A crisper-cas12a sensing system based on double aptamer and gold nanoparticles and application thereof
The CRISPR-cas12a sensing system based on dual aptamers and gold nanoparticles loaded with molecular beacons has improved the sensitivity and selectivity of adenosine detection, achieving high-precision detection of adenosine. This addresses the shortcomings of existing CRISPR-cas12a sensing systems in adenosine detection and expands its application scope.
Patent Information
- Application Number
- CN202211472143.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-23
- Publication Date
- 2025-12-23
- Estimated Expiration
- 2042-11-23
AI Technical Summary
The existing CRISPR-cas12a sensing system has insufficient sensitivity and low detection efficiency in adenosine detection, making it difficult to meet the needs of rapid and sensitive biomedical research.
A CRISPR-cas12a sensing system based on dual aptamers and gold nanoparticles loaded with molecular beacons was adopted. By loading molecular beacons onto gold nanoparticles, the cleavage efficiency of cas12a was enhanced, and the CRISPR-cas12a system was used to identify non-nucleic acid substances, especially the complementary strands of adenosine aptamers.
The sensitivity and selectivity of the sensing system have been improved, enabling high-precision detection of adenosine and broadening the application range of the CRISPR-cas12a system. It has the advantages of good selectivity, high sensitivity, low detection limit, and wide detection range, and is suitable for the detection of adenosine content in serum.
Smart Images

Figure CN115820810B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a biosensing system, in particular to a CRISPR-cas12a sensing system based on double aptamer and gold nanoparticles, and also relates to the application thereof, and belongs to the technical field of biosensing. BACKGROUND
[0002] As a purine nucleoside, adenosine plays a huge role in regulating tumor growth, and is a reaction factor that can be produced by immune cells when fighting tumor cells. It has been reported that the concentration of adenosine in the microenvironment of tumor cells is 10 to 20 times higher than that in the microenvironment of healthy people. The enzyme on the surface of the cell cleaves adenosine triphosphate (ATP) to produce adenosine and release it outside the cell. Adenosine has been shown to accumulate and overexpress in specific areas of tumor cells under hypoxic or stress conditions. There are many studies on the anti-tumor effect of adenosine, which confirms that inhibiting the overexpression of adenosine can effectively inhibit tumor growth and spread. Therefore, as a potential tumor marker, rapid and sensitive detection is of great significance to biomedical research.
[0003] The traditional CRISPR-cas12a system uses straight-chain ssDNA as a reporter, but its slow cutting speed limits its application. Molecular beacons are more easily cut by activated cas12a due to their protrusions, achieving more sensitive and rapid detection. Molecular beacon technology has a wide range of applications in biological research due to its simple operation, high sensitivity, strong specificity, real-time quantitative determination of nucleic acids, and even in vivo analysis. However, the sensitivity, accuracy, and detection efficiency of the current CRISPR-cas12a sensing system still need to be improved in terms of adenosine detection. SUMMARY
[0004] In view of the defects of the existing CRISPR-cas12a sensing system, such as low detection efficiency and insufficient sensitivity, the present application aims to provide a CRISPR-cas12a sensing system based on double aptamer and gold nanoparticles loaded with molecular beacons. This system can improve the cutting efficiency of cas12a, increase the sensitivity of the sensing system, and realize the detection of non-nucleic acid substances by the CRISPIR-cas12a system, thereby expanding its application range.
[0005] Another object of the present application is to provide an application of the CRISPR-cas12a sensing system based on double aptamer and gold nanoparticles loaded with molecular beacons. This sensing system is for non-diagnostic treatment purposes and is only used for routine adenosine content determination. When applied to adenosine detection, this sensing system has the advantages of good selectivity, high sensitivity, low detection limit, and wide detection range, and can accurately detect the content of adenosine in the sample to be tested.
[0006] To achieve the above technical purposes, the application provides a CRISPR-cas12a sensing system based on double aptamer and gold nanoparticles loaded with molecular beacon, which comprises a cas12a / g-RNA complex, double aptamer and gold nanoparticles loaded with molecular beacon.
[0007] The CRISPR-cas12a system based on double aptamer and gold nanoparticles loaded with molecular beacon of the application contains aptamer and its complementary strand, when the target detection object exists, the aptamer is structurally converted to make the aptamer complementary strand free, the free aptamer complementary strand is recognized by the CRISPR-cas12a system, the trans-cleavage ability of the CRISPR-cas12a is activated, the molecular beacon loaded on the gold nanoparticles is cut off, and the fluorescence of the molecular beacon is restored. The protrusion at the front end of the molecular beacon is beneficial to the cutting of the cas12a, the molecular beacon is connected to the gold nanoparticles, the fluorescence of the molecular beacon can be effectively quenched by the gold nanoparticles, the concentration of the molecular beacon in a unit volume can be increased, and the cutting efficiency of the cas12a is further improved. The gold nanoparticles loaded with the molecular beacon can increase the concentration of the reporter in a unit concentration, and realize the rapid and sensitive detection of the target object by the CRISPR-cas12a system. The application converts the process of recognizing non-nucleic acid substances by the CRISPIR-cas12a system into the process of recognizing the complementary strand of the adenosine aptamer by the CRISPIR-cas12a system, and realizes the detection of non-nucleic acid substances by the CRISPIR-cas12a system.
