
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2042-07-08
AI Technical Summary
The prior art has high cost, frequent use and limited improvement of soil quality when improving saline-alkali soil, especially in the management of large-area saline-alkali soil.
A microalgae with extracellular polysaccharides named Zanya YJ-2 was screened and used. This algae strain can significantly reduce the pH and conductivity of saline-alkali earth, and improve the soil's organic matter, total sugar content and enzyme activity.
By inoculating YJ-2 algae liquid on the surface of saline-alkali earth, the algae crust is formed, which significantly improves the quality of saline-alkali earth, reduces the pH and electrical conductivity of saline-alkali earth, and improves the organic matter and enzyme activity of the soil. It is low in cost and suitable for large-scale use.
Smart Images

Figure SMS_1 
Figure HDA0003737791530000011 
Figure HDA0003737791530000012
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of soil improvement, and particularly relates to a microalgae producing extracellular polysaccharide and its application in improving saline-alkali soil. Background Art
[0002] Saline-alkali soil is a typical degraded soil. There are more than 1.125 billion hectares of saline-alkali soil distributed globally, and about 800 million hectares of arable land are affected by salinization. The area of saline-alkali land in China is about 99 million hectares, mainly distributed in the Northeast Plain, the arid and semi-arid regions of the Northwest, the Huang-Huai-Hai Plain and the eastern coastal areas. The most significant feature of saline-alkali soil is that its pH value is higher than that of normal soil, and soil salinity is a major abiotic stress factor, which will deteriorate the soil quality, thus resulting in the inhibition of plant growth. Salt stress also affects the soil biological properties by inhibiting enzyme activity and reducing the abundance and diversity of the microbial community.
[0003] At present, there are various methods for improving saline-alkali soil, including physical, chemical, biological and engineering improvements, to improve soil quality and crop yield. Chinese Patent (Application No.: 202111343482.7) uses a combination of citric acid, amino acid powder, ammonium nitrate, urea phosphate, mineral source fulvic acid, enzymolyzed pollen and water to improve saline-alkali soil, but it needs to be applied multiple times during the implementation process, increasing the cost, and the addition of chemicals always has two sides to the soil quality. Chinese Patent (Application No.: 202120710554.6) developed a rapid recyclable improvement device for the salt elution of saline-alkali soil, but the input cost and regular maintenance cost of these devices are relatively high, making it difficult to achieve sustainable development.
[0004] Biological improvement methods have the advantages of resource conservation, ecological friendliness, environmental economy, etc., and are attracting more and more attention from all parties. Microalgae are important producers in natural ecosystems and play an indispensable role in the transformation of soil elements, especially the carbon cycle, which is beneficial to increasing soil fertility. The extracellular polysaccharide secreted by microalgae can bind soil particles to form a three-dimensional extracellular polymer matrix, which plays an important role in anti-corrosion, water retention and preventing harmful environmental stresses. Therefore, seeking methods to use microalgae to improve saline-alkali soil has important practical significance for exerting its ecological functions and improving the quality of saline-alkali soil. Chinese Patent (Application No.: 201910775218.7) provides an efficient saline-alkali soil treatment technology with algal activity; Chinese Patent (Application No.: 202010231785.9) provides a plant nutrient composition using microalgae as raw materials and its preparation method. The above-mentioned inventions are all composite nutrients prepared by mixing multiple microalgae, and some of them need to be applied multiple times during the application process, with a large dosage, high input and maintenance costs, so they face certain difficulties in the treatment of large areas of saline-alkali land. Summary of the Invention
[0005] Aiming at the problems existing in the prior art, the present invention provides a microalgae strain producing extracellular polysaccharide and its application in improving saline-alkali soil. The microalgae strain producing extracellular polysaccharide can significantly reduce the pH and electrical conductivity of saline-alkali soil, and improve the organic matter, total sugar content and enzyme activity of saline-alkali soil.
