A method for efficiently preparing abestrol by catalyzing isopentenol with resting recombinant Escherichia coli cells

Abstract

Abiesol degradation produces ambergris aroma substances, which can improve the flavor quality of tobacco and is widely used in the spice industry. The present invention develops a new method for preparing abiesol by catalysis of low-cost and high-efficiency resting cells. By knocking out the phosphorylase encoding genes phoA, ybjG, pgpB and the outer membrane lipoprotein encoding gene nlp Ⅰ, constitutively overexpressing the fatty acid metabolism transcription regulator encoding gene fadR and the glycerol metabolism operon gene glpFK, overexpressing hydroxyethylthiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate δ-isomerase, bifunctional diphosphate farnesyl synthase, geranylgeranyl diphosphate synthase, lysine-13-ene-8-ol diphosphate synthase and abiesol synthase to obtain recombinant Escherichia coli. The resting cell catalytic process can catalyze 3.0g / L isopentenol to produce 1.80g / L abiesol in 24h, and the conversion rate reaches 71.15%, which is much higher than the current literature and patent reports. The resting cells can be reused 5-6 times, are simple to operate, and are economical. Compared with the fermentation method, they have better potential for large-scale production of abestrol.

Description

Technical Field

[0001] The invention relates to a method for efficiently preparing afir alcohol by catalyzing isopentenol with recombinant Escherichia coli resting cells, and belongs to the field of bioengineering. Background Art

[0002] Terpenoids are ubiquitous plant secondary metabolites and the most important aroma component of tobacco. In particular, diterpenoid alcohol compounds in tobacco, mainly including sibirol and lisdactyl alcohol compounds, have an important influence on the aroma quality of tobacco; their content differences are significantly correlated with the quality characteristics of different types of tobacco, and their degradation products are all representative tobacco aroma substances. In oriental tobacco, lisdactyl alcohol is a common diterpenoid alcohol compound, among which cis-abietanol is a unique aroma precursor in most oriental tobaccos and some cigars, and plays an important role in the aroma characteristics of tobacco. Its degradation produces substances with strong ambergris aroma, which is very effective in increasing the aroma and taste of cigarettes. It is harmonious with the characteristic aroma of tobacco and can cover up the impurities. Even if used in trace amounts, it can improve the aroma quality of tobacco. It is especially suitable for flavoring mixed cigarettes and is often used in cigarette extracts. As a semi-synthetic precursor of amber-like ambergris, cis-abietanol is widely used in the fragrance industry because of its beautiful aroma, good aroma fixation effect and influence on smoke quality. At present, the characteristic aroma precursor substance of tobacco, fir alcohol, is mostly extracted from tobacco leaves rich in fir alcohol by extraction method. However, the content of fir alcohol in tobacco leaves is relatively low. At the same time, the availability of tobacco raw materials has become a bottleneck restricting the large-scale application of the extraction method. In recent years, with the rapid development of synthetic biology, microbial fermentation has become a hot research topic in the synthesis of fir alcohol. Previously, there have been literature and patent reports on the biosynthesis of fir alcohol by microbial fermentation using glucose or glycerol as substrates. However, due to the fact that the substrate glycerol or glucose participates in multiple cell reactions at the same time as a substrate, although the heterologous synthesis pathway of fir alcohol and the supply of precursors have been strengthened, the synthesis efficiency is still low. Li et al. obtained an engineered strain by strengthening the heterologous synthesis pathway of abirol and the supply of precursors, and fermented and cultured it in a 1.3L fermenter for about 100 hours, with abirol production of ~634.7 mg / L (Li. et al. (2019). Combinatorial Engineering of Mevalonate Pathway and Diterpenoid Synthases in Escherichia coli for cis-Abienol Production. Journal of Agricultural and Food Chemistry, 67 (23), 6523-6531.). Cheng et al. also obtained an engineered strain by strengthening the supply of precursors, and the abirol production was ~220 mg / L after 52 hours of fermentation, which was a relatively low yield (Cheng. et al. (2020). Improved cis-Abienol production through increasing precursor supply in Escherichia coli. Scientific Reports, 10 (1), 16791).Zhang et al. used isopentenol as a substrate for bio-fermentation to synthesize abirol. The fermentation was carried out in a 1.3L fermenter for about 144 hours, and the substrate 6.8g / L isopentenol was converted to 1375.7mg / L abirol, and the yield was greatly improved, but the overall fermentation time was too long, and the substrate conversion rate was only 24.1% (Zhang.et al. (2022). Engineering Escherichia coli for effective and economic production of cis-abienol by optimizing isopentenol utilization pathway. Journal of Cleaner Production, 351). Therefore, the yield of abirol synthesized by microbial fermentation is still low, and the synthesis level is not ideal. Since the fermentation process uses an organic relative fermentation system for extraction, the extraction product will be doped with a large amount of fat-soluble substances from the fermentation broth (such as fat-soluble components in the culture medium, fat-soluble cell contents, fat-soluble cell metabolites, etc.), in addition to abirol, which brings difficulties to subsequent separation, purification and application. Therefore, it is urgent to develop a method for synthesizing abirol with high yield, low cost and high efficiency.

[0003] Resting cell biocatalysis has been widely used in the synthesis of a variety of high value-added chemicals. This method uses a complete multi-enzyme system in the cell to achieve biotransformation. Compared with the fermentation method, it has the following advantages: first, resting cells have better operability and economy than fermentation methods; second, resting cells have better stability, can be reused for multiple biotransformations, and have little activity loss. They can also be catalyzed in the form of immobilized cells, which further saves production costs; finally, resting cells have higher tolerance to substrates and products than fermentation methods. In particular, the abestrol synthesis metabolic pathway contains intermediate metabolites (such as isopentenyl diphosphate (IPP) and farnesyl diphosphate (FPP)) that are highly toxic to cells, which affect strain growth and are not conducive to the fermentation synthesis of abestrol. Resting cells separate the strain culture stage from the abestrol catalytic synthesis stage, avoiding the growth inhibition of strains by toxic substrates and intermediate metabolites. These characteristics indicate that resting cell biocatalysis is more suitable for the large-scale preparation of abestrol than fermentation. The present invention innovatively proposes a new method for efficiently preparing abestrol by resting cell biocatalysis. Summary of the invention

[0004] In view of the problems existing in the existing fermentation method for synthesizing firwood alcohol, such as long fermentation cycle, low yield, complicated separation and purification steps, the purpose of the present invention is to provide a preparation method using recombinant Escherichia coli resting cells.

[0005] Also provided is a method for efficiently preparing abies alcohol by biocatalyzing isopentenol using the obtained recombinant Escherichia coli resting cells, which has the advantages of recyclable resting cells, simple process, low production cost and high conversion rate.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] A method for preparing recombinant Escherichia coli resting cells comprises the following steps: knocking out phosphatase encoding genes phoA, ybjG, pgpB and outer membrane lipoprotein encoding gene nlpⅠ in an Escherichia coli host, constitutively overexpressing fatty acid metabolism transcription regulator encoding gene fadR, and constitutively overexpressing glycerol metabolism operon gene glpFK, to construct an Escherichia coli engineering strain LSC-06; constructing an Escherichia coli engineering strain LSC-07 that co-expresses hydroxyethylthiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate δ-isomerase, bifunctional farnesyl diphosphate synthase, geranylgeranyl diphosphate synthase, lisdane-13-ene-8-ol diphosphate synthase and abietol synthase on the basis of the Escherichia coli engineering strain LSC-06; and culturing the Escherichia coli engineering strain LSC-07 to obtain recombinant Escherichia coli resting cells.