[0008] As a preferred scheme, the double aptamer is an adenosine aptamer and its complementary strand.
[0009] As a preferred scheme, the maximum emission wavelength of the FAM fluorescent light emitting group contained in the molecular beacon is 528 nm.
[0010] As a preferred scheme, the 3' end of the molecular beacon is connected with the FAM light emitting group.
[0011] As a preferred scheme, the maximum absorption wavelength of the gold nanoparticles is 520 nm, and the diameter is 13-16 nm.
[0012] As a preferred scheme, the diameter of the gold nanoparticles loaded with the molecular beacon is 32-35 nm.
[0013] As a preferred scheme, the molecular beacon is connected with the gold nanoparticles through the thiol group at the 5' end.
[0014] As a preferred scheme, the cas12a / g-RNA complex is obtained by mixing and incubating cas12a and g-RNA.
[0015] As a preferred scheme, the cas12a and g-RNA mixed incubation process is: mixing cas12a and g-RNA and reacting at a water bath temperature of 25-40℃ for 30-60 min.
[0016] As a preferred scheme, the molar ratio of cas12a to g-RNA is 1:1.25-5.
[0017] Controlling the molar ratio of cas12a to g-RNA in a suitable range is beneficial to improve the detection efficiency of the sensing system. When the molar ratio of cas12a to g-RNA is too large, the amount of g-RNA is insufficient to fully activate the trans-cleavage activity of cas12a; when the molar ratio of cas12a to g-RNA is too small, the excess g-RNA will produce a certain background interference to the cleavage of cas12a.
[0018] As a preferred scheme, cas12a and g-RNA are both configured as solutions and mixed in equal volumes.
[0019] As a preferred scheme, the double adaptors are obtained by mixed incubation of adaptors and their complementary strands.
[0020] As a preferred scheme, the adaptor and its complementary strand mixed incubation process is: mixing the adaptor and its complementary strand and reacting at a water bath temperature of 90-100℃ for 5-10 min, and then cooling to room temperature within 2-4 h.
[0021] As a preferred scheme, the molar ratio of the adaptor to its complementary strand is 2-4:1.
[0022] Controlling the molar ratio of the adaptor to its complementary strand in a reasonable range can obtain a sensing system with excellent performance. If the molar ratio of the adaptor to its complementary strand is too large, the unpaired adaptor will interfere with the cleavage function of cas12a, affecting its cleavage efficiency; if the molar ratio of the adaptor to its complementary strand is too small, the unpaired adaptor complementary strand will produce a certain background interference to the cleavage of cas12a.
[0023] As a preferred scheme, the adaptor and its complementary strand are both configured as solutions and mixed in equal volumes.
[0024] As a preferred scheme, the gold nanoparticles loaded with molecular beacons are obtained by mixed reaction of gold nanoparticles and organic phosphine solution containing molecular beacons.
[0025] As a preferred scheme, the preparation process of the gold nanoparticles is: heating the chloroauric acid solution to boiling, then quickly adding the sodium citrate solution, heating the obtained mixture to reflux, and then cooling to room temperature to obtain a gold nanoparticle-containing solution.
[0026] As a preferred scheme, the mixing reaction process of the gold nanoparticles and the organic phosphine solution containing the molecular beacon is that the gold nanoparticles are mixed with the organic phosphine solution containing the molecular beacon and are frozen overnight at a temperature of-20 to-40℃.
[0027] As a preferred scheme, the organic phosphine in the organic phosphine solution is tris(2-carboxyethyl) phosphine.
[0028] As a preferred scheme, the molar concentration of the organic phosphine solution is 5-10 mM.
[0029] As a preferred scheme, the molecular beacon is configured as a molecular beacon solution, and the molar concentration of the molecular beacon is 100-300 μM.
[0030] As a preferred scheme, the volume ratio of the molecular beacon solution to the organic phosphine solution is 1:1-5.
[0031] As a preferred scheme, the molar ratio of the gold nanoparticles to the molecular beacon is 25-200:1.
[0032] Controlling the molar ratio of the gold nanoparticles to the molecular beacon in a suitable range is beneficial to obtaining a sensing system with excellent performance. If the molar ratio of the gold nanoparticles to the molecular beacon is too large, the density of the molecular beacon on the surface of the gold nanoparticles is too small, and thus the cutting efficiency of cas12a is relatively reduced. If the molar ratio of the gold nanoparticles to the molecular beacon is too small, the molecular beacon on the surface of the gold nanoparticles is too dense, and the steric hindrance is increased, which affects the cutting of cas12a to a certain extent.
[0033] The application further provides an application of the CRISPR-cas12a sensing system based on the double aptamer and the gold nanoparticle loaded with the molecular beacon, which is applied to adenosine detection. