A Leucine-rich Repeat Protein Kinase Family Gene GhLRRK1 and Its Application

Abstract

The present invention discloses a leucine-rich repeat protein kinase family gene GhLRRK1 and its application. The genomic sequence of the leucine-rich repeat protein kinase family gene GhLRRK1 is SEQ ID NO.2. In the upland cotton population, by combining whole-genome resequencing and transcriptome data of ovules one day after flowering, genome-wide association analysis and alternative splicing locus analysis were carried out, and a gene GhLRRK1 significantly associated with cotton lint percentage was identified. There is an alternative splicing site regulated by SNP on this gene. The SNP site has two haplotypes, A and G. Intron retention occurs at the alternative splicing site in the G haplotype, and the intron is not retained in the A haplotype. The lint percentage of the G haplotype is significantly higher than that of the A haplotype, and it may be a causal gene regulating the cotton lint percentage trait. The present invention provides important research value and application prospects of this gene in the efficient identification of upland cotton varieties with high lint percentage, the improvement and cultivation of new cotton varieties with high lint percentage.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnological applications, and relates to a leucine-rich repeat protein kinase family gene GhLRRK1 associated with lint percentage trait in cotton and its applications. Background Art

[0002] Cotton, as the main raw material of the textile industry, is an important cash crop. At present, the total output of cotton in China is still insufficient to meet the domestic market's consumption demand for cotton. Therefore, increasing the yield of upland cotton is one of the important goals of cotton breeding. Cotton yield traits are complex traits controlled by multiple genes, and it is of great significance to explore yield genes that can be used in breeding. At present, some genetic loci related to fiber quality and yield have been identified in cotton by using genome-wide association studies (GWAS). Yield traits (such as the number of bolls, boll weight, seed index, lint percentage, etc.) directly or indirectly affect the yield level. Among them, lint percentage is a complex quantitative trait, which is related to seed size and lint yield and is regulated by multiple genes. Fang Lei et al. (2017) identified 44 loci associated with lint percentage in an upland cotton population and identified the genes GhLY1-A02 and GhLYI-D08. However, the causal genes of most candidate loci are not clear.

[0003] Alternative splicing (AS) refers to the process by which the pre-mRNA of a single gene is processed through different splicing sites to generate multiple mature mRNA isoforms, thereby regulating gene expression, increasing the diversity and complexity of protein products, and participating in the regulation of various phenotypic variations. Genetic variation refers to single nucleotide polymorphisms (SNPs) on the genome. Genetic variations in the regulatory regions of genes can regulate gene expression and alternative splicing. In some studies, the level of alternative splicing is used as a molecular phenotype, and then association analysis and co-localization analysis are carried out with genetic variations, which can effectively identify genetic variations that simultaneously affect the alternative splicing of target genes and agronomic phenotypes. Using the above method, the trans-splicing factor ZmGRP1 was identified in maize; in rice, candidate genes related to salt stress, OsNUC1 and OsRAD23, were determined. Through the sequencing of the genomes of 279 upland cotton accessions and the transcriptome sequencing of 1-DPA ovules, and the quantification of the level of alternative splicing. Genome-wide association analysis of alternative splicing found that the genetic locus associated with lint percentage on chromosome A06 co-localized with the intron retention type of alternative splicing on GhLRRK1, suggesting that the alternative splicing variation of GhLRRK1 can affect the lint percentage.

[0004] The leucine-rich repeat protein kinase family protein (LRRK) is a class of multi-domain proteins. The gene GhLRRK1 contains three domains: a high-mobility group gene (HMG)-box domain superfamily (HMG-box_SF super family), an N-terminal leucine-rich domain (LRRNT_2), and a leucine-rich repeat receptor-like protein kinase domain (LRR-RLK, PLN00113 super family). Currently, there are extensive reports on the gene functions of genes containing the LRR-RLK domain in plants. Leucine-rich repeat receptor-like kinases (LRR-RLKs) play important roles in regulating plant growth, development, and stress responses. In Arabidopsis thaliana, CLV1 containing LRR-RLK and CLV2 are involved in the regulation of shoot apical meristems. The gene CRINKLY4 containing the LRR-RLK domain in maize is involved in epidermal cell specialization, and the deletion of CR4 inhibits the formation of the aleurone layer, thereby affecting the yield of maize. The gene SERK of LRR-RLK is also involved in ovule development in Arabidopsis thaliana and maize. Summary of the Invention

[0005] An object of the present invention is to provide a leucine-rich repeat protein kinase family gene GhLRRK1.