[0008] The construction method of the E. coli engineering strain LSC-06 is as follows:

[0009] (1) Knockout of the alkaline phosphatase encoding gene phoA:

[0010] Using the genome of Escherichia coli C41 (DE3) as a template, donor DNA was designed to construct an Escherichia coli engineered strain LSC-01 with the phoA gene knocked out.

[0011] (2) Knockout of the gene encoding undecaprylate diphosphatase ybjG:

[0012] Using the genome of the E. coli engineered strain LSC-01 as a template, donor DNA was designed to construct the E. coli engineered strain LSC-02 with the ybjG gene knocked out;

[0013] (3) knockout of the gene encoding phosphatidylglycerolphosphatase, pgpB;

[0014] Using the genome of the E. coli engineered strain LSC-02 as a template, donor DNA was designed to construct the E. coli engineered strain LSC-03 with the pgpB gene knocked out;

[0015] (4) Knockout of the outer membrane lipoprotein encoding gene nlpⅠ

[0016] Using the genome of the E. coli engineered strain LSC-03 as a template, donor DNA was designed to construct the E. coli engineered strain LSC-04 with the nlpⅠ gene knocked out.

[0017] (5) Constitutive overexpression of the fatty acid metabolism transcriptional regulator gene fadR

[0018] Using the genome of the engineered E. coli strain LSC-04 as a template, donor DNA was designed to construct a construct that replaced the promoter of the fatty acid metabolism transcription regulator gene fadR with a strong constitutive promoter P. tac The engineered E. coli strain LSC-05;

[0019] (6) Constitutive overexpression of the glycerol metabolism operon glpFK

[0020] Using the genome of the engineered E. coli strain LSC-05 as a template, donor DNA was designed and the promoter of the glycerol kinase encoding gene glpFK was constructed as a constitutive strong promoter P tac The engineered Escherichia coli strain LSC-06.

[0021] The construction method of the E. coli engineering strain LSC-07 is as follows:

[0022] (1) constructing a recombinant expression vector pCTI containing the hydroxyethylthiazole kinase encoding gene EcThiM and the isopentenyl phosphate kinase MthIPK;

[0023] (2) constructing a recombinant expression vector pAEIG containing the bifunctional farnesyl diphosphate synthase encoding gene ScERG20, the isopentenyl diphosphate δ-isomerase encoding gene ScIDI, and the geranylgeranyl diphosphate synthase encoding gene TcGGPPS;

[0024] (3) constructing a recombinant expression vector pRCA containing the gene encoding lisdactone-13-ene-8-ol diphosphate synthase CcCLS and the gene encoding abestrol synthase NtABS;

[0025] (4) The recombinant expression vectors pCTI, pAEIG and pRCA constructed in steps (1) to (3) are co-transformed into the E. coli engineered strain LSC-06 described in claim 1 to construct an E. coli engineered strain LSC-07 that simultaneously expresses hydroxyethylthiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate δ-isomerase, bifunctional farnesyl diphosphate synthase, geranylgeranyl diphosphate synthase, lisdendron-13-ene-8-ol diphosphate synthase and abietol synthase.

[0026] A method for preparing abies alcohol by catalyzing isopentenol using the recombinant Escherichia coli resting cells obtained by the preparation method.

[0027] In a 100 mL catalytic reaction system, add isopentenol with a final concentration of 1.0-5.0 g / L, recombinant Escherichia coli resting cells of 20-200 g / L, and 0-40 g / L glycerol, add 20 mM pH 7.0 PB buffer to a volume of 100 mL, and finally add isopropyl myristate accounting for 10-20% (v / v) of the total volume of the reaction system; catalyze the reaction at 25°C for 12-24 hours to synthesize abendazole.

[0028] Add glycerol with a final concentration of 10-40 g / L into 100 mL of the catalytic reaction system.

[0029] In a 100 mL catalytic reaction system, 3.0 g / L isopentenol, 100 g / L recombinant Escherichia coli resting cells, and 20 g / L glycerol were added respectively, 20 mM pH 7.0 PB buffer was added to a volume of 100 mL, and finally 10% (v / v) of isopropyl myristate was added to the total volume of the reaction system; catalysis was carried out at 25°C for 24 hours to synthesize abdelol.

[0030] After the reaction is completed, the recombinant E. coli resting cells are recovered by centrifugation and reused.

[0031] The method for preparing the recombinant Escherichia coli resting cells is used in catalyzing the preparation of abies alcohol by isopentenol.

[0032] Beneficial effects of the present invention:

[0033] Since the phoA, ybjG, and pgpB genes present in the host genome of Escherichia coli encode alkaline phosphatase, undecaprylyl diphosphatase, and phosphatidylglycerol phosphatase, respectively, all of them have dephosphorylation activity with a wide substrate spectrum, they can catalyze the dephosphorylation reaction of GPP (geranyl diphosphate), FPP (farnesyl diphosphate), and GGPP (geranylgeranyl diphosphate), which are important intermediate metabolites in the synthesis pathway of fir alcohol, to generate geraniol, farnesol, and geranylgeraniol, respectively. In the resting cell catalysis of fir alcohol biosynthesis, the substrate conversion rate of fir alcohol will be reduced. Therefore, the present invention knocks out the above-mentioned dephosphorylation activity enzyme encoding genes phoA, ybjG, and pgpB to construct the above-mentioned gene knockout engineering strain.

[0034] Since the product abies alcohol is highly lipophilic, the host cell membrane-related coding genes were genetically modified: the outer membrane lipoprotein coding gene nlpⅠ was knocked out and replaced, and the promoter of the fatty acid metabolism transcription regulator coding gene fadR was replaced by a constitutive strong promoter P tac, enhance the lipid solubility of cell membranes, and improve the tolerance to the toxicity of substrate isopentenol and product abendazole; strengthen the synthesis of outer membrane vesicles of host cell membranes, enhance the host's transmembrane transport of substrates and products, and help reduce the product inhibition of abendazole on catalytic reactions.

[0035] Since the synthesis pathway of firwood alcohol requires consumption of ATP, adding glycerol to the catalytic reaction system can enhance the ATP synthesis capacity of resting cells and meet the ATP demand of the firwood alcohol catalytic synthesis process. Therefore, the key operon gene glpFK of the host glycerol metabolic pathway was genetically modified: the glpFK operon of Escherichia coli encodes the glycerol transporter (GlpF) and glycerol kinase (GlpK). Extracellular glycerol is passively transported into the cell with the assistance of the glycerol transporter GlpF, and glycerol-3-phosphate is generated under the action of glycerol kinase GlpK, and further dehydrogenated to dihydroxyacetone phosphate, thereby entering the glycolysis pathway and the tricarboxylic acid cycle, and undergoing aerobic oxidation to produce ATP (18.5 mol ATP can theoretically be synthesized per 1 mol glycerol). Therefore, the promoter of the key operon gene glpFK of the glycerol metabolic pathway was replaced with the constitutive strong promoter P tac , strengthen the host's ability to metabolize glycerol to generate ATP, meet the energy demand for ATP in the synthesis of fir tree alcohol, and improve the efficiency of fir tree alcohol synthesis.

