STK11 flox / flox LTF Cre / - Transgenic mouse endometrial tumor cell line and its application

Abstract

The present invention belongs to the technical field of cell line construction, and particularly relates to a STK11 flox / flox LTF Cre / ‑ Transgenic mouse endometrial tumor cell line and its application. flox / flox LTF Cre / ‑ The deposit number of the transgenic mouse endometrial tumor cell line is CCTCC NO: C2022278. The cell line provided by the present invention has good wall adhesion performance, stable cell characteristics, can be stably passaged for multiple times, has uniform morphological characteristics during passage, can maintain typical characteristics of epithelial cells during passage, has clinical biological characteristics close to tumors, has strong proliferation activity and tumor formation ability, has a high tumor formation rate, is suitable for establishing an endometrial tumor animal model, and provides new ideal experimental materials that are closer to clinical tumor biological characteristics for studying the occurrence and development molecular mechanism of endometrial cancer and screening anti-endometrial cancer drugs.

Description

Technical Field

[0001] The present invention relates to the technical field of cell line construction, and in particular to a STK11 flox / flox LTF Cre / - Transgenic mouse endometrial tumor cell lines and their applications. Background Art

[0002] Endometrium cancer (EC) is one of the most common malignant tumors of the female reproductive tract. Most of them are adenocarcinomas, which are more common in elderly women. There is no effective prevention method at present. There is no specific chemotherapy and radiotherapy program for patients with advanced stage and those who cannot tolerate surgery. The establishment of endometrial cancer cell lines and animal cell models with different characteristics is the basis for in-depth research on endometrial cancer. As an important model for the study of human diseases, mice have established a primary endometrial cancer mouse model induced by a single cause (transgenic) to conduct in-depth research on endometrial cancer. However, due to its high experimental cost, long time, high energy consumption, and complex external factors, it has not been widely used.

[0003] The cost of establishing cell lines by direct in vitro culture of clinical tumor tissues is low, and it has become a common method for basic medicine and clinical medicine research and is widely used as a powerful tool for cancer research. However, this method is easily mixed with other non-tumor cells and has a low success rate. In addition, this method cannot faithfully replicate the progress of tumor biology that depends on tumor-host interactions. At present, there are dozens of established human endometrial cancer cell lines, but there are still few reported applicable mouse endometrial cancer cell lines. Moreover, due to differences in source background and race, the molecular mechanisms involved are different, which is not conducive to accurate mechanism analysis of the cause. Therefore, this research field urgently needs to develop mouse endometrial tumor cell lines with clear etiology, stable passage, high tumorigenicity, and suitable for establishing a variety of animal models. Summary of the invention

[0004] In view of the problems existing in the prior art, the present invention provides a STK11 flox / flox LTF Cre / - The invention discloses a transgenic mouse endometrial tumor cell line and its application, aiming to solve part of the problems in the prior art or at least alleviate part of the problems in the prior art.

[0005] The present invention is specifically implemented through the following technical solutions:

[0006] The first aspect of the present invention provides a STK11 flox / flox LTF Cre / - Transgenic mouse endometrial tumor cell line, the STK11 flox / flox LTF Cre / -The deposit number of the transgenic mouse endometrial tumor cell line is CCTCC NO: C2022278.

[0007] Furthermore, the STK11 flox / flox LTF Cre / - The genotype of the transgenic mouse endometrial tumor cell line is STK11 flox / flox LTF Cre / - .

[0008] Furthermore, the STK11 flox / flox LTF Cre / - Transgenic mouse endometrial tumor cell lines do not express STK11 protein.

[0009] In addition, the second aspect of the present invention provides the STK11 as described above flox / flox LTF Cre / - Descendant cell lines of transgenic mouse endometrial tumor cell lines.

[0010] In addition, the third aspect of the present invention provides the STK11 as described above flox / flox LTF Cre / - The application of transgenic mouse endometrial tumor cell lines or their progeny cell lines in studying the occurrence mechanism and drug resistance mechanism of endometrial cancer or screening drugs for treating endometrial cancer.

[0011] In addition, the fourth aspect of the present invention provides the STK11 as described above flox / flox LTF Cre / - Application of transgenic mouse endometrial tumor cell lines or their progeny cell lines in preparing mammalian tumor animal models.