[0006] Another object of the present invention is to provide the application of this gene. Alternative splicing genome-wide association analysis shows that alternative splicing of this gene can cause changes in the lint percentage, a trait related to cotton fiber yield. Specifically, the gene GhLRRK1 significantly associated with cotton lint percentage was identified. There is an alternative splicing site regulated by SNP on this gene; the SNP site has two haplotypes, A and G. Intron retention occurs at the alternative splicing site in the G haplotype, and the intron is not retained in the A haplotype; the lint percentage of the G haplotype is significantly higher than that of the A haplotype, and GhLRRK1 may be the causal gene regulating cotton lint percentage traits.

[0007] The object of the present invention can be achieved by the following technical solutions:

[0008] The leucine-rich repeat protein kinase family gene GhLRRK1, the cDNA sequence of the leucine-rich repeat protein kinase family gene GhLRRK1 in tetraploid upland cotton TM-1 is: SEQ ID NO.1, and the genomic sequence is: SEQ ID NO.2.

[0009] Application of the leucine-rich repeat protein kinase family gene GhLRRK1 in identifying cotton varieties with high lint percentage. Specifically, alternative splicing (retention or not) occurs in the sixth intron of the gene GhLRRK1 in cotton, and its alternative splicing level is regulated by genetic variation sites (SNPs). By judging the intron retention situation or alternative splicing level of this site, cotton varieties with high lint percentage can be identified. If the sixth intron is retained and the alternative splicing level is low, it is a cotton variety with high lint percentage. The retained sequence of the sixth intron is shown in SEQ ID NO.9.

[0010] Furthermore, the present invention designs a primer for detecting the intron retention situation, including the upstream primer shown in SEQ ID NO.7 and the downstream primer shown in SEQ ID NO.8.

[0011] Furthermore, the alternative splicing of the leucine-rich repeat protein kinase family gene GhLRRK1 is related to lint percentage, and the alternative splicing level is related to its regulatory SNP (A06:23513733). According to the co-localization analysis with GWAS data, the intron is retained in cotton materials with high lint percentage, the SNP base is G, and its alternative splicing level is low; at the same time, the intron is not retained in cotton materials with low lint percentage, the SNP is A, and the alternative splicing level is high. Therefore, cotton varieties with high and low lint percentage in the population can be quickly identified through the SNP at this alternative splicing site: upland cotton materials carrying intron retention are cotton varieties with high lint percentage (G), and vice versa, they are cotton varieties with low lint percentage (A).

[0012] Furthermore, the present invention designs a primer pair for detecting this regulatory SNP site. The upstream primer is: SEQIDNO.5, and the downstream primer is SE1 ID NO.6.

[0013] Application of the leucine-rich repeat protein kinase family gene GhLRRK1 in improving cotton lint percentage or cultivating new cotton varieties with high lint percentage by genetic engineering means. The gene containing the high-yield haplotype GhLRRK1 (G) can be transferred into cotton varieties by genetic engineering means to increase cotton yield, or the sixth intron segment in the low-yield haplotype GhLRRK1 (A) can be retained or inserted to be transformed into a high-yield haplotype, thereby cultivating new cotton varieties with high lint percentage.

[0014] The beneficial effects of the present invention are shown in:

[0015] Through genome-wide association study and alternative splicing locus analysis, a leucine-rich repeat protein kinase family gene GhLRRK1 associated with lint percentage in cotton was discovered. The leucine-rich repeat protein kinase family gene GhLRRK1 of the present invention undergoes alternative splicing with intron retention. The splicing level of this intron retention site is closely related to lint percentage, and the alternative splicing level is related to its regulatory SNP. The cDNA and intron retention of GhLRRK1 provided by the present invention can be verified by detecting PCR technology, which has the advantages of small starting template amount, simple and easy experimental steps, and high sensitivity.

[0016] The intron retention of GhLRRK1 at the 1-DPA ovule stage in different cotton varieties was obtained by transcriptome sequencing. The splicing level of the intron retention site of this gene is significantly correlated with lint percentage, indicating that this gene is related to the components of lint percentage.

[0017] The SNP genotypes of GhLRRK1 in the population were verified by PCR technology (Table 1). This technology is easy to operate, has high sensitivity and good accuracy.

[0018] According to the different SNP genotypes of GhLRRK1, the upland cotton population can be divided into two major categories. Statistical analysis methods found that there are significant differences in the lint percentage traits between these two categories of populations ( Figure 4 ), further proving the correlation between this gene and lint percentage. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Colocalization of genome-wide association analysis of cotton lint percentage and alternative splicing association analysis of GhLRRK1

[0020] Lint Percentage represents lint percentage (%). The arrow indicates the SNP locus associated with the trait. The abscissa represents the physical coordinate position (Mb) on the chromosome, and the positive axis of the ordinate represents the significance of the association between the SNP locus and the agronomic trait, expressed as -log 10 (p). The negative axis of the ordinate represents the significance of the association between the SNP locus and the alternative splicing level of GhLRRK1, expressed as -log 10 (p).