[0006] The present invention is achieved through the following technical solutions:
[0007] A microalgae strain producing extracellular polysaccharide, screened from the surface layer of a saline-alkali soil in the Guanzhong Plain, named YJ-2, was deposited at the China Center for Type Culture Collection (Wuhan University Culture Collection Center) on June 14, 2022, with the deposit number of CCTCC NO: M2022884.
[0008] The characteristics of YJ-2 are as follows: in BG-11 liquid medium, it can reach its logarithmic growth phase after 3 days of artificial climate cultivation; through microscopic observation, YJ-2 cells are usually in the form of 2, 4 or 8 superimposed on each other, showing a palisade or tetragonal arrangement on the plane, with a smooth cell wall, spines, teeth or raised lines.
[0009] The gene sequence characteristics of the 18S rDNA of YJ-2 are as follows: the length of the 18S rDNA sequence is 653bp. By comparing the 18S rDNA sequence with the GenBank database through BLAST, it is found that this algal strain has a high homology with Scenedesmus sp. ( Scenedesmus sp. S1MT340974.1); combined with the observation results of its morphological structure, this algal strain is determined to be the genus Scenedesmus ( Scenedesmus sp. ), named Scenedesmus sp. YJ-2 (Scenedesmus sp. YJ-2). The 18S rDNA sequence is shown in SEQ ID NO: 1, specifically:
[0010] cttccgtaggggaacctgcggaaggatcattgaatatgcaaaccacaacacgcactctttatttgtgttcgacgttaggtcaacacgcgcaagcgtgtggcctactaacctacacaccattgaccaaccatttatcaaaccaaactctgaagctttggctgccgttaaccggcagttctaacaaagaacaactctcaacaacggatatcttggctctcgcaacgatgaagaacgcagcgaaatgcgatacgtagtgtgaattgcagaattccgtgaaccatcgaatctttgaacgcatattgcgctcgactcctcggagaagagcatgtctgcctcagcgtcggtttacaccctcacccctcttccttaacaggaggcgcctgtcgtgcttgcttaagccggcagcaggggtggatctggctctcccaatcggattcactctggttgggttggctgaagcacagaggcttaaactgggacccaattcgggctcaactggataggtagcaacaccctcgggtgcctacacgaagttgtgtctgaggacctggttaggagccaagcaggaaacgcgtctctggcgcgtactctgtattcgacctgagctcaggcaaggctacccgctgaacttaagcatatcaataagccggagg。
[0011] The application of the above-mentioned Scenedesmus sp. YJ-2 in improving saline-alkali soil. The specific application is to inoculate the Scenedesmus sp. YJ-2 algal solution in the logarithmic growth phase onto the surface of saline-alkali soil, grow to form a uniform algal crust, and then improve the saline-alkali soil.
[0012] A method for inoculating Scenedesmus sp. YJ-2 to improve saline-alkali soil, comprising the following steps:
[0013] (1) Inoculate the purified Scenedesmus sp. YJ-2 into a sterile liquid medium, and culture it under light until the logarithmic phase to obtain a highly active Scenedesmus sp. YJ-2 algal solution.
[0014] (2) Uniformly spray and inoculate the Scenedesmus sp. YJ-2 algal solution onto the surface of saline-alkali soil, and place the inoculated saline-alkali soil in an artificial climate incubator for culture, and regularly supplement water to form a microalgae biological crust growing uniformly on the surface of saline-alkali soil.
[0015] In the above method, the sterile liquid medium used in step (1) is BG-11 medium.
[0016] In the above method, the total chlorophyll content in the Scenedesmus sp. YJ-2 algal solution in step (2) is 2 - 5 μg / mL.
[0017] In the above method, the Scenedesmus sp. YJ-2 algal solution in step (2) is inoculated evenly on the surface of saline-alkali soil at 0.24 ± 0.06 μg (total chlorophyll) / cm 2 The saline-alkali soil surface is inoculated evenly.
[0018] In the above method, the saline-alkali soil in step (2) is light to medium saline-alkali soil, and the soil soluble salt content is 1.02 - 3.82 g / kg.
[0019] In the above method, the culture conditions of the artificial climate incubator in step (2) are: temperature 25°C, light intensity 120 μEm -2 s -1 , light / dark is 16 / 8 h, and according to the change of soil moisture content, water is supplemented every day to keep its water content at 20 - 25%.
[0020] In the above method, the culture time after inoculating Scenedesmus sp. YJ-2 in the saline-alkali soil is 15 - 60 d.
[0021] Compared with the prior art, the present invention has the following beneficial effects:
[0022] Through a reasonable screening process, the present invention screened a microalgae strain producing extracellular polysaccharide from saline-alkali soil, named Scenedesmus sp. YJ-2, which belongs to indigenous microalgae. This microalgae has a high extracellular polysaccharide yield. After a large number of propagations, it is applied to the improvement of saline-alkali soil, which can improve the quality of saline-alkali soil. It can achieve a good effect of improving saline-alkali soil without being compounded with other algae, so the input cost is very low, and the microalgae has good environmental adaptability.
[0023] Through good environmental control of growth conditions, the present invention inoculates YJ-2 in saline-alkali soil, and a stable algal crust can be formed on the surface of saline-alkali soil in a short time, and then the saline-alkali soil is improved through the metabolic activities of microalgae. After inoculating YJ-2 in the present invention, the pH and conductivity of the saline-alkali soil show an obvious decreasing trend, and the organic matter, total sugar content and soil enzyme activity show an increasing trend, indicating that YJ-2 can effectively improve the quality of saline-alkali soil and has potential application prospects, providing a way for improving saline-alkali soil.
[0024] Furthermore, the microalgae algal solution used in the present invention has a low dosage, which can reduce costs and is conducive to large-scale use and promotion. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 It is the morphological characteristics of Scenedesmus sp. YJ-2 under microscope observation.
[0026] Figure 2 It is the molecular biological phylogenetic tree of Scenedesmus sp. YJ-2.
[0027] Figure 3 It is the algal crust formed on the surface of saline-alkali soil 15 d after inoculating Scenedesmus sp. YJ-2.
[0028] Figure 4 It is the dynamic change curve of microalgae biomass in saline-alkali soil after inoculating Scenedesmus sp. YJ-2. Specific implementation manners
[0029] To further understand the present invention, the present invention will be described below in combination with embodiments. These descriptions are only to further explain the features and advantages of the present invention and are not used to limit the claims of the present invention.
[0030] Example 1: Screening of indigenous microalgae in saline-alkali soil
[0031] Collect the surface soil (0-1 cm) with microalgae in natural light and medium saline-alkali land. Place the surface soil sample in a sterilized 250 mL transparent conical flask, add sterilized BG-11 liquid medium until most of the surface soil sample is immersed but not completely submerged, and then place it in an artificial climate incubator at 25 °C, light intensity of 120 μEm -2 s -1 , with a light / dark cycle of 16 / 8 h for enrichment culture. After the surface of the surface soil sample becomes significantly green, pick a little sample and transfer it to a new BG-11 liquid medium for re-enrichment culture. Then, use the plate coating method to dilute and coat the algal solution on the solid BG-11 medium for separation and purification to obtain single algal cell colonies. Pick several single-cell colonies, continue to expand the culture with the liquid medium, and observe the morphology of algal cells under a microscope until a single pure algal strain is obtained. Preserve several pure algal strains obtained by screening with solid BG-11 medium for later use.
[0032] Example 2: Identification of the ability of microalgae to produce extracellular polysaccharides
[0033] (1) Qualitative detection of extracellular polysaccharide production by microalgae
[0034] Add 100 mL of sterilized BG-11 liquid medium to a 250 mL transparent conical flask. Inoculate several algal strains preserved on the solid BG-11 medium into the BG-11 liquid medium, and place it at 25 °C, light intensity of 120 μEm -2 s -1Enrich and culture for 3 days in an artificial climate incubator with a light / dark cycle of 16 / 8 h. During the light period, shake the culture medium thoroughly every 2 h to promote the reproduction of microalgae and avoid the aggregation of algal cells. After 3 days of culture, collect the microalgae culture solution, add an equal volume of absolute ethanol solution, let it stand for 2 h, and then centrifuge at 8000 rpm for 15 min. Dissolve the precipitate in 10 mL of deionized water, add 1 mL of DNS reagent, and react in a boiling water bath for 5 min. After cooling, observe whether the solution shows a reddish-brown color. If it shows a reddish-brown color, it indicates that the microalgae secrete extracellular polysaccharides. Compare the depth of the reddish-brown color in the reaction solutions of different microalgae, and select the microalgae strain with the darkest color, named YJ-2.
[0035] (2)Determination of extracellular polysaccharide content
[0036] The phenol-sulfuric acid method was used to determine the extracellular polysaccharide content. Accurately weigh 50 mg of glucose dried to constant weight at 105 °C and dissolve it in distilled water, then make up the volume to 50 mL in a volumetric flask to prepare a standard solution of 0.1 mg / mL. Use distilled water to prepare solutions with concentrations of 0, 0.02, 0.04, 0.06, 0.08, and 0.1 mg / L respectively. Take 1 mL of standard solutions with different concentration gradients, add 1 mL of 5% phenol solution respectively, and then quickly add 5 mL of concentrated sulfuric acid, let it stand for 10 min, and shake well. After standing at room temperature for 30 min, measure the absorbance at 490 nm. Use the glucose content as the abscissa and the absorbance value as the ordinate to make a standard curve.
[0037] Under the conventional culture conditions, the extracellular polysaccharide yield of the microalgae YJ-2 obtained in this example is 312.36 ± 25.63 mg / L.
[0038] Example 3: Identification of YJ-2
[0039] The morphological characteristics and taxonomic status of YJ-2 were observed and identified according to the following method.
[0040] (1)Through microscopic observation, the YJ-2 cells are usually in the form of 2, 4, or 8 superimposed cells, showing a palisade or tetragonal arrangement on the plane, with a smooth cell wall, spines, teeth, or raised lines, as Figure 1 shown.
[0041] (2)Taxonomic status identification of YJ-2: Microalgae 18S rDNA gene sequencing included the extraction of algal strain DNA, in vitro PCR amplification of 18S rDNA (using 18S universal primers ITS1 [5’-TCCGTAGGTGAACCTGCGG-3’] and ITS4 [5’-TCCTCCGCTTATTGATATGC-3’]) to obtain a 653bp gene fragment. The sequenced sequence results were entered into the NCBI database for BLAST gene sequence alignment. After analysis with MEGA software, the 18S rDNA sequence of the strain was aligned with that of similar strains in the database, and a phylogenetic tree of the strain 18S rDNA was established, as Figure 2 shown. The results showed that the microalgae YJ-2 had a relatively high homology with Scenedesmus sp. with a similarity of 78%. At the same time, combined with the results of microscopic morphological observation, this algal strain was identified as Scenedesmus ( Scenedesmus sp ), with the serial number OM964574.
[0042] Example 4: Growth status of YJ-2 in saline-alkali soil and changes in soil properties of saline-alkali soil after inoculation with YJ-2
[0043] The YJ-2 algal solution was evenly inoculated on the surface of saline-alkali soil at 0.28 μg (total chlorophyll) / cm 2 and cultured in an artificial climate incubator. Water was replenished every day to make up for the lost water to keep the water content at 20 - 25%. An obvious algal crust could be formed in 15 d (as Figure 3 ). The dynamic changes of microalgae biomass in saline-alkali soil were measured at 15, 30, 45, and 60 d respectively, and the pH, electrical conductivity, organic matter, total sugar content, and enzyme activity of saline-alkali soil were measured at 60 d.