[0012] Furthermore, the mammal includes immunodeficient nude mice or wild-type mice.

[0013] In addition, the fifth aspect of the present invention provides a method for establishing an endometrial tumor animal model, comprising the following steps:

[0014] S1, as described above STK11 flox / flox LTF Cre / - The transgenic mouse endometrial tumor cell line or its progeny cell line is inoculated subcutaneously or intrauterinely in a mammal;

[0015] S2. Raising the mammal for 30-60 days to obtain an endometrial tumor animal model.

[0016] Furthermore, in step S1, the inoculum size is 1×10 6 -1×10 8 cells.

[0017] Furthermore, the mammal is an immunodeficient nude mouse or a wild-type mouse.

[0018] The advantages and positive effects of the present invention are:

[0019] 1. STK11 provided by the present invention flox / flox LTF Cre / - The transgenic mouse endometrial tumor cell line has good adhesion properties and typical cobblestone epithelial morphology. The cell traits are stable and can be stably passaged for multiple times. The morphological characteristics are uniform during the passage process, and the typical characteristics of epithelial cells can be maintained during the passage process. It has clinical biological characteristics close to tumors, and has strong proliferation activity and tumor-forming ability, with a high tumor formation rate. It is suitable for establishing an endometrial tumor animal model, providing new ideal experimental materials that are closer to the biological characteristics of clinical tumors for studying the occurrence and development of endometrial cancer and the molecular mechanism of anti-endometrial cancer drug screening.

[0020] 2. Through genotyping, it was found that it does not express STK11 protein and is a brand-new endometrial cancer cell line, which enriches and completes the endometrial cancer cell line library. In addition, it has a clear genetic background, tumor pathogenesis and genetic characteristics, making it an ideal cell line for studying the mechanism of endometrial tumors and preclinical trials, laying a foundation for studying the various functions and intervention regulation of endometrial cancer at the cellular and molecular levels, especially for in vitro research on the STK11 gene and related pathway genes in endometrial tumors.

[0021] 3. The present invention is the first to use conditional reprogramming (CR) technology to cultivate immortalized mouse endometrial tumor cell lines. Compared with human tumor cell lines that can only be transplanted in immunodeficient mice, this technology can not only form tumors in immunodeficient mice, but can also be transplanted in immune-competent wild-type mice. It has a wider range of applications and provides a usable model for immune research on endometrial cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0023] Figure 1 This is a diagram showing the gross morphological characteristics of the mouse endometrial tumor cell line LHO1 under an optical microscope according to an embodiment of the present invention;

[0024] Figure 2This is a crystal violet staining image of the mouse endometrial tumor cell line LHO1 according to an embodiment of the present invention;

[0025] Figure 3 This is an immunohistochemical staining image of the mouse endometrial tumor cell line LHO1 according to an embodiment of the present invention;

[0026] Figure 4 This is an immunofluorescence staining image of the mouse endometrial tumor cell line LHO1 according to an embodiment of the present invention;

[0027] Figure 5 The agarose gel electrophoresis diagram of the mouse endometrial tumor cell line LHO1 genome in the embodiment of the present invention;

[0028] Figure 6 This is a Western Blot detection diagram of the mouse endometrial tumor cell line LHO1 genome according to an embodiment of the present invention;

[0029] Figure 7 This is a diagram of the species identification of the mouse endometrial tumor cell line LHO1 according to an embodiment of the present invention;

[0030] Figure 8 A cell doubling curve of the mouse endometrial tumor cell line LHO1 according to an embodiment of the present invention;

[0031] Fig. 9 The general appearance of the subcutaneous transplanted tumors of the immunodeficient mouse NOD and the wild-type mouse C57 according to the embodiment of the present invention;

[0032] Fig.10 This is a diagram of a transplanted tumor of a subcutaneous transplanted tumor endometrial tumor animal model according to an embodiment of the present invention. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with the examples. The equipment and reagents used in each embodiment and test example can be obtained from commercial sources unless otherwise specified. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0034] Based on the information contained in this application, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined process, properties or components, because these embodiments and other descriptions are only for illustrating specific aspects of the present invention. In fact, various changes that the technicians in this field or related fields can obviously make to the embodiments of the present invention are all covered within the scope of the appended claims.

[0035] In order to better understand the present invention but not to limit the scope of the present invention, all the numbers used in this application to express the amount, percentage, and other numerical values ​​should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant figures and by conventional rounding methods.

[0036] In order to make the above-mentioned objects, features and advantages of the present invention more clearly understood, the specific embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. The experimental methods in the following embodiments without specifying specific conditions are generally based on the conditions recommended by the manufacturer.

[0037] Serine / threonine kinase 11 (STK11) was identified in 1998 as the mutated gene in Peutz-Jeghers syndrome (PJS), an inherited cancer predisposition characterized by gastrointestinal polyposis and a high incidence of cancer, particularly at various anatomical sites, including the gastrointestinal tract, lung, and female genital tract. Women with PJS have a high incidence of uterine corpus (endometrium) and cervical cancer. Loss of the STK11 protein is observed in approximately 20% of primary endometrial cancers. Loss of the STK11 gene in a mouse model of endometrial adenocarcinoma is associated with significant invasiveness, rapid disease progression and spread, and leads to early death. In a mouse model based on STK11 gene deletion, a distinct tumorigenic phenotype, a well-differentiated endometrioid adenocarcinoma, can be observed in the mouse endometrium, indicating that the STK11 gene is an extremely important tumor suppressor gene in the endometrium. The short latency, complete penetration, diffuse growth pattern and lack of definable morphological precursors together strongly demonstrate that STK11 inactivation is sufficient to cause the malignant transformation of endometrial epithelial cells into invasive adenocarcinoma without the need for cooperating oncogenic mutations, that is, the rapid development of endometrial cancer can be achieved without the need for co-mutations in other tumor-related genes of endometrial cancer.

[0038] Based on this, the present invention constructs a transgenic mouse with STK11 gene knockout, and based on this STK11 gene knockout transgenic mouse (genotype STK11 flox / flox LTF Cre / -) was used to perform in vitro primary culture of primary uterine tumor tissue and the corresponding in vitro endometrial cancer cell line was established, named mouse endometrial tumor cell line LHO1. The mouse endometrial tumor cell line was deposited in the China Center for Type Culture Collection on September 20, 2022, with the deposit number CCTCC NO: C2022278, and the deposit address is: Luojia Mountain (No. 299, Bayi Road), Wuchang District, Wuhan City, Hubei Province.

[0039] STK11 flox / flox LTF Cre / - The transgenic mouse endometrial tumor cell line LHO1 has the following biological characteristics:

[0040] 1) Genetic characteristics are clear: the mouse endometrial tumor cell line LHO1 of the present invention is derived from a cell line with the genotype STK11 flox / flox LTF Cre / - The transgenic mice of the STK11 alleles of the transgenic mice carry the STK11 gene on both chromosomes and carry flox site sequences at both ends of the STK11 gene. The mice also contain the Cre gene, which is regulated by the lactoferrin (LTF) promoter. The LTF promoter is a uterine epithelium and uterine gland-specific promoter that is highly sensitive to estrogen in the uterus. It is not expressed in the immature mouse uterus, but is strongly expressed only in the uterine epithelium of adult mice. At the same time, the Cre gene is transcribed. Therefore, STK11 flox / flox LTF Cre / - Transgenic mice are genetically engineered mice that specifically express Cre enzyme in the uterine epithelium and uterine glands. When the transgenic mice grow to about 2 months old, the LTF promoter is activated. At the same time, a large amount of Cre recombinase is produced. In the uterine cells where Cre recombinase is specifically expressed, the exons or elements between the two flox sites will be deleted, achieving the purpose of conditional knockout of the STK11 gene and spontaneously inducing endometrial cancer in mice in situ. flox / flox LTF Cre / - The endometrial tumor tissue of transgenic mice was cultured in vitro to establish a corresponding in vitro cell line. The genetic background of this cell line is clear, and the cause and genetic characteristics of the tumor are clear. It is an ideal cell line for studying the mechanism of endometrial tumors and preclinical trials, and lays a foundation for studying the various functions and intervention regulations of endometrial cancer at the cellular and molecular levels, especially for in vitro research on the STK11 gene and related pathway genes in endometrial tumors.

[0041] 2) Stable properties: The cell line grows rapidly and has an active metabolism. It has good in vitro culture expansion and can be stably passaged for multiple generations. Specifically, it has been stably passaged for more than 40 generations. During the passage process, the morphological characteristics are uniform, with a typical cobblestone epithelial morphological structure, and can maintain the same or similar pathological characteristics as the primary tumor tissue.

[0042] 3) Strong tumorigenicity and high tumor formation rate: The mouse endometrial tumor cell line LHO1 has stable cloning ability and migration and invasion ability, and can form tumors in mammals, especially immunodeficient nude mice and wild-type mice. It has strong tumorigenicity and is suitable for establishing endometrial tumor animal models, and can establish a variety of endometrial tumor animal models. The present invention has successfully prepared an endometrial cancer animal model using this cell line, and the animal model can be used to study the molecular mechanism of the occurrence and development of endometrial cancer, drug screening, and the discovery of new biomarkers related to endometrial cancer, as well as immune research, etc.

[0043] 4) Good uniformity: Using a multiplex PCR system, the test results showed that the cell line LHO1 and its progeny cells contained mouse cell DNA, and there was no rat contamination, hamster contamination, or human contamination. It was identified as a new single cell line by STR, with good uniformity and no contamination from other cells.

[0044] It should be noted that gene knockout refers to a technique of inactivating or deleting a specific gene of an organism by certain means. In the context of the present invention, gene knockout, deletion or inactivation have the same meaning.

[0045] Example 1STK11 flox / flox LTF Cre / - Establishment of transgenic mouse endometrial tumor cell line

[0046] Since in vivo studies have great limitations, in vitro culture of endometrial epithelial cells is of great significance for studying uterine reproductive physiology. Cell lines and cultures are often used as in vitro tumor models to elucidate the functional contribution of one or more genes to the biological mechanisms of cancer. This example uses STK11, which can spontaneously induce endometrial cancer. flox / flox LTF Cre / - The uterine tumor tissue of 7-month-old transgenic female mice was used as a sample, and the uterine tumor tissue was directly cultured in vitro, and digested and passaged repeatedly to finally obtain a stable mouse endometrial tumor cell line. The specific steps include:

[0047] 1) Obtaining endometrial tumor epithelial cells: 7-month-old STK11 mice were killed by cervical dislocation. flox / flox LTF Cre / -Transgenic mice were excised under sterile conditions. The uterine tumor tissue was placed in a 10 cm culture dish filled with ice-cold sterilized PBS, the tumor capsule was thoroughly cleaned, and the uterine tumor tissue retained after the above operation was cut into 1×1×1 mm 3 The tissue blocks were cut into pieces of different sizes, and then they were continuously cut with scissors for 10-15 minutes until they became a paste. Ten times the volume of type II collagenase was added and incubated in a shaker at 37° and 140 r / min for 15-20 minutes. Then, F12 medium (Ham's F 12 nutrient medium) containing serum was added to terminate the digestion. After being mixed evenly with a Pasteur pipette, the mixture was passed through a 70 μm cell sieve and centrifuged at 1000 r / min for 5 minutes to collect the endometrial tumor epithelial cells.

[0048] 2) Primary culture: The above endometrial tumor epithelial cells were inoculated into a cell culture flask with irradiated mouse embryonic fibroblasts JC-2 in advance, wherein the tumor tissue culture medium in the cell culture flask was mixed with DMEM highglucose medium and F12 medium in a ratio of 3:1, and 10% fetal bovine serum (FBS), 1% penicillin-streptomycin double antibody, 10 μg / mL gentamicin, 250 ng / mL amphotericin B, 5 μg / mL insulin, 25 ng / mL hydrocortisone, 0.125 ng / mL epidermal growth factor (EGF), 0.1 nM cholera toxin and 10 μM Y-27632 were added. Y-27632 is a cell-permeable, highly efficient and highly selective ROCK-related protein kinase selective inhibitor, which inhibits ROCKI by competing with ATP for binding to the catalytic site, and was purchased from Abmole.

[0049] 3) Subculture: After the primary cultured cells were co-cultured with mouse embryonic fibroblasts JC-2 for 2 weeks, the epithelial cell colonies surrounded by irradiated fibroblasts were harvested and first digested with 0.25% EDTA trypsin for 30 seconds to remove the fibroblasts, and then 0.05 EDTA% trypsin was added to continue digestion. The epithelial cell colonies were digested into single cells and inoculated in a 96-well plate. The LHO1 cell line was established from a homogeneous population in a single well, and then maintained in complete F12 medium containing 10 μM Y-27632 to maintain its growth and reproduction. At this point, STK11 was completed. flox / flox LTF Cre / - The transgenic mouse endometrial tumor cell line was established and named as mouse endometrial tumor cell line LHO1.

[0050] The mouse endometrial tumor cell line LHO1 can be continuously subcultured in vitro. It has been subcultured for more than 40 generations. The cell growth is stable and in good condition, and it is still being subcultured and cultured.

[0051] The mouse endometrial tumor cell line LHO1 was deposited in the China Center for Type Culture Collection on September 20, 2022, with the collection number CCTCC NO: C2022278, and the collection address: Luojia Mountain (No. 299, Bayi Road), Wuchang District, Wuhan City, Hubei Province.

[0052] Example 2STK11 flox / flox LTF Cre / - Study on the biological characteristics of endometrial tumor cell lines in transgenic mice

[0053] 1) Cell morphological characteristics

[0054] The mouse endometrial tumor cell line LHO1 at the 20th generation was used to observe its morphological characteristics under a microscope. Figure 1 , where, from left to right, the magnifications are 100× and 200×. Figure 1 In the figure, we can see that the mouse endometrial tumor cell line LHO1 grows into a cobblestone-like monolayer cell colony that is tightly arranged. The cell nucleus is large and round and located in the center of the cell. The cell morphology is uniform, which is consistent with the characteristics of epithelial cells.

[0055] 2) Cell identification

[0056] Staining identification: Using crystal violet staining, it can be observed that the cell cytoplasm is stained brown, the nucleus is blue, and the cells have a typical cobblestone epithelial morphology (see the results). Figure 2 , magnifications from left to right are 100x and 200x, respectively). Immunocytochemical staining was further performed using cytokeratin-19 antibodies specific for epithelial cells and vimentin antibodies specific for stromal cells. The results are shown in Figure 3-4 ;in, Figure 3 The figure is the cell immunohistochemistry, from left to right, cytokeratin (CK19, purchased from Sewell, catalog number: GB12232), E-cadherin (E-cadherin, purchased from Abclonal, catalog number: A3149), and vimentin (Vimentin, purchased from Abclonal, catalog number: A19607) staining; Figure 4 This is a cell immunofluorescence image, from left to right: pan-CK (broad-spectrum cytokeratin PCK antibody, tumor epithelial marker, purchased from bioss, item number 5352R), E-cadherin, vimentin, Snail (zinc finger transcription factor, purchased from Abclonal, item number: A5243). Figure 3-4 It can be seen that the mouse endometrial tumor cell line LHO1 stained positive for cytokeratin and E-cadherin, indicating that the cells had tumor epithelial-like characteristics.

[0057] Genotype identification: The mouse endometrial tumor cell line LHO1 at the 20th generation was digested with trypsin, and the cell pellet was collected by centrifugation. DNA was extracted using the Axygen genome extraction kit and STK11 flox / flox Qualitative detection of homozygous and heterozygous genotypes. Details are as follows:

[0058] a) Extract genomic DNA from mouse endometrial tumor cell line LHO1 and perform conventional PCR. The reaction system (total 25 μL) is: 1.0 μL upstream primer, 1.0 μL downstream primer, 3.0 μL genomic DNA (template), 12.5 MIX (purchased from Vazyme, catalog number PS112), and 7.5 μL ddH2O. After the reaction is completed, perform agarose gel electrophoresis. The results are shown in Figure 5 The left picture is the electrophoresis diagram after amplification with STK11 gene primers, and the right picture is the electrophoresis diagram after amplification with Cre gene primers. In each picture, from left to right, lanes M, wt, flox-cre, flox, and LHO represent Marker, wild-type mouse genome, experimental mouse of cell line source tissue, control mouse genome, and LHO1 cell line, respectively. Figure 5 It can be observed that the LHO1 and flox-cre genotypes are consistent and have a genotype similar to the parental tissue of the cell source. The primer sequences used above are as follows, and all sequences are from the 5' end to the 3' end:

[0059] STK11-F: GGTTTCCATGCTGCCCCTTC (see SEQ ID NO. 1);

[0060] STK11-R: ACCACCACTCTGCTCTCCCG (see SEQ ID NO. 2);

[0061] Cre-F:TATGGCGGGTTTCAAGGCAGTGTG (see SEQ ID NO. 3);

[0062] Cre-R: GGAGGGCAGGCAGGTTTTGGTG (see SEQ ID NO. 4).

[0063] b) Extract genomic DNA of mouse endometrial tumor cell line LHO1 and perform Western Blot detection. The operation procedure is as shown in the kit manual. Figure 6As shown; among them, from top to bottom are Western Blot detection images of PTEN gene, STK11 gene and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene; in each image, from left to right, lanes Ishikawa, HEC-1B and LHO represent human endometrial cancer PTEN knockdown / knockout positive control group, human endometrial cancer PTEN knockdown / knockout negative control group and LHO1 cell line. It can be seen from the figure that LHO1 cells are the same as the parent, STK11 protein is knocked out, PTEN protein is retained, and 100% of the cells do not express STK11 protein.

[0064] c) Extracting genomic DNA from mouse endometrial tumor cell line LHO1, using a multiplex PCR system (including four-color fluorescent probes for human, mouse, rat, and hamster), and testing on an ABI7500 real-time fluorescence quantitative detector, the test results are as follows: Figure 7 As shown; Detection channel 1: Human (Human, FAM-1 blue line), mouse (Mouse, HEX green line), detection channel 2: cell line CHO1 (FAM-2 blue line), rat (Rat, CY5 red line). The results showed that LHO1 and its progeny cells contained mouse cell DNA, and the cell line was identified as a mouse cell line, and there was no rat contamination, no mouse contamination, and no human contamination in the cell line.

[0065] Growth kinetics study: Logarithmically growing cells of the 10th and 40th generations were used to prepare 1×10 4 Cells / mL cell suspension were inoculated in a 96-well plate at a volume of 100 μL per well, and the cell proliferation within a certain period of time was detected by Cell Counting Kit-8 (CCK8 kit) method (OD450, absorbance value measured at 450 nm). The growth curve was drawn as shown in Figure 8 As shown in the figure, it can be seen that the cells proliferate stably, with an average doubling time of 18.96 hours, and have strong proliferation ability. Moreover, the doubling time remains stable as the cell line is passaged.

[0066] In summary, the mouse endometrial tumor cell line LHO1 of the present invention has good wall adhesion and proliferation properties, stable cell traits, can be stably passaged multiple times, has uniform morphological characteristics during passage, can maintain typical characteristics of epithelial cells, has clinical biological characteristics close to tumors, and provides new ideal experimental materials closer to clinical tumor biological characteristics for studying the occurrence and development molecular mechanism of endometrial cancer and anti-endometrial cancer drug screening. In addition, through genotype identification, it does not express STK11 protein and is a brand-new mouse endometrial tumor cell line, enriching and completing the endometrial cancer cell line library.

[0067] Example 3STK11 flox / flox LTF Cre / - Study on the tumorigenicity of transgenic mouse endometrial tumor cell lines

[0068] Animal models of endometrial cancer (EC) are absolutely crucial for preclinical research, especially models that can reproduce the human disease environment, allowing us to better understand the pathophysiology, genetic and immune mechanisms and molecular processes of human endometrial cancer from precancerous stages to tumorigenesis. These models can be used as tools for developing early disease detection strategies and are also an important part of evaluating and predicting the safety and efficacy of new drugs for the treatment of EC.