[0021] Figure 2 The SNP associated with lint percentage and the alternative splicing associated with GhLRRK1 are located in the same linkage disequilibrium (LD) interval

[0022] The SNP (A06:23513733) associated with the alternative splicing of GhLRRK1 and the SNP (A06:23741067) associated with lint percentage are in a region of high linkage disequilibrium, suggesting that the SNP regulates lint percentage by regulating the alternative splicing of GhLRRK1.

[0023] Figure 3 The different alternative splicing situations of GhLRRK1 and their effects on gene translation products

[0024] Among them, A is the IGV graph, B is the gene structure graph, and C is the situation of intron retention and its translation in this region. GhLRRK1 has two alternative splices. There is a stop codon TAA in the intron region. Intron retention will cause premature termination of translation and the protein product will be shorter.

[0025] Figure 4 The correlation between the alternative splicing level of GhLRRK1 and lint percentage

[0026] The box plot represents the alternative splicing and lint percentage levels of different genotypes in the variety population. The numbers represent the number of individual samples of different genotypes. PSI refers to the splicing ratio, which is used to measure the alternative splicing level. When the intron sequence is spliced: it is denoted as n 1 ; when it is retained, it is denoted as n 2 ,

[0027] Figure 5 The gene expression levels of GhLRRK1 in different tissues and developmental stages of cotton

[0028] The abscissa represents different tissues, including root (R), stem (S), leaf (L), ovule, and fiber. The ovule tissue includes 3 and 1 days before flowering, the day of flowering, and 1 to 35 days after flowering. The fiber tissue includes 5 to 25 days after flowering.

[0029] Figure 6 Molecular verification of the alternative splicing of GhLRRK1

[0030] According to the annotation of the upland cotton reference genome TM-1, whether the sixth intron of the GhLRRK1 gene is retained forms two different alternative splices. According to the genotyping of the SNP locus A06:23513733 that regulates alternative splicing, materials with GG and AA genotypes were randomly selected, and cDNA was obtained by reverse transcription of 1-DPA ovules. Primers were designed according to the intron sequence for PCR amplification. The electrophoresis pattern shows bands corresponding to the expected sizes of products with and without the sixth intron. The housekeeping gene Histone3 of upland cotton TM-1 was used as a control. It shows that GhLRRK1 has two types of alternative splices and is associated with the regulated genotypes. Specific implementation methods

[0031] Example 1: Mining of the leucine-rich repeat protein kinase family gene GhLRRK1 associated with cotton lint percentage

[0032] For 279 modern varieties or lines of upland cotton, from 2007 to 2009, detailed investigations on yield traits (such as lint percentage and boll weight) were carried out in Anyang, Henan, Nanjing, Jiangsu, and Kuqa, Xinjiang. Meanwhile, whole-genome resequencing and transcriptome sequencing of 1DPA ovules were performed on these 279 cotton varieties. The genomic sequences were aligned to the reference genomic sequence of upland cotton standard line TM-1 (V2.0). The software Samtools was used to identify genome-wide SNPs, and a total of 1,186,673 high-quality SNPs (minor allele frequency > 0.05, missing rate < 80%) were mined for genome-wide association analysis. Genome-wide association analysis found that a SNP (A06:23741067) on chromosome A06 was significantly associated with the lint percentage trait (p-value = 1.24×10 -6 ). Using LeafCutter to identify and quantify genome-wide intron retention in the transcriptome sequencing data of 1DPA ovules, and performing sQTL analysis through the EMMAx software, it was found that there was a genetically regulated alternative splicing (A06:23710348:2310428:clu38722) on A06, located in the gene region of GhLRRK1 ( Figure 1 ). The SNP regulating the alternative splicing of GhLRRK1 also regulated the lint percentage, so it was determined that the alternative splicing of GHLRRK1 was associated with the lint percentage ( Figure 2 ).

[0033] Example 2: Intron retention in GhLRRK1 affects gene translation:

[0034] Whole-genome resequencing was performed on the RNA samples of these 279 upland cotton materials. SNP genotyping was carried out through GATK. According to the genotypes of regulatory sites, the alternative splicing levels of different haplotypes were compared. When the genotype was GG, the alternative splicing level with intron retention was lower, and when the genotype was AA, the alternative splicing level with intron retention was higher. The retention of this intron would generate a premature termination codon TAA, resulting in a shorter sequence of the gene protein product ( Figure 3 ).

[0035] Example 3: The alternative splicing level of intron retention in GhLRRK1 is related to the agronomic trait of lint percentage:

[0036] Transcriptome sequencing was performed on the RNA samples of 279 upland cotton materials, and the intron retention alternative splicing was quantified. It was found that the lint percentage of upland cotton materials with intron retention (GG haplotype) was significantly increased by 26% compared with that of materials without retention (AA haplotype) (p-value < 1.5×10-11, Student's t-test) ( Figure 4 ).

[0037] Example 4 Obtaining the leucine-rich repeat protein kinase family gene GhLRRK1:

[0038] The cDNA sequence and genomic sequence of GhLRRK1 were obtained from the upland cotton genomic sequence, as shown in SEQ ID NO.1 and SEQ ID NO.2. Gene full-length primers were designed based on both ends of the cDNA for PCR amplification. The primer sequences were F1: ATGATATTGGATGCATGTT (SEQ ID NO.3) and R1: ATTGAAAAATGGTGCATAA (SEQ ID NO.4). The PCR reaction procedure was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 sec, annealing at 60°C for 1 min, extension at 72°C for 1 min, for 34 cycles; finally, extension at 72°C for 10 min. The PCR amplification product was sequenced and further compared with the cDNA to determine the sequence accuracy. The leucine-rich repeat protein kinase family gene GhLRRK1 was obtained.

[0039] Example 5 Application of the leucine-rich repeat protein kinase family gene GhLRRK1 in identifying cotton varieties with high lint percentage:

[0040] Genotyping was performed according to the SNP (A06:23513733) that regulates alternative splicing sites. Amplification primers were designed at both ends of the SNP. The primer sequences were F2: CAAAAATATAAATCAAACTATACCG (SEQ ID NO.5) and R2: CATTGATAGTGTGATTGATAATTCA (SEQ ID NO.6). The PCR reaction procedure was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 20 sec, for 30 cycles; finally, extension at 72°C for 5 min. 17 materials with haplotype GhLRRK1(A), 239 materials with haplotype GhLRRK1(G), and 12 heterozygous materials were identified. Figure 4and Table 1). Meanwhile, based on the position of the alternative splicing site on chromosome A06, genomic amplification primers were designed at both ends of this intron, and the primer sequences were F3: TGCTCCTGAACTTGGC (SEQ ID NO.7) and R3: ATTTGGGCAGTGAACC (SEQ ID NO.8). Using this pair of primers, PCR amplification and sequencing were performed on the cDNA of 279 varieties. The PCR reaction procedure was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 sec, annealing at 58°C for 1 min, extension at 72°C for 30 sec, for 34 cycles. According to the sequencing results, the retention of this intron (SEQ ID NO.9, GTAAGCAAACTCATATTCAGAAGCTAACAAAAGCAAGTTTCAAGTAAATGAATGCAGAAATTAGTGATCATGGTTGCAG) was verified: this intron was retained in the GG haplotype upland cotton materials, and not retained in the AA haplotype materials ( Figure 6 ).

[0041] From the above results, it can be seen that the gene GhLRRK1 has important research value in improving the lint percentage of cotton and cultivating new cotton varieties with high lint percentage. On the one hand, molecular markers can be designed according to the two haplotypes of the gene GhLRRK1, which can effectively identify the yield traits of cotton and have good application value in the breeding research of high-yield cotton varieties. On the other hand, by means of genetic engineering, the gene containing the high-yield haplotype GhLRRK1(G) can be transferred into cotton varieties to increase cotton yield, or the sixth intron segment in the low-yield haplotype GhLRRK1(A) can be retained or inserted to be transformed into a high-yield haplotype, thereby cultivating new cotton varieties with high lint percentage and increasing cotton yield.

[0042] Table 1 Identification of high and low lint percentage haplotypes in population variety materials

[0043]

[0044]

[0045] Obviously, the above embodiments are merely examples for clear illustration and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or alterations can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or alterations derived therefrom still fall within the protection scope of the present invention.

Claims

1. A method for identifying high lint percentage cotton varieties, characterized in that, specifically: By detecting whether the sixth intron retention of GhLRRK1 is regulated, it is determined whether the cotton is a high lint percentage variety; if the sixth intron is retained, GhLRRK1 protein translation is prematurely terminated, then the cotton is a high lint percentage variety; the GhLRRK1 genomic sequence is as shown in SEQ ID NO.2; the sixth intron retention sequence is as shown in SEQ ID NO.

9.

2. The method according to claim 1, characterized in that, The primer pair for detecting whether the sixth intron retention occurs in GhLRRK1 includes the upstream primer shown in SEQ NO.7 and the downstream primer shown in SEQ ID NO.8.

Images