[0036] The present invention first constructs an Escherichia coli host bacterium E. coli C41 (DE3) in which multiple broad-substrate-spectrum dephosphorylation active enzymes are knocked out, and constructs an Escherichia coli engineered bacterium that co-expresses hydroxyethylthiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate δ-isomerase, bifunctional farnesyl diphosphate synthase, geranylgeranyl diphosphate synthase, lisdane-13-ene-8-ol diphosphate synthase and abirol synthase, and ferments to obtain resting cells for catalyzing isopentenol to prepare abirol.

[0037] The catalytic pathway of the present invention comprises: consuming ATP (provided by glycerol metabolism) by hydroxyethylthiazole kinase to convert substrate isopentenol into dimethylallyl monophosphate (DMAP); consuming ATP by isopentenyl phosphate kinase to convert DMAP into dimethylallyl diphosphate (DMAPP); isopentenyl diphosphate δ-isomerase to isomerize DMAPP into isopentenyl diphosphate (IPP); catalyzing DMAPP and IPP into geranyl diphosphate (GPP) and farnesyl diphosphate (FPP) by bifunctional diphosphate farnesyl synthase; catalyzing FPP and IPP into geranylgeranyl diphosphate (GGPP) by geranylgeranyl diphosphate synthase; converting GGPP into cis-abienol (cis-abienol) by lisdane-13-ene-8-ol diphosphate synthase and abirol synthase. Figure 1 ).

[0038] The present invention adopts a resting cell catalytic process, which can catalyze 3.0g / L substrate isopentenol within 24 hours to produce 1.80g / L of abirol, with a conversion rate of up to 71.15%, which is much higher than the conversion rate level reported in current literature and patents. Resting cell culture has low nutritional requirements, short culture time, and easy preparation; the catalytic time is greatly shortened compared with the fermentation method, and the synthesis efficiency is high; resting cells have better tolerance to the toxicity of substrate isopentenol and product abirol, and the product concentration is high; therefore, compared with the fermentation method, resting cell catalysis has better application potential in the large-scale preparation of abirol. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The schematic diagram of the synthesis of abies alcohol by resting cells catalyzing isopentenol in the present invention.

[0040] Figure 2 This is an agarose gel electrophoresis diagram showing the successful knockout of genes phoA, ybjG, pgpB, and nlpⅠ in the E. coli host strain E. coli C41 (DE3) and the successful replacement of the fadR and glpFK gene promoters.

[0041] Among them, AF are agarose gel electrophoresis images of successful knockout of genes phoA, ybjG, pgpB, and nlpⅠ, and successful replacement of fadR and glpFK gene promoters, respectively.

[0042] Figure 3 The maps are of the recombinant expression vectors PCTI (A), PAEIG (B), and PRCA (C).

[0043] Figure 4 The effect of different glycerol concentrations on the synthesis yield of abies alcohol.

[0044] Figure 5 The effect of different resting cell concentrations on the synthesis yield of abies alcohol.

[0045] Figure 6 The effect of different substrate concentrations on the synthesis yield of abies alcohol.

[0046] Figure 7 The figure shows the liquid chromatogram of the standard and sample of abirol (the elution time of abirol is 18.74 min).

[0047] Figure 8 Repeat the effect diagram for resting cells. DETAILED DESCRIPTION

[0048] The specific implementation methods of the present invention are further described in detail below in conjunction with the examples. Unless otherwise specified, the instruments and equipment involved in the examples are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents; the experimental methods involved are all conventional methods; the genes and primers involved are synthesized by Suzhou Genewise Co., Ltd.; restriction endonucleases, T4 DNA ligase, PCR enzymes, etc. are from Takara Co., Ltd.

[0049] Various E. coli strains known in the art can be used as the starting strain of the present invention, such as E. coli C41 (DE3), E. coli BL21 (DE3), E. coli C43 (DE3), etc. The starting strain of E. coli in the present embodiment is E. coli C41 (DE3).

[0050] Example 1 Knockout of alkaline phosphatase phoA

[0051] The pEcCas / pEcgRNA system was used to knock out the alkaline phosphatase encoding gene phoA in the Escherichia coli host and construct the plasmid pEcgRNA-phoA. The purpose of this method is to transcribe the corresponding gRNA, thereby forming a complex with the Cas9 protein and recognizing the target site of the target gene through base pairing and PAM to achieve the breakage of the target DNA.

[0052] The specific method is:

[0053] (1) Design target sequences using CRISPR RGEN Tools. Select target sequence: TGCTGATTGGCGATGGGATGGGG (SEQ 1). The plasmid pEcgRNA was digested with BsaI to generate linearized pEcgRNA with 5'-TAGT-3' and 5'-AAAC-3' overhangs.

[0054] Synthetic oligonucleotide upstream primer phoA-UP

[0055] (5'-TAGTTGCTGATTGGCGATGGGATG-3', SEQ 2) and the downstream primer phoA-DN (5'-AAACCATCCCATCGCCAATCAGCA-3', SEQ 3) were annealed in a reaction mixture consisting of 35 μL of ddH2O, 5 μL of T4 ligase buffer, 5 μL of phoA-UP and 5 μL of phoA-DN.

[0056] The annealed double-stranded DNA (phoA-UP and phoA-DN) was diluted 200 times, and 1 μL of the diluted double-stranded DNA was connected with 1 μL of pEcgRNA linearized with BsaI in a mixture of 2 μL of T4 ligase buffer, 1 μL of T4 ligase, and 15 μL of ddH2O at 16°C for 1 hour, and the ligation product was transformed into DH5α to screen the plasmid pEcgRNA-phoA. The positive clones with successful ligation were screened on LB plates containing 50 μg / mL spectinomycin.

[0057] (2) Donor DNA design: Using the E. coli C41 (DE3) genome as a template, design upstream and downstream homology arm amplification primers, and the upper and lower homology arms are designed to be about 400-500bp each. Amplify the upper and downstream homology arms separately, purify and recover. Using the upstream primer (PhoA-FF) of the upstream homology arm and the downstream primer (PhoA-BR) of the downstream homology arm, the recovered upper and downstream homology arms are used as templates for PCR reaction. The PCR conditions are denaturation at 94℃ for 5min, and cycle 30 times according to the following parameters: denaturation at 94℃ for 15s, annealing at 58℃ for 15s, extension at 72℃ for 1min, and finally extension at 72℃ for 10min. Obtain the donor DNA fragment. The above-mentioned primers are designed as follows:

[0058] PhoA-FF:AGTTGTTATTTAAGCTTGCC(SEQ 4)

[0059] PhoA-FR:ACTGCGCCATCTTTGGTATTTTCTGATCACCCGTTAAGCG(SEQ 5)

[0060] PhoA-BF:CGCTTAACGGGTGATCAGAAAATACCAAAGATGGCGCAGT (SEQ 6)

[0061] PhoA-BR:AGGCAATCACTCATGTAGGTCT(SEQ 7)

[0062] (3) The pEcgRNA-phoA plasmid and the donor DNA fragment were co-electroporated into the electroporation competent E. coli C41 (DE3) containing the pEcCas plasmid. The revived bacteria after electroporation were spread on SOB plates containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin and cultured at 37°C overnight. The positive recombinants were screened by colony PCR ( Figure 2 A), Conserved strains.

[0063] The positive recombinants screened above were placed in LB medium containing 10mM rhamnose and 50μg / mL kanamycin for overnight culture to eliminate the gRNA plasmid. 1μL of overnight cultured bacterial solution was transferred to 1mL of LB liquid medium without resistance. After mixing, 50μL of bacterial solution was spread on the LB plate containing kanamycin resistance and cultured at 37℃ overnight. For the LB plate containing kanamycin and spectinomycin resistance, single colonies that did not grow on the spectinomycin plate but grew on the kanamycin plate were selected and the strains were preserved.

[0064] The cultured colonies were inoculated into LB liquid medium containing glucose (5g / L) and cultured overnight at 37°C. Then, about 10 μL of the overnight cultured bacterial solution was spread on LB plates containing glucose (5g / L) and sucrose (10g / L), cultured overnight at 37°C, and then single colonies were randomly selected and screened. The colonies that were eliminated from the plasmid pEcCas on LB plates with and without kanamycin did not grow on the kanamycin plates. The strain LSC-01 with the phoA gene knocked out was screened.

[0065] Example 2 Knockout of ybjG, an undecaprylate diphosphatase

[0066] (1) Design target sequence using CRISPR RGEN Tools. Select target sequence: ATTCCCAAGCGATCACGGTACGG (SEQ 8). Plasmid pEcgRNA was digested with BsaI to generate linearized pEcgRNA with 5'-TAGT-3' and 5'-AAAC-3' overhangs.

[0067] Oligonucleotides ybjG-UP (5'-TAGTATTCCCAAGCGATCACGGTA-3', SEQ 9) and ybjG-DN (5'-AAACTACCGTGATCGCTTGGGAAT-3', SEQ 10) were synthesized and annealed in a reaction mixture consisting of 35 μL of ddH2O, 5 μL of T4 ligase buffer, 5 μL of ybjG-UP and 5 μL of ybjG-DN.

[0068] The annealed double-stranded DNA (ybjG-UP and ybjG-DN) was diluted 200 times, and 1 μL of the diluted double-stranded DNA was connected with 1 μL of pEcgRNA linearized by BsaI in a mixture of 2 μL of T4 ligase buffer, 1 μL of T4 ligase, and 15 μL of ddH2O at 16°C for 1 h. The ligation product was transformed into DH5α, and the plasmid pEcgRNA-ybjG was screened. The positive clones with successful ligation were screened on LB plates containing 50 μg / mL spectinomycin.

[0069] (2) Donor DNA design: Using the genome of strain LSC-01 as a template, design upstream and downstream homologous arm amplification primers, and the upper and lower homologous arms are designed to be about 400-500bp each. Amplify the upper and downstream homologous arms separately, purify and recover. Using the upstream primer (ybjG-FF) of the upstream homologous arm and the downstream primer (ybjG-BR) of the downstream homologous arm, the above-recovered upper and downstream homologous arms are used as templates for PCR reaction. The PCR conditions are denaturation at 94℃ for 5min, and cycle 30 times according to the following parameters: denaturation at 94℃ for 15s, annealing at 58℃ for 15s, extension at 72℃ for 1min, and finally extension at 72℃ for 10min. Obtain the donor DNA fragment. The above-mentioned primers are designed as follows:

[0070] ybjG-FF:TATTGTTCCACCACGGCCAA(SEQ 11)

[0071] ybjG-FR:CGGATCGGTAATGCAAAACAGAACGAGATCATCCACGGAG(SEQ 12)

[0072] ybjG-BF:CTCCGTGGATGATCTCGTTCTGTTTTGCATTACCGATCCG(SEQ 13)

[0073] ybjG-BR:GGTTTCTCTTTCAGGCCAGA(SEQ 14)

[0074] (3) Co-electroporation of the pEcgRNA-ybjG plasmid and the donor DNA fragment into an engineered strain containing the pEcCas plasmid LSC-01 The cells recovered after electroporation were plated on SOB plates containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin and cultured overnight at 37°C. Positive recombinants were screened by colony PCR ( Figure 2 B), preserve the strain. The specific implementation method of subsequent plasmid elimination is as described in Example 1, and finally the engineered strain LSC-02 is obtained.

[0075] Example 3 Knockout of the phosphatidylglycerol phosphatase encoding gene pgpB

[0076] (1) Design target sequence using CRISPR RGEN Tools. Select target sequence: CTGAAACTGTCACCCAGCCCTGG (SEQ 15). Plasmid pEcgRNA was digested with BsaI to generate linearized pEcgRNA with 5'-TAGT-3' and 5'-AAAC-3' overhangs.

[0077] Oligonucleotides pgpB-UP (5'-TAGTCTGAAACTGTCACCCAGCCC-3', SEQ 16) and pgpB-DN (5'-AAACGGGCTGGGTGACAGTTTCAG-3', SEQ 17) were synthesized and annealed in a reaction mixture consisting of ddH2O, T4 ligase buffer, pgpB-UP and pgpB-DN.

[0078] The annealed double-stranded DNA (pgpB-UP and pgpB-DN) was diluted 200 times, and 1 μL of the diluted double-stranded DNA was connected with 1 μL of pEcgRNA linearized by BsaI in a mixture of 2 μL of T4 ligase buffer, 1 μL of T4 ligase, and 15 μL of ddH2O at 16°C for 1 hour, and the ligation product was transformed into DH5α, and the plasmid pEcgRNA-pgpB was screened. Positive clones were screened on LB plates containing 50 μg / mL spectinomycin.

[0079] (2) Donor DNA design: Bacteria The genome of strain LSC-02 As a template, design the upstream and downstream homology arm amplification primers, and the upper and lower homology arms are designed to be about 400-500bp each. Amplify the upper and downstream homology arms separately, purify and recover. Use the upstream primer (pgpB-FF) of the upstream homology arm and the downstream primer (pgpB-BR) of the downstream homology arm, and the recovered upper and downstream homology arms as templates to perform PCR reaction. The PCR conditions are denaturation at 94℃ for 5min, and cycle 30 times according to the following parameters: denaturation at 94℃ for 15s, annealing at 58℃ for 15s, extension at 72℃ for 1min, and finally extension at 72℃ for 10min. Obtain the donor DNA fragment. The above-mentioned primers are designed as follows:

[0080] pgpB-FF:GAGCTGGAAGCCACAATCGC(SEQ 18)

[0081] pgpB-FR:TTCCGCAGGTGGTGTTAATGATCCATACGGCTACTGGCAT(SEQ 19)

[0082] pgpB-BF:ATGCCAGTAGCCGTATGGATCATTAACACCACCTGCGGAA(SEQ 20)

[0083] pgpB-BR:CCAGTCGCTTTATTTTACGTTC(SEQ 21)

[0084] (3) The pEcgRNA-pgpB plasmid and the donor DNA fragment were co-electroporated into the electroporation competent cell of the engineered strain LSC-02 containing the pEcCas plasmid. The revived cells after electroporation were spread on SOB plates containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin and cultured overnight at 37°C. The positive recombinants were screened by colony PCR ( Figure 2 C), preserve the strain. The specific implementation method of subsequent plasmid elimination is as shown in Example 1, and the engineered strain is finally obtained. LSC-03.

[0085] Example 4 Knockout of the outer membrane lipoprotein encoding gene nlpⅠ

[0086] (1) Design target sequences using CRISPR RGEN Tools. Select target sequence: GCGTAAAAGTGAAGTCCTCGCGG (SEQ 22). The plasmid pEcgRNA was digested with BsaI to generate linearized pEcgRNA with 5'-TAGT-3' and 5'-AAAC-3' overhangs.

[0087] Oligonucleotides nlpI-UP (5'-TAGTGCGTAAAAGTGAAGTCCTCG-3', SEQ 23) and nlpI-DN (5'-AAACCGAGGACTTCACTTTTACGC-3', SEQ 24) were synthesized and annealed in a reaction mixture consisting of ddH2O, T4 ligase buffer, nlpI-UP and nlpI-DN.

[0088] The annealed double-stranded DNA (nlpⅠ-UP and nlpⅠ-DN) was diluted 200 times, and 1 μL of the diluted double-stranded DNA was connected with 1 μL of pEcgRNA linearized by BsaI in a mixture of 2 μL of T4 ligase buffer, 1 μL of T4 ligase, and 15 μL of ddH2O at 16°C for 1 hour, and the ligation product was transformed into DH5α, and the plasmid pEcgRNA-nlpⅠ was selected. Positive clones were selected on LB plates containing 50 μg / mL spectinomycin.

[0089] (2) Donor DNA design: Bacteria The genome of strain LSC-03As a template, design the upstream and downstream homology arm amplification primers, and the upper and lower homology arms are designed to be about 400-500bp each. Amplify the upper and downstream homology arms separately, purify and recover. Use the upstream primer of the upstream homology arm (nlpⅠ-FF) and the downstream primer of the downstream homology arm (nlpⅠ-BR), and the recovered upper and downstream homology arms as templates to perform PCR reaction. The PCR conditions are 94℃ denaturation for 5min, and cycle 30 times according to the following parameters: 94℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 1min, and finally 72℃ extension for 10min. Obtain the donor DNA fragment. The above-mentioned primers are designed as follows:

[0090] nlpⅠ-FF:AAATCGAAGTGGGCCGCGTCT (SEQ 25)

[0091] nlpⅠ-FR:GCGATAATTCCAACAATGCGTCGCAACGAAACACCAGCGCAAA(SEQ 26)

[0092] nlpⅠ-BF:TTTGCGCTGGTGTTTCGTTGCGACGCATTGTTGGAATTATCGC(SEQ 27)

[0093] nlpⅠ-BR:TGCCAGCACCAGAATCTGT(SEQ 28)

[0094] (3) Co-electroporation of the pEcgRNA-nlpⅠ plasmid and the donor DNA fragment into an engineered strain containing the pEcCas plasmid LSC-03 The cells recovered after electroporation were plated on SOB plates containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin and cultured overnight at 37°C. Positive recombinants were screened by colony PCR ( Figure 2 D), preserve the strain. The specific implementation method of subsequent plasmid elimination is as described in Example 1, and finally the engineered strain LSC-04 is obtained.

[0095] Example 5 Replacement of the fatty acid metabolism transcription regulator encoding gene fadR promoter with a constitutive strong promoter P tac

[0096] (1) Design target sequence using CRISPR RGEN Tools. Select target sequence: TATCAGCGTAGTTAGCCCTCTGG (SEQ 29). Plasmid pEcgRNA was digested with BsaI to generate linearized pEcgRNA with 5'-TAGT-3' and 5'-AAAC-3' overhangs.

[0097] Oligonucleotides fadR-UP (5'-TAGTTATCAGCGTAGTTAGCCCTC-3', SEQ 30) and fadR-DN (5'-AAACGAGGGCTAACTACGCTGATA-3', SEQ 31) were synthesized and annealed in a reaction mixture consisting of ddH2O, T4 ligase buffer, fadR-UP and fadR-DN.

[0098] The annealed double-stranded DNA (fadR-UP and fadR-DN) was diluted 200 times, and 1 μL of the diluted double-stranded DNA was ligated with 1 μL of pEcgRNA linearized by BsaI in a mixture of 2 μL of T4 ligase buffer, 1 μL of T4 ligase, and 15 μL of ddH2O at 16°C for 1 h. The ligation product was transformed into DH5α to screen out the plasmid pEcgRNA-P tac -fadR. Positive clones were screened on LB plates containing 50 μg / mL spectinomycin.

[0099] (2) Donor DNA design: Using the genome of strain LSC-04 as a template, design upstream and downstream homology arm amplification primers. The upstream and downstream homology arms are designed to be about 400-500 bp each. Amplify the upstream and downstream homology arms, purify and recover them. tac -fadR-FF) and the downstream primer of the downstream homology arm (P tac -fadR-BR), the upstream and downstream homology arms recovered above were used as templates for PCR reaction, and the PCR conditions were 94℃ denaturation for 5min, and 30 cycles according to the following parameters: 94℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 1min, and finally 72℃ extension for 10min. The donor DNA fragment was obtained. The primers mentioned above were designed as follows:

[0100] P tac -fadR-FF:CTTCGATAGCCAACAGACCAC(SEQ 32)

[0101] P tac -fadR-FR:TAACCACACATTACGAGCCGATGATTAATTGTCAACAGCTCACAAAAAGAAGAAAAAGGGA (SEQ 33)

[0102] P tac -fadR-BF:CATCGGCTCGTATAATGTGTGGTTAGAAAGGTGTGTTTCACATATGGTCATTAAGGCGCAAA (SEQ 34)

[0103] Ptac -fadR-BR:GATCGGCCACTTCATTAGC(SEQ 35)

[0104] (3) Co-electroporation of the pEcgRNA-fadR plasmid and the donor DNA fragment into an engineered strain containing the pEcCas plasmid LSC-04 The cells recovered after electroporation were plated on SOB plates containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin and cultured overnight at 37°C. Positive recombinants were screened by colony PCR ( Figure 2 E), save the strain. The specific implementation method of subsequent plasmid elimination is as shown in Example 1, and the engineered strain is finally obtained. LSC-05.

[0105] Example 6 Replacement of the promoter of the glycerol kinase encoding gene glpFK with a strong constitutive promoter P tac

[0106] (1) Design target sequence using CRISPR RGEN Tools. Select target sequence: CAGCATGCCTACAAGCATCGTGG (SEQ 36). Plasmid pEcgRNA was digested with BsaI to generate linearized pEcgRNA with 5'-TAGT-3' and 5'-AAAC-3' overhangs.

[0107] Oligonucleotides glpFK-UP (5'-TAGTCAGCATGCCTACAAGCATCG-3', SEQ 37) and glpFK-DN (5'-AAACCGATGCTTGTAGGCATGCTG-3', SEQ 38) were synthesized and annealed in a reaction mixture consisting of ddH2O, T4 ligase buffer, glpFK-UP and glpFK-DN.

[0108] The annealed double-stranded DNA (glpFK-UP and glpFK-DN) was diluted 200 times, and 1 μL of the diluted double-stranded DNA was ligated with 1 μL of pEcgRNA linearized by BsaI in a mixture of 2 μL of T4 ligase buffer, 1 μL of T4 ligase, and 15 μL of ddH2O at 16°C for 1 h. The ligation product was transformed into DH5α, and the plasmid pEcgRNA-P was screened. tac -glpFK. Positive clones were screened on LB plates containing 50 μg / mL spectinomycin.

