Method for establishing CADASIL disease model in dogs

Abstract

The present invention relates to a method for establishing a Notch3 gene knockout type cerebral autosomal dominant arteriopathy with subcortical infarction and leukoencephalopathy (CADASIL) model dog, as well as the obtained Notch3 gene knockout type CADASIL disease model dog and its cells, tissues and organs, making it feasible to use dogs as animal models for CADASIL disease research.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a method for establishing a CADASIL disease model dog. Background Art

[0002] Cerebral autosomal dominant arteriopathy with subcortical infarct and leukoencephalopathy (CADASIL), also known as CADASIL, is a common hereditary cerebral arteriopathy. The clinical features of this disease were first reported in 1977. It usually develops in middle age, with clinical manifestations mainly including leukoencephalopathy, dementia, headache, pseudobulbar palsy and depression. The incidence of this disease is about (2-5) / 100,000, but it may actually be higher.

[0003] With the rapid development of the biological field, researchers have found that CADASIL has obvious autosomal dominant inheritance characteristics, and the vascular lesions caused by it are mainly related to mutations in the Notch3 (Notch receptor 3, Notch receptor 3) gene. Most of the pathogenic variants of NOTCH3 are missense mutations (95%), and about 60% are located in exons 3, 4, 5, and 8. Exons 3 and 4 are hotspot mutation areas in Chinese CADASIL patients. The pathogenic variants of the NOTCH3 gene occur abnormally in exons 2 to 24, leading to the formation of odd-numbered cysteine ​​residues in EGFR, affecting the two-to-two binding of disulfide bonds and changing the protein conformation, ultimately leading to abnormal accumulation of NOTCH3-ECD. Recent studies have shown that abnormal accumulation of NOTCH3-ECD in small blood vessels of the brain and other peripheral organs is the core event of CADASIL, which promotes abnormal aggregation of functional extracellular matrix proteins and produces cytotoxic effects, ultimately leading to smooth muscle cell degeneration. Through hemodynamic studies on CADASIL patients, researchers speculate that cerebral blood flow disorders may be the main cause of CADASIL disease.

[0004] In order to explore the relevant disease mechanisms, researchers have constructed a variety of rat and mouse models for Notch3 gene expression deficiency or mutation. These models can simulate some pathological phenotypes of clinical CADASIL patients to a certain extent, such as systemic VSMC degeneration and impaired arterial capacity, but rarely show the most significant pathological changes of cerebral artery degeneration in clinical CADASIL patients. The main reason may be that the mouse / rat has a short lifespan, a small brain size, and different levels of tissue-specific overexpression of mutant Notch3, which may lead to abnormal increase of brain white matter in rat / rat CADASIL models, but cannot simulate the lacunar infarction phenomenon shown by MRI detection in clinical CADASIL patients, which largely hinders the application of the model in clinical transformation and the development and research of related drugs.

[0005] Therefore, there is an urgent need to find new animal models that can better simulate the pathological phenotype of CADASIL clinical patients for use in clinical transformation and related drug development research. Summary of the invention

[0006] In order to solve the problems existing in the prior art, based on the high similarity between dogs and humans in vascular structure and composition size, the present invention provides a method for establishing a Notch3 (Notch receptor 3) gene knockout cerebral autosomal dominant arteriopathy (CADASIL) model dog with subcortical infarction and leukoencephalopathy by gene editing technology. The present invention also relates to the established Notch3 gene knockout CADASIL dog model, and its cells and tissues.

[0007] In a first aspect, the present invention provides a method for establishing a canine model of cerebral autosomal dominant arteriopathy with subcortical infarction and leukoencephalopathy (CADASIL), the method comprising the following steps: using gene editing technology to obtain a canine fertilized egg or canine somatic cell with a Notch3 gene knockout.

[0008] In some embodiments, the gene editing technology is selected from BE3 single-base editing technology, CRISPR, TALEN and ZFN, preferably CRISPR / Cas9.

[0009] In some embodiments, the method comprises the steps of:

[0010] (1) Determine the target site based on the sequence of exon 3 of the canine Notch3 gene sequence;

[0011] (2) synthesizing the sgRNA sequence according to the targeting site determined in step (1), and then connecting the synthesized sequence to the backbone vector to construct an sgRNA targeting vector;

[0012] (3) Obtaining in vitro transcription products of sgRNA and CRISPR / Cas9 respectively through in vitro transcription;

[0013] (4) Introducing the in vitro transcription product obtained in step (3) into a canine fertilized egg or a canine somatic cell to obtain a canine fertilized egg or a canine somatic cell with Notch3 gene knockout.

[0014] In some embodiments, three targeting sites are determined based on exon 3 of the Notch3 gene sequence. Preferably, the sgRNA sequence of the targeting site and its complementary sequence include the following sequences:

[0015] S1 site: CGTCTGCCAGAGTTCCGTGGTGG (SEQ ID NO: 2), the complementary sequence is CCACCACGGAACTCTGGCAGACG (SEQ ID NO: 3);

[0016] S2 site: TCCCTTACCTCGGAAGCCACGGG (SEQ ID NO: 4), complementary sequence is CCCGTGGCTTCCGAGGTAAGGGA (SEQ ID NO: 5);

[0017] S3 site: AATGGCAGGGGTCCTCCAGCTGG (SEQ ID NO: 6), and the complementary sequence is CCAGCTGGAGGACCCCTGCCATT (SEQ ID NO: 7).

[0018] In some embodiments, the canine somatic cells are from the following tissues or organs: fetal tissue, skin, muscle, ear, mammary gland, fallopian tube, ovary, blood, urine, fat, bone marrow, blood vessels and luminal endothelium.

[0019] In some embodiments, the canine somatic cell is selected from the group consisting of fetal fibroblasts, skin cells, epithelial cells, ear cells, fibroblasts, endothelial cells, muscle cells, mammary cells, fallopian tube cells, ovarian cells, cumulus cells, neural cells, and osteoblasts.

[0020] In some embodiments, the method further comprises transplanting the obtained Notch3 gene knockout canine fertilized egg into the fallopian tube of a recipient female dog, thereby preparing a CADASIL disease model dog.

[0021] In some embodiments, the method further comprises transplanting the nucleus of the obtained Notch3 gene knockout canine somatic cell into a canine enucleated oocyte, and then transplanting the canine enucleated oocyte after nuclear transplantation into the fallopian tube of a recipient female dog, thereby preparing a CADASIL disease model dog.

[0022] In some embodiments, the present invention utilizes gene editing technology to select a targeting site sequence according to the exons of the canine Notch3 gene sequence, and constructs an sgRNA targeting vector and a CRISPR / Cas9 expression vector according to the targeting site sequence. After the vector is verified to be effective, it is transcribed into mRNA in vitro, and then the mRNA is injected into a canine fertilized egg by cytoplasmic injection. The canine fertilized egg is then transplanted into one of the fallopian tubes of a female dog whose bilateral fallopian tubes have been flushed with embryos, thereby preparing a Notch3 gene knockout CADASIL disease model dog.

[0023] In a second aspect, the present invention provides a targeting vector for canine Notch3 gene knockout, wherein the targeting vector is composed of an sgRNA sequence designed for a targeting site sequence in exon 3 of the canine Notch3 gene and a backbone vector.

[0024] In some embodiments, three targeting sites are designed according to exon 3 of the Notch3 gene sequence, and the sgRNA sequences and their complementary sequences of the targeting sites include the following sequences:

[0025] S1 site: CGTCTGCCAGAGTTCCGTGGTGG (SEQ ID NO: 2), the complementary sequence is CCACCACGGAACTCTGGCAGACG (SEQ ID NO: 3);

[0026] S2 site: TCCCTTACCTCGGAAGCCACGGG (SEQ ID NO: 4), complementary sequence is CCCGTGGCTTCCGAGGTAAGGGA (SEQ ID NO: 5);

[0027] S3 site: AATGGCAGGGGTCCTCCAGCTGG (SEQ ID NO: 6), and the complementary sequence is CCAGCTGGAGGACCCCTGCCATT (SEQ ID NO: 7).

[0028] In a third aspect, the present invention provides canine somatic cells, tissues or organs of a CADASIL disease model dog obtained by the method of the first aspect.

[0029] In some embodiments, the canine somatic cell, tissue or organ comprises the sequence shown in SEQ ID NO:13 and / or SEQ ID NO:15.

[0030] In some embodiments, the classification of the somatic cells is named Notch3 gene knockout positive cell line, which is deposited in the China General Microbiology Center (CGMCC) with the deposit number CGMCC No.45181 and the deposit date of June 9, 2022.

[0031] In a fourth aspect, the present invention provides a primer pair, the sequence of the primer pair is as follows:

[0032] Forward primer: CATTGTTGTCAGGCAGGTAGC (SEQ ID NO: 10); and

[0033] Reverse primer: GAAGGGTGCGAGGGATTGA (SEQ ID NO: 11).

[0034] In a fifth aspect, the present invention provides a kit, wherein the sequences of the primer pairs are as follows:

[0035] Forward primer: CATTGTTGTCAGGCAGGTAGC (SEQ ID NO: 10); and

[0036] Reverse primer: GAAGGGTGCGAGGGATTGA (SEQ ID NO: 11).

[0037] In a sixth aspect, the present invention provides use of the primer pair described in the fourth aspect or the kit described in the fifth aspect in detecting a CADASIL disease model dog having a genomic sequence comprising a sequence fragment shown in SEQ ID NO:13 and / or SEQ ID NO:15.

[0038] The NOTCH3 receptor encoded by the Notch3 gene binds to its ligand through the extracellular domain (NOTCH3-ECD), and then exerts signal transduction through the intracellular domain to regulate the proliferation and differentiation of vascular smooth muscle cells. NOTCH3-ECD is composed of 34 epidermal growth factor-like repeat domains (EGFR), each of which contains 6 cysteine ​​residues, which are bound in pairs through 3 disulfide bonds. Most of the pathogenic variants of NOTCH3 are missense mutations (95%), and about 60% are located in exons 3, 4, 5, and 8. Exons 3 and 4 are hotspot mutation regions in Chinese CADASIL patients. The pathogenic variants of the NOTCH3 gene occur abnormally in exons 2-24, leading to the formation of odd-numbered cysteine ​​residues in EGFR, affecting the two-by-two binding of disulfide bonds and changing the protein conformation, which ultimately leads to the abnormal accumulation of NOTCH3-ECD. Notch3 mutations usually lead to increased NOTCH3-ECD accumulation levels in vascular smooth muscle cells (VSMCs), significant deposition of granular osmophilic granules (GOMs), and ultimately loss of VSMCs.

[0039] The present invention uses CRISPR / Cas9 to obtain a CADASIL disease model dog with Notch3 gene knockout, realizes effective editing of the Notch3 gene in the genome, and enriches the canine disease model biological sample library. The CADASIL disease model dog prepared by the method of the present invention can effectively make up for the defects of mouse and primate CADASIL model animals, and has a high similarity with humans in gene defect patterns, and can be used for the research of new technologies for the treatment of human CADASIL, the development of new drugs and the research of its pathogenesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 A schematic diagram of the canine Notch3 gene targeting site sequence of the present application is shown.

[0041] Figure 2 The PCR identification results of newborn puppies Nos. 210579 to 210591 of the present application are shown.

[0042] Figure 3 The Notch3 gene sequencing results of the gene-edited dog No. 210586 of the present application are shown.

[0043] Figure 4 The Notch3 gene sequencing results of the gene-edited dog No. 210588 of the present application are shown.

[0044] Figure 5 Shown are the brain magnetic resonance imaging results of the gene-edited dog No. 210586 of the present application. DETAILED DESCRIPTION

[0045] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments and drawings. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation to the present invention. In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0046] Example

[0047] 1. Construction of transgenic targeting vector

[0048] According to the canine Notch3 gene sequence information provided by NCBI, the targeting site was designed based on exon 3 of the canine Notch3 gene. The sequence of the targeting site was the sequence shown in SEQ ID NO: 1: TTGCATGAATGAACGAGGCGTGTGCCCATTTGTTGGGCTGTTTGCTTGTGTGTTTCTTGCCTTTCACGTGTGTGTATCTCGGGGTCTGGGATGCTCCTGCCCAGTACCATCCTAGTACTGCTCTGTACTAAGCTGTCTCTGCCCACAGGTGCCCGCCGGGATGGGTGGGCGAGCGGTGCCAGCTGGAGGACCCCTGCCATTCGGGCCCCTGCGCTGGCCGTGGCGTCTGCCAGAGTTCCGTGGTGGCAGGCGCCGCCCGCTTCTCCTGCCGGTGCCCCCGTGGCTTCCGAGGTAAGGGATGGTCTGGAGGGGAGCCCGGGGCAGGCAAGGGTGTGAAGAGCCCA (SEQ ID NO: 1).

[0049] Three sgRNA sequences were designed for this target site (see Figure 1 ), specifically:

[0050] sg1: CGTCTGCCAGAGTTCCGTGGTGG (SEQ ID NO: 2), the complementary sequence sg1-rev is: CCACCACGGAACTCTGGCAGACG (SEQ ID NO: 3);

[0051] sg2: TCCCTTACCTCGGAAGCCACGGG (SEQ ID NO: 4), the complementary sequence sg2-rev is: CCCGTGGCTTCCGAGGTAAGGGA (SEQ ID NO: 5);

[0052] sg3: AATGGCAGGGGTCCTCCAGCTGG (SEQ ID NO: 6), and the complementary sequence sg3-rev is: CCAGCTGGAGGACCCCTGCCATT (SEQ ID NO: 7).

[0053] When constructing the vector, the backbone vector T7-gRNA (purchased from Addgene) was digested with BbsI for subsequent experiments. The sgRNA sequence and the sgRNA complementary sequence were annealed and connected, and then connected to the digested T7-gRNA plasmid. The T7-sgRNA plasmid was amplified by PCR and the PCR product was recovered. The PCR product of T7-sgRNA was transcribed in vitro using an in vitro transcription kit.

[0054] 2. In vitro transcription:

[0055] First, the CRISPR / Cas9 plasmid was linearized, and the reaction system was: 30μg plasmid, 5μL restriction endonuclease AflII; 10μL 10×Buffer and ddH2O, with a total volume of 100μL. Then, 100μL phenol: chloroform: isoamyl alcohol (25:24:1) was added to purify the linearized plasmid DNA, and centrifuged at 12000g for 5min; 50μl of supernatant was pipetted into a 1.5ml centrifuge tube without RNase, and 1 / 10 volume of sodium acetate and 3 volumes of anhydrous ethanol were added to precipitate the plasmid DNA, and centrifuged at 12000g for 5min; the supernatant was discarded, and the residual supernatant was discarded as much as possible, and 150μL 70% ethanol was added to wash the plasmid, and the solution was centrifuged at 12000g for 5min; it was dried in air for 3-5min, and the DNA was dissolved with 15μL RNase-free ddH2O, and the concentration was determined.

[0056] In vitro transcription mRNA kit method (thermofisher mMESSAGE T7 Ultra Kit):

[0057] The in vitro transcription system is: 1μg linearized plasmid DNA, 10μL 2×NTP / CAP, 2μL 10×Buffer, 2μL RNA synthase and ddH2O, with a total volume of 20μL. After mixing, incubate at 37℃ for 1hr; add 1μL TURBO DNase to digest the plasmid template, and incubate at 37℃ for 30min. Then mix 20μL in vitro transcription product, 20μL 10×Reaction Buffer, 10μL ATP (10mM), 2.5μL RNase inhibitor, 2μL Poly(A) polymerase and nuclease-free ddH2O to prepare a total volume of 100μL in vitro transcribed mRNA plus polyA system, and incubate at 37℃ for 1hr. After incubation, add 350 μL of binding buffer to the reaction system and mix by pipetting; then add 250 μL of anhydrous ethanol and mix evenly; then transfer the sample to the mRNA purification column and centrifuge at 10,000 g at room temperature for 1 min; discard the filtrate, reinstall the column, rinse the column with 500 μL of eluent, and centrifuge at 10,000 g at room temperature for 1 min; repeat the rinse once, discard the filtrate, and centrifuge the empty column for 1 min to elute impurities such as proteins; then place the column in a new centrifuge tube, add 50 μL of RNA eluent to the center of the column, cover the lid, incubate at 65°C for 10 min, and centrifuge at 10,000 g at room temperature for 1 min; detect the RNA quality and concentration.

[0058] The in vitro transcription products of CRISPR / Cas9 and sgRNA were mixed to a final concentration of 20 ng / μL for sgRNA and 200 ng / μL for Cas9, and stored at -80°C for cytoplasmic injection.

[0059] 3. Cytoplasmic injection, embryo transfer and identification

[0060] CRISPR / Cas9 mRNA and three sgRNA mRNAs were mixed in a ratio of 2:1:1:1, and injected into the cytoplasm of canine fertilized eggs. A total of 11 embryo transfers were performed, with 55 embryos transferred, 11 transplant recipients, 28 puppies born, and 2 gene-edited positive dogs (see Table 1 for details). The specific operation included: a total of 11 naturally estrus beagle female dogs were used as fertilized egg donors and embryo transplant recipients for experiments. Blood was collected from all female dogs to test the progesterone concentration in the serum. When the progesterone concentration reached 4-7ng / mL, it could be determined as the ovulation period. Natural mating was performed 48h after ovulation, and then fertilized embryos were flushed out. A total of 55 fertilized eggs were obtained from 11 female dogs. After collecting the fertilized eggs, the cumulus granulosa cells were removed using TCM199 medium containing 0.1% hyaluronidase, and then placed in a microdroplet of HEPES-buffered TCM199 medium (HM, GIBCO11150), and then placed on an inverted microscope equipped with a micromanipulator. A mixture of RNA containing the above-prepared sgRNA and mRNA of Cas9 at a volume ratio of 4:1 was drawn using a microinjection needle and then injected into the cytoplasm of the fertilized egg. The oviduct was flushed with 10 mL of HEPES-buffered TCM199 medium (HM, GIBCO11150) containing 10% fetal bovine serum, and the oviduct flushing fluid flowed out from the injection needle ligated at the oviduct umbrella and collected in a 10 mL centrifuge tube. After the cytoplasmic injection was completed, the embryo was placed in an embryo transfer tube, and the embryo in the embryo transfer tube was injected from the umbrella into the oviduct on the side with less bleeding during the embryo flushing. A total of 28 puppies were finally born.

[0061] Table 1. Cytoplasmic injection and embryo transfer results

[0062]

[0063] In addition, the present invention also designs an sgRNA sequence for the S4 site for the targeting site of the sequence shown in SEQ ID NO: 1 of exon 3 of the canine Notch3 gene: AGCGCAGGGGCCCGAATGGCAGG (SEQ ID NO: 8), and the complementary sequence of the sgRNA sequence for the S4 site is CCTGCCATTCGGGCCCCTGCGCT (SEQ ID NO: 9). Using the same method as the sgRNA for the above-mentioned S1-S3 sites, an experiment was conducted on the sgRNA for the S4 site. A total of 10 embryo transplants were performed, with 55 transplanted embryos, 10 transplant recipients, and a total of 20 puppies born, and no gene-edited positive dogs were produced. The results of cytoplasmic injection are detailed in Table 2 below. It can be seen from the results of Tables 1 and 2 that the Notch3 gene-edited dogs can be successfully obtained using the method of the present invention.

[0064] Table 2 Comparison results of S4 single-target cytoplasmic injection and embryo transfer

[0065]

[0066]

[0067] After the puppies were born, ear tissue (E) and tail tissue (T) were collected for identification. After the tissue blocks were cut into pieces in a centrifuge tube, proteinase K was added to the centrifuge tube and lysed in a water bath at 56°C for 1-3 hours. Then 700μL of Genomic Lysis Buffer was pipetted and added to the lysis system, mixed evenly by inversion, and centrifuged at 10,000g for 1 minute. The supernatant was pipetted to the purification column, centrifuged at 10,000g for 1 minute at room temperature, and centrifuged for 1 minute. A new collection tube was replaced, 200μL of DNA Pre-Wash Buffer was added to the centrifuge column, centrifuged at 10,000g for 1 minute at room temperature, and the waste liquid was discarded. 400μL of g-DNA Wash Buffer was added to the centrifuge column, centrifuged at 10,000g for 1 minute at room temperature, and the waste liquid was discarded. The purification column and collection tube were centrifuged again at 10,000g for 2 minutes. Replace the purification column into a new 1.5 mL centrifuge tube, add 50 μL of Elution Buffer to elute the DNA, and place at room temperature for 2 minutes. Centrifuge at 12000 rpm for 1 minute to obtain the canine genomic DNA solution.

[0068] PCR and PCR product sequencing were performed using canine genomic DNA as a template, where the genotype identification primer pair was:

[0069] Notch3-Forward Primer: 5'-TTGCATGAATGAACGAGGCGTGT-3' (SEQ ID NO: 10)

[0070] Notch3-reverse primer: 5'-TGGGCTCTTCACACCCTTGC-3' (SEQ ID NO: 11)

[0071] Among them, the PCR identification system is shown in Table 3 below:

[0072] Table 3

[0073]

[0074]

[0075] Figure 2The PCR identification results of newborn puppies numbered 210579 to 210591 are shown. The PCR products were further purified and recovered by gel excision, connected to the T vector and transformed into Escherichia coli. 15 colonies were selected from each plate for sequencing. The sequencing results were compared with the wild-type sequence to determine the mutation type of the Notch3 gene.

[0076] The wild-type nucleic acid sequence of the Notch3 gene exon 3 contains the sequence shown in SEQ ID NO: 12, which encodes 2324 amino acids. After sequencing and sequence information comparison, the gene-edited dogs No. 210586 and No. 210588 among the 28 puppies had mutations at the target site of Notch3 gene exon 3. Figure 3 and Figure 4 The Notch3 gene sequencing results of gene-edited dogs No. 210586 and No. 210588 are shown respectively, and the specific mutation information is as follows:

[0077] (1) Two genotypes were detected in the gene-edited dog No. 210586: -102bp (GCTGGAGGACCCCTGCCATTCGGGCCCCTGCGCTGGCCGTGGCGTCTGCCAGAGTTCCGTGGTGGCAGGCGCCGCCCGCTTCTCCTGCCGGTGCCCCCGTGG) deletion and 3bp (TCC) insertion and wild type, that is, the individual is a -102+3 / wt heterozygote, the mutated nucleic acid sequence contains the sequence shown in SEQ ID NO: 13, and the mutated amino acid sequence contains the sequence shown in SEQ ID NO: 14, encoding 2291 amino acids.

[0078] (2) The gene-edited dog No. 210588 was detected to have three genotypes: -5bp (AGCTG) deletion and 2bp (CA) insertion, -5bp deletion and wild type, that is, the individual was a -5+2 / -5 / wt heterozygote, the mutated nucleic acid sequence contained the sequence shown in SEQ ID NO: 15, and the mutated amino acid sequence contained the sequence shown in SEQ ID NO: 16, encoding 155 amino acids.

[0079] 4. Phenotypic verification of Notch3 gene-edited dogs

[0080] The Notch3 gene-edited dogs obtained above were subjected to brain MRI experiments. The brain MRI results of gene-edited dog No. 210586 are as follows: Figure 5 As shown, the results showed that the bilateral ventricles of the gene-edited dog No. 210586 were asymmetric, the white matter was atrophied, and there was a high signal in the white matter around the right ventricle, which further verified that the Notch3 gene-edited CADASIL disease model dog was obtained in the present invention.