[0069] In this example, the mouse endometrial tumor cell line LHO1 was used to establish an endometrial tumor animal model. Animal experiments showed that tumors could be generated after inoculation into immunodeficient nude mice and wild-type mice of the same species. The specific steps included the following:

[0070] S1, 1×10 6 -1×10 8 The mouse endometrial tumor cell line LHO1 or its progeny cells of Cells were inoculated subcutaneously or into the uterus of mammals;

[0071] S2. Raising the mammal for 30-60 days to obtain an endometrial tumor animal model.

[0072] The mammals mentioned above include immunodeficient nude mice or wild-type mice. For example, taking immunodeficient nude mice NOD and wild-type mice C57 as examples, step S2 is to feed immunodeficient nude mice for 45 days and wild-type mice for 30 days, and observe and record whether tumors are formed. Fig. 9 This is a general picture of the appearance of a subcutaneous transplanted tumor. The study found that the mouse endometrial tumor cell line LHO1 rapidly formed tumors in the skin of nude mice. All mice developed tumors within two weeks, and the animals were killed within one month after inoculation. The general appearance of the xenograft tumor formed in NOD mice containing LHO1 cells is shown in the figure. Fig.10 As shown, it can be seen that LHO1 has a strong tumorigenic ability with low variability.

[0073] In summary, it can be seen that the cell line mouse endometrial tumor cell line LHO1 of the present invention has strong tumorigenicity, can be used for subcutaneous tumor formation in wild-type mice of the same species and immunodeficient mice, and can also be used to produce endometrial tumors in nude mice, and has the ability to establish a variety of endometrial tumor animal models, and has a high tumor formation rate. The present invention uses CR technology to cultivate immortalized mouse endometrial cancer cell lines for the first time. Compared with human tumor cell lines, they can only be transplanted in immunodeficient mice, which makes researchers have great limitations in the study of disease immune environment or immunotherapy. The mouse endometrial tumor cell line LHO1 constructed by the present invention can not only form tumors on nude mice, but also be transplanted in immune-healthy wild-type mice C57. It has a wider range of applications and provides a usable model for immune research on endometrial cancer.

[0074] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A STK11 flox / flox LTF Cre / - A transgenic mouse endometrial tumor cell line, characterized in that The deposit number is CCTCC NO: C2022278.

2. STK11 according to claim 1 flox / flox LTF Cre / - Descendant cell lines of transgenic mouse endometrial tumor cell lines.

3. STK11 according to claim 1 flox / flox LTF Cre / - Transgenic mouse endometrial tumor cell line or STK11 as claimed in claim 2 flox / flox LTF Cre / - The application of the progeny cell lines of transgenic mouse endometrial tumor cell lines in studying the occurrence mechanism and drug resistance mechanism of endometrial cancer or screening drugs for treating endometrial cancer.

4. STK11 according to claim 1 flox / flox LTF Cre / - Transgenic mouse endometrial tumor cell line or STK11 as claimed in claim 2 flox / flox LTF Cre / - Application of progeny cell lines of transgenic mouse endometrial tumor cell lines in the preparation of mammalian tumor animal models.

5. STK11 according to claim 4 flox / flox LTF Cre / - Transgenic mouse endometrial tumor cell lines or STK11 flox / flox LTF Cre / - The use of a progeny cell line of a transgenic mouse endometrial tumor cell line in preparing a mammalian tumor animal model is characterized in that: The mammal is an immunodeficient nude mouse or a wild-type mouse.

6. A method for establishing an endometrial tumor animal model, characterized in that: The following steps are involved: S1. The STK11 as claimed in claim 1 flox / flox LTF Cre / - Transgenic mouse endometrial tumor cell line or STK11 as claimed in claim 2 flox / flox LTF Cre / - Progeny cell lines of transgenic mouse endometrial tumor cell lines are inoculated subcutaneously or intrauterinely in mammals; S2. Raising the mammal for 30-60 days to obtain an endometrial tumor animal model.

7. The method for establishing an endometrial tumor animal model according to claim 6, characterized in that: In step S1, the inoculum size is 1×10 6 -1×10 8 Cells.

8. The method for establishing an endometrial tumor animal model according to claim 6, characterized in that: The mammal is an immunodeficient nude mouse or a wild-type mouse.

Images