[0109] (2) Donor DNA design: Bacteria The genome of strain LSC-05As a template, design the upstream and downstream homology arm amplification primers, and the upper and lower homology arms are designed to be about 400-500bp. Amplify the upstream and downstream homology arms respectively, purify and recover. tac -glpFK-FF) and the downstream primer of the downstream homology arm (P tac -glpFK-BR), the upstream and downstream homology arms recovered above were used as templates for PCR reaction, and the PCR conditions were 94℃ denaturation for 5min, and 30 cycles according to the following parameters: 94℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 1min, and finally 72℃ extension for 10min. The donor DNA fragment was obtained. The primers mentioned above were designed as follows:

[0110] P tac -glpFK-FF:TCTTCGCGCTGATGCTGGG(SEQ 39)

[0111] P tac -glpFK-FR:TAACCACACATTATACGAGCCGATGATTAATTGTCAACAGCTCTCGTCATAAAATGAGCGTTA(SEQ 40)

[0112] P tac -glpFK-BF:CATCGGCTCGTATAATGTGTGGTTAGAAAGGTGTGTTTCACATATGAGTCAAACATCAACCT(SEQ 41)

[0113] P tac -glpFK-BR:GCACAAAATTGATATGAGGA(SEQ 42)

[0114] (3) Co-electroporation of the pEcgRNA-glpFK plasmid and the donor DNA fragment into an engineered strain containing the pEcCas plasmid LSC-04 The cells recovered after electroporation were plated on SOB plates containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin and cultured overnight at 37°C. Positive recombinants were screened by colony PCR ( Figure 2 F), save the strain. The specific implementation method of subsequent plasmid elimination is as shown in Example 1, and the engineered strain is finally obtained. LSC-06.

[0115] Example 7 Construction of recombinant expression vector pCTI

[0116] In this example, the hydroxyethylthiazole kinase encoding gene EcThiM is from E. coli K-12W3110. A pair of primers (EcThiM-F, EcThiM-R) are used to perform PCR on the genomic DNA of E. coli K-12W3110 to obtain the EcThiM fragment.

[0117] Among them, primers EcThiM-F: 5'-ATGGATCCGCAAGTCGACCTGCTGGGTTC-3' (SEQ 43); EcThiM-R: 5'-CATAAGCTTTCATGCCTGCACCTCCTGCGT-3' (SEQ 44), contain restriction enzyme cutting sites BamHI and HindⅢ.

[0118] The isopentenyl phosphate kinase encoding gene MthIPK is from Methanothermobacterthermautotrophicus str.Delta H; the MthIPK fragment was obtained by PCR using a pair of primers (MthIPK-F, MthIPK-R) on the laboratory-preserved plasmid pUC57-MthIPK.

[0119] Among them, primers MthIPK-F: 5'-ATATGATTATTCTGAAACTGGGCGG-3' (SEQ 45) and MthIPK-R: 5'-TCTACTCGAGTTAATGTTTGCCGGTAAT-3' (SEQ 46) contain restriction enzyme sites NdeI and XhoI.

[0120] The PCR conditions for the above genes were all 94℃ denaturation for 5min, and 30 cycles according to the following parameters: 94℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 1min, and finally 72℃ extension for 10min. The products obtained by the PCR reaction were analyzed by 1% agarose gel electrophoresis. After confirming that the fragment size was correct, the target band fragment was recovered using a DNA purification recovery kit for the construction of a recombinant expression vector.

[0121] The plasmid pCDuet-1 and the above fragments were digested and ligated using restriction endonucleases BamHI, HindIII, NdeI and XhoI, and T4 DNA ligase to obtain the expression vector pCTI ( Figure 3 A).

[0122] Example 8 Construction of recombinant expression vector pAEIG

[0123] In this example, the bifunctional farnesyl diphosphate synthase encoding gene ScERG20 (F96C) comes from S. cerevisiae S288c. A pair of primers (ScEGR20-F, ScEGR20-R) were used to perform PCR on S. cerevisiae S288c genomic DNA to obtain the ScERG20 fragment.

[0124] Among them, primer ScEGR20-F: 5'-CAGGGAATTCGGCTTCAGAAAAAGAAATTAGGA-3' (SEQ 47);

[0125] ScEGR20-R:

[0126] 5'-GCTACCGCCACCGCCGCTACCGCCACCGCCTTTGCTTCTCTTGTAAACTTTG-3'(SEQ 48),

[0127] The isopentenyl diphosphate δ-isomerase encoding gene ScIDI comes from S.cerevisiae S288c. A pair of primers ScIDI-F and ScIDI-R are used to perform PCR on S.cerevisiae S288c genomic DNA to obtain the ScIDI fragment.

[0128] Among them, primer ScIDI-F:

[0129] 5'-GGCGTGGCGGTAGCGGCGGTGGCGGTAGCATGACTGCCGACAACAAT-3'(SEQ 49),

[0130] ScIDI-R: 5'-GCGCCTTAAGTTATAGCATTCTATGAATTTGCC-3' (SEQ 50).

[0131] By setting directional complementary sequences on primer ScEGR20-R and primer ScIDI-F, the obtained fragments ScERG20 and ScIDI were fused by PCR to obtain the fragment ScERG20-ScIDI.

[0132] Similarly, the PCR fusion method was used to introduce the high activity mutation of the bifunctional farnesyl diphosphate synthase (i.e., the 96th amino acid residue mutation: F→C) into the fragment ScERG20-ScIDI to obtain the fusion fragment ScERG20(F96C)-IDI. Among them, primer ScEGR20-F: 5'-CAGGGAATTCGGCTTCAGAAAAAGAAATTAGGA-3' (SEQ 51), ScEGR20(F96C)-F: 5'-GTTGTTGCAGGCTTACTGCTTGGTCGCCGATG-3' (SEQ 52), ScEGR20(F96C)-R: 5'-CATCGGCGACCAAGCAGTAAGCCTGCAACAAC-3' (SEQ 53) and ScIDI-R: 5'-GCGCCTTAAGTTATAGCATTCTATGAATTTGCC-3' (SEQ 54). The primers ScEGR20-F and ScIDI-R contain the restriction sites EcoRI and AflII.

[0133] The geranylgeranyl diphosphate synthase encoding gene TcGGPPS, from Taxus canadensis, was PCR-generated with a pair of primers on the laboratory-stored plasmid pUC57-TcGGPPS to obtain the TcGGPPS fragment. Among them, the primers TcGGPPS-F: 5'-GCAGCATATGGCAGATCTGTTTGATTTCAATG-3' (SEQ 55); TcGGPPS-R: 5'-CGAGCTCGAGTTAGTTCTGACGAAACGCAAT-3' (SEQ 56), containing restriction sites NdeI and XhoI.

[0134] The PCR conditions for the above genes were all 94℃ denaturation for 5min, and 30 cycles according to the following parameters: 94℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 1min, and finally 72℃ extension for 10min. The products obtained by the PCR reaction were analyzed by 1% agarose gel electrophoresis. After confirming that the fragment size was correct, the target band fragment was recovered using a DNA purification recovery kit for the construction of a recombinant expression vector.

[0135] The plasmid pACYCDuet-1 and the above fragments were digested and ligated using restriction endonucleases EcoRI, AflII, NdeI, XhoI and T4 DNA ligase to obtain the expression vector pAEIG ( Figure 3 B).

[0136] Example 9 Construction of recombinant expression vector pRCA

[0137] In this example, the gene encoding lisdactone-13-ene-8-ol diphosphate synthase CcCLS is from Cistus creticus. A pair of primers was used to perform PCR on the laboratory-preserved plasmid pUC57-CcCLS to obtain the CcCLS fragment.

[0138] Among them, primers CcCLS-F: 5'-AGCGGATCCGTGTTCAGCTAGGAG-3' (SEQ 57); CcCLS-R: 5'-ATGCGTCGACTTACACCACGCTCTCAAA-3' (SEQ 58), contain restriction enzyme cutting sites BamHI and SalI.

[0139] The gene encoding abirol synthase, NtABS, was derived from Nicotiana tabaccum. A pair of primers was used to perform PCR on the laboratory-preserved plasmid pUC57-NtABS to obtain the NtABS fragment.

[0140] Among them, primers NtABS-F: 5'-ATAGAGATCTGGCTATATGCCACAGGCCCTG-3' (SEQ 59); NtABS-R: 5'-ATGAGGTACCCGGAGAATACTGATTCAGGGGCTT-3' (SEQ 60), contain restriction enzyme sites BglII and KpnI.

[0141] The PCR conditions for the above genes were all 94℃ denaturation for 5min, and 30 cycles according to the following parameters: 94℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 1min, and finally 72℃ extension for 10min. The products obtained by the PCR reaction were analyzed by 1% agarose gel electrophoresis. After confirming that the fragment size was correct, the target band fragment was recovered using a DNA purification recovery kit for the construction of a recombinant expression vector.

[0142] The plasmid pRSFDuet-1 and the above fragments were digested and ligated using restriction endonucleases BamHI, SalI, BglII, KpnI and T4 DNA ligase to obtain the expression vector pRCA ( Figure 3 C).

[0143] Example 10 Construction of resting cells of recombinant engineered bacteria

[0144] The three recombinant expression vectors successfully constructed in the above examples 7-9 were simultaneously transformed into the engineered strain LSC-06 to obtain the engineered strain LSC-07 that co-expressed hydroxyethylthiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate δ-isomerase, bifunctional farnesyl diphosphate synthase, geranylgeranyl diphosphate synthase, lisdane-13-ene-8-ol diphosphate synthase and abietol synthase.

[0145] Example 11 Preparation of Abiesol by Isopentenol Catalyzed by Resting Cells

[0146] The strain LSC-07 successfully constructed in Example 10 was inoculated into 50 mL LB medium containing 50 μg / mL streptomycin, 30 μg / mL chloramphenicol, and 25 μg / mL kanamycin, and cultured at 37°C with shaking at 200 rpm overnight. The culture was transferred to fresh 400 mL TB medium containing 50 μg / mL streptomycin, 30 μg / mL chloramphenicol, and 25 μg / mL kanamycin at a 1% inoculum, and cultured at 37°C with shaking at 200 rpm. The OD 600 When it reaches 2.5-3.0, add 0.5mM IPTG for overnight induction at 25°C, 200rpm, centrifuge at 4000rpm, 4°C for 10min, discard the supernatant, and wash twice with 20mM PB (pH 7.0) buffer to obtain resting cells expressing hydroxyethylthiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate δ-isomerase, bifunctional farnesyl diphosphate synthase, geranylgeranyl diphosphate synthase, lisdane-13-ene-8-ol diphosphate synthase and abies alcohol synthase for use.

[0147] In a 100 mL reaction system, add isopentenol with a final concentration of 1.0-5.0 g / L, glycerol with a final concentration of 0-40 g / L (to provide resting cells with ATP synthesis capacity to meet the ATP demand of the catalytic synthesis process of abestrol) and 20-200 g / L of the above resting cells (the above concentrations are all final concentrations), add 20 mM pH 7.0 PB buffer to a volume of 100 mL, and finally add isopropyl myristate accounting for 10% (v / v) of the total volume of the reaction system to form a catalytic reaction system, catalyze at 25° C. for 12-24 hours, and finally obtain abestrol.

[0148] In order to explore the effects of various factors in the reaction system on the yield of abies alcohol, experiments were conducted by changing the glycerol concentration, resting cell concentration, and isopentenol concentration.

[0149] By changing the glycerol concentration (0, 10, 20, 30, 40 g / L), the changes in the yield of abirol under different glycerol concentrations were explored (final concentration of isopentenol 2.0 g / L, final concentration of the above resting cells 100 g / L), catalyzed at 25 ° C for 24 h, and the results showed that the yield of abirol was the highest when the glycerol concentration was 20 g / L ( Figure 4 ).

[0150] By changing the resting cell concentration (20, 50, 100, 150, 200 g / L), the effect of different resting cell concentrations on the synthesis yield of abirol was investigated (final concentration of isopentenol 2.0 g / L, final concentration of glycerol 20 g / L), catalyzed at 25 ° C for 24 h, and the results showed that the yield of abirol was the highest when the resting cell concentration was 100 g / L ( Figure 5 , the bacterial concentration on the horizontal axis in the figure is the final resting cell concentration).

[0151] By changing the concentration of isopentenol (1.0, 2.0, 3.0, 4.0, 5.0 g / L), the effect of different isopentenol concentrations on the synthesis yield of firwood alcohol was investigated (final concentration of resting cells was 100 g / L, final concentration of glycerol was 20 g / L), and catalysis was performed at 25°C for 24 hours. The results showed that the yield of firwood alcohol was the highest when the isopentenol concentration was 3.0 g / L ( Figure 6 , the amount of substrate added on the horizontal axis in the figure is the final concentration of isopentenol).

[0152] The experiment showed that the optimal resting cell catalytic process was to add 3.0 g / L of isopentenol, 100 g / L of recombinant E. coli resting cells, 20 g / L of glycerol, 20 mM pH 7.0 PB buffer to a volume of 100 mL, and finally add 10% (v / v) of isopropyl myristate to the total volume of the reaction system at 25°C for 24 hours. The results showed that 3.0 g / L of substrate isopentenol was catalyzed to produce 1.80 g / L of abirol within 24 hours, and the actual conversion rate reached 71.15%, which is much higher than the level reported in the current literature and patents.

[0153] Calculation method of actual conversion rate: According to the catalytic reaction of firwood alcohol, 4 mol of isopentenol is completely converted to produce 1 mol of firwood alcohol. The theoretical value of 3.0 g / L of isopentenol completely converted to firwood alcohol is 2.53 g / L according to the molecular weight calculation. The actual conversion rate can be obtained by dividing the actual detection value by the theoretical value.

[0154] HPLC analysis: react at 25°C, 200 rpm for 24 hours, then take a sample. Abiesol has UV absorption at 237 nm, and is analyzed using a high performance liquid chromatography UV detector ( Figure 7 ).

[0155] The HPLC analysis conditions are as follows: the chromatographic column is C18; the flow rate is 0.8 mL / min; the column temperature is 30°C; the detector is a UV detector; the injection volume is 5 μL. The test results are: after 24 hours of reaction, the content of afir alcohol is 1.80 g / L.