[0081] The gene-edited canine somatic cells numbered 210586 were classified and named Notch3 gene knockout positive cell line, and deposited in the General Microbiology Center of China Culture Collection (CGMCC), the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing (postal code 100101), the deposit number is CGMCC No.45181, and the deposit date is June 9, 2022.

[0082] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A method for establishing a canine model of cerebral autosomal dominant arteriopathy with subcortical infarction and leukoencephalopathy (CADASIL), the method comprising the following steps: (1) Determine the target site based on the sequence of exon 3 of the canine Notch3 gene sequence; (2) Synthesizing the sgRNA sequence according to the targeting site determined in step (1), and then connecting the synthesized sequence with the backbone vector to construct the sgRNA targeting vector; (3) Obtaining in vitro transcription products of sgRNA and CRISPR / Cas9 respectively through in vitro transcription; (4) introducing the sgRNA obtained in step (3) and the in vitro transcription product of CRISPR / Cas9 into canine fertilized eggs or canine somatic cells to obtain canine fertilized eggs or canine somatic cells with Notch3 gene knockout; The method further comprises: The obtained Notch3 gene knockout canine fertilized eggs are transplanted into the fallopian tube of a recipient female dog, thereby preparing a CADASIL disease model dog; or the obtained Notch3 gene knockout canine somatic cell nuclei are transplanted into canine enucleated oocytes, and then the canine enucleated oocytes after nuclear transplantation are transplanted into the fallopian tube of a recipient female dog, thereby preparing a CADASIL disease model dog; Wherein, in step (1), the sgRNA sequence of the targeting site and its complementary sequence are the following sequences: S1 site: CGTCTGCCAGAGTTCCGTGGTGG (SEQ ID NO: 2), complementary sequence is CCACCACGGAACTCTGGCAGACG (SEQ ID NO: 3); S2 site: TCCCTTACCTCGGAAGCCACGGG (SEQ ID NO: 4), complementary sequence is CCCGTGGCTTCCGAGGTAAGGGA (SEQ ID NO: 5); S3 site: AATGGCAGGGGTCCTCCAGCTGG (SEQ ID NO: 6), complementary sequence is CCAGCTGGAGGACCCCTGCCATT (SEQ ID NO: 7).

2. The method according to claim 1, characterized in that The canine somatic cells are derived from the following tissues or organs: fetal tissue, skin, muscle, ear, mammary gland, fallopian tube, ovary, blood, urine, fat, bone marrow, blood vessel and luminal endothelium.

3. A targeting vector for canine Notch3 gene knockout, the targeting vector comprising an sgRNA sequence designed for a targeting site sequence in exon 3 of the canine Notch3 gene and a backbone vector, in, The sgRNA and its complementary sequence are the following sequences: S1 site: CGTCTGCCAGAGTTCCGTGGTGG (SEQ ID NO: 2), complementary sequence is CCACCACGGAACTCTGGCAGACG (SEQ ID NO: 3); S2 site: TCCCTTACCTCGGAAGCCACGGG (SEQ ID NO: 4), complementary sequence is CCCGTGGCTTCCGAGGTAAGGGA (SEQ ID NO: 5); S3 site: AATGGCAGGGGTCCTCCAGCTGG (SEQ ID NO: 6), complementary sequence is CCAGCTGGAGGACCCCTGCCATT (SEQ ID NO: 7).

4. Canine somatic cells, tissues or organs of a CADASIL disease model dog obtained by the method of claim 1 or 2.

5. The canine somatic cell, tissue or organ according to claim 4, characterized in that: The canine somatic cell, tissue or organ comprises the sequence shown in SEQ ID NO: 13 and / or SEQ ID NO:

15.

6. The canine somatic cell, tissue or organ according to claim 5, characterized in that: The classification of the somatic cells is named Notch3 gene knockout positive cell strain, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC) with the deposit number CGMCC No. 45181 and the deposit date June 9, 2022.

Images