[0044] Method for measuring microalgae biomass in saline-alkali soil: Take the algal crust soil per unit area (1 cm in diameter) into a 10 mL centrifuge tube, add 5 mL of absolute ethanol, shake well, and perform dark treatment for extraction for 24 h. Shake it again three times during this period to extract chlorophyll in saline-alkali soil. After the extraction, centrifuge at 8000 rpm for 15 min. Measure the absorbance of the supernatant at 665 and 652 nm, and calculate the chlorophyll content. The dynamic change curve of microalgae biomass in saline-alkali soil after inoculation with YJ-2 is as Figure 4 shown. The chlorophyll content in the algal crust gradually increased with the culture time, indicating that YJ-2 showed good adaptability to saline-alkali soil.
[0045] Measure the pH, electrical conductivity, organic matter, total sugar content, as well as the activities of catalase, sucrase and urease in saline-alkali soil before and after inoculating microalgae YJ-2. The pH and electrical conductivity of saline-alkali soil are measured by a pH meter and a conductivity meter respectively, the organic matter is measured by the potassium dichromate volumetric method, the catalase is measured by the potassium permanganate titration method, the sucrase is measured by the 3,5-dinitrosalicylic acid colorimetric method, the urease is measured by the sodium phenolate-sodium hypochlorite colorimetric method, and the total sugar is measured by the phenol-sulfuric acid method. After culturing for 60 d with inoculated YJ-2, the changes in some properties of the saline-alkali soil are shown in Table 1.
[0046] Table 1 Changes in pH, electrical conductivity, organic matter, enzyme activity and total sugar content of saline-alkali soil after culturing for 60 d with inoculated YJ-2
[0047]
[0048] As can be seen from Table 1, compared with the non-inoculated YJ-2, the pH and electrical conductivity of the saline-alkali soil decreased, and the contents of organic matter, total sugar and enzyme activity in the soil all increased to varying degrees, indicating that inoculating YJ-2 can improve the quality of saline-alkali soil.
Claims
1. An extracellular polysaccharide-producing microalga, characterized in that, The extracellular polysaccharide-producing microalgae belong to the genus Scenedesmus ( Scenedesmus sp. ), and are deposited in the China Center for Type Culture Collection. The deposit date is June 14, 2022, and the deposit number is CCTCC NO: M2022884.
2. The extracellular polysaccharide-producing microalgae according to claim 1, wherein The 18S rDNA sequence of the extracellular polysaccharide-producing microalgae is as shown in SEQ ID NO:
1.
3. Use of the extracellular polysaccharide-producing microalgae according to any one of claims 1-2 in improving saline-alkali soil.
4. The application according to claim 3, characterized in that Comprising: (1) Inoculating the purified extracellular polysaccharide-producing microalgae into a sterile liquid medium and culturing under light until the logarithmic phase to obtain a microalgae liquid; (2) Uniformly spraying and inoculating the microalgae liquid on the surface of saline-alkali soil, and culturing the inoculated saline-alkali soil in an artificial climate, regularly supplementing water to form a microalgae biological crust growing uniformly on the surface of saline-alkali soil.
5. The application according to claim 4, characterized in that In step (1), the sterile liquid medium is BG-11 medium.
6. The application according to claim 4, characterized in that In step (2), the total chlorophyll content in the microalgae liquid is 2-5 μg / mL.
7. The application according to claim 6, characterized in that, With a chlorophyll meter, the microalgae algal solution was inoculated on the surface of saline-alkali soil at 0.24 ± 0.06 μg / cm 2 .
8. The application according to claim 4, wherein In step (2), the artificial climate conditions are: temperature 25°C, light intensity 120 μEm -2 s -1 , light / dark cycle 16 / 8 h.
9. The application according to claim 4, wherein In step (2), regularly supplementing water to keep the water content of the saline-alkali soil at 20-25%.
10. The application according to claim 4, characterized in that, The inoculated saline-alkali soil is cultured in an artificial climate for 15-60 d.
Citation Information
Patent Citations
Efficient saline and alkali soil control technology through activity of algae
CN110476530A
Plant nutrient composition as well as preparation method and application thereof
CN111285711A
Saline-alkali soil conditioner
CN114015453A
Rapid and recyclable device for improving severe saline-alkali soil
CN214719339U