[0156] from Figure 7The HPLC test results show that the elution time of the catalytic synthesis product sample obtained in this experiment is consistent with that of the abendazole standard (both are 18.74 min), indicating that the catalytic synthesis product is abendazole.

[0157] Example 12 Reuse of resting cells

[0158] After the resting cell catalytic reaction is completed, the resting cells in the reaction system still retain most of the catalytic activity, so the reusability of the resting cells is verified.

[0159] After centrifugation of the reaction system, the resting cells were recovered and repeatedly used for a new round of catalytic reaction. Reaction conditions: Add 3.0 g / L of isopentenol, 100 g / L of recombinant Escherichia coli resting cells, and 20 g / L of glycerol to a 100 mL catalytic reaction system, add 20 mM pH 7.0 PB buffer to a volume of 100 mL, and finally add 10% (v / v) of isopropyl myristate to the total volume of the reaction system. The catalytic reaction was continued at 25 ° C for 24 hours. The efficiency of repeated use of resting cells is shown in Figure 8 ,The experimental results show that in the first 6 repetitions of resting cells, the actual conversion rate of the substrate isopentenol to abies alcohol reached more than 50%, which means that the same batch of resting cells can be reused 5-6 times.

[0160] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any similar modifications, equivalent substitutions or improvements made by those skilled in the art within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for preparing recombinant Escherichia coli resting cells, characterized in that: The phosphatase encoding genes phoA, ybjG, pgpB and the outer membrane lipoprotein encoding gene nlpⅠ in the Escherichia coli host were knocked out, the fatty acid metabolism transcription regulator encoding gene fadR was constitutively overexpressed, that is, the fatty acid metabolism transcription regulator encoding gene fadR promoter was replaced by the constitutive strong promoter Ptac, and the glycerol metabolism operon gene glpFK was constitutively overexpressed, that is, the glycerol kinase encoding gene glpFK promoter was replaced by the constitutive strong promoter Ptac, and the Escherichia coli engineering strain LSC-06 was constructed; on the basis of the Escherichia coli engineering strain LSC-06, a hydroxyethylthiazole kinase encoding gene EcThiM from E.coli K-12 W3110, an isopentenyl phosphate kinase encoding gene MthIPK from Methanothermobacter thermautotrophicus str. Delta H, an isopentenyl diphosphate δ-isomerase encoding gene ScIDI from S. cerevisiae S288c, and an F96C high activity mutation from S. cerevisiae S288c, ScERG20, TcGGPPS, CcCLS, and NtABS were used to encode the bifunctional farnesyl diphosphate synthase from Cistuscreticus, Taxus canadensis, Taxus geranyl diphosphate synthase, and the abietol synthase from Nicotiana tabaccum. The E. coli engineered strain LSC-07 was cultured to obtain recombinant E. coli resting cells.

2. The preparation method according to claim 1, characterized in that The construction method of the E. coli engineering strain LSC-06 is as follows: (1) Knockout of the alkaline phosphatase encoding gene phoA: Using the genome of Escherichia coli C41 (DE3) as a template, donor DNA was designed to construct an Escherichia coli engineered strain LSC-01 with the phoA gene knocked out; (2) Knockout of the gene encoding undecaprylate diphosphatase ybjG: Using the genome of the E. coli engineered strain LSC-01 as a template, donor DNA was designed to construct the E. coli engineered strain LSC-02 with the ybjG gene knocked out; (3) Knockout of the gene encoding phosphatidylglycerol phosphatase, pgpB; Using the genome of the E. coli engineered strain LSC-02 as a template, donor DNA was designed to construct the E. coli engineered strain LSC-03 with the pgpB gene knocked out; (4) Knockout of the outer membrane lipoprotein encoding gene nlpⅠ Using the genome of the E. coli engineered strain LSC-03 as a template, donor DNA was designed to construct the E. coli engineered strain LSC-04 with the nlpⅠ gene knocked out. (5) Constitutive overexpression of the fatty acid metabolism transcriptional regulator gene fadR Using the genome of the engineered E. coli strain LSC-04 as a template, donor DNA was designed to construct a construct that replaced the promoter of the fatty acid metabolism transcription regulator gene fadR with a strong constitutive promoter P. tac The engineered E. coli strain LSC-05; (6) Constitutive overexpression of the glycerol metabolism operon glpFK Using the genome of the engineered E. coli strain LSC-05 as a template, donor DNA was designed and the promoter of the glycerol kinase encoding gene glpFK was constructed as a constitutive strong promoter P tac The engineered Escherichia coli strain LSC-06.

3. The preparation method according to claim 1, characterized in that: The construction method of the E. coli engineering strain LSC-07 is as follows: (1) Constructing a recombinant expression vector pCTI containing the hydroxyethylthiazole kinase encoding gene EcThiM and isopentenyl phosphate kinase MthIPK; (2) Construction of a recombinant expression vector pAEIG containing the bifunctional farnesyl diphosphate synthase encoding gene ScERG20, the isopentenyl diphosphate δ-isomerase encoding gene ScIDI, and the geranylgeranyl diphosphate synthase encoding gene TcGGPPS; (3) Construction of the recombinant expression vector pRCA containing the gene encoding lisdactyl-13-ene-8-ol diphosphate synthase CcCLS and the gene encoding abestrol synthase NtABS; (4) The recombinant expression vectors pCTI, pAEIG and pRCA constructed in steps (1) to (3) are co-transformed into the E. coli engineered strain LSC-06 described in claim 1 by plasmid co-transformation to construct an E. coli engineered strain LSC-07 that simultaneously expresses hydroxyethylthiazole kinase, isopentenyl phosphate kinase, isopentenyl diphosphate δ-isomerase, bifunctional farnesyl diphosphate synthase, geranylgeranyl diphosphate synthase, lisdendron-13-ene-8-ol diphosphate synthase and abietol synthase.

4. A method for preparing abirol by catalyzing isopentenol using the recombinant Escherichia coli resting cells obtained by the preparation method of any one of claims 1 to 3, characterized in that: In a 100 mL catalytic reaction system, add isopentenol with a final concentration of 1.0-5.0 g / L, recombinant Escherichia coli resting cells of 20-200 g / L, and 0-40 g / L glycerol, add 20 mM pH 7.0 PB buffer to a volume of 100 mL, and finally add isopropyl myristate accounting for 10-20% (v / v) of the total volume of the reaction system; catalyze the reaction at 25°C for 12-24 hours to synthesize abendazole.

5. The method according to claim 4, characterized in that Add glycerol to a final concentration of 10-40 g / L in 100 mL of the catalytic reaction system.

6. The method according to claim 4, characterized in that In a 100 mL catalytic reaction system, 3.0 g / L isopentenol, 100 g / L recombinant Escherichia coli resting cells, and 20 g / L glycerol were added respectively, and 20 mM pH 7.0 PB buffer was added to a volume of 100 mL. Finally, 10% (v / v) of isopropyl myristate was added to the total volume of the reaction system; catalysis was carried out at 25°C for 24 h to synthesize abdelol.

7. The method according to claim 4, characterized in that After the reaction is completed, the recombinant E. coli resting cells are recovered by centrifugation and reused.

8. Use of the method for preparing the recombinant Escherichia coli resting cells as claimed in claim 1 in catalyzing the preparation of abendazole from isopentenol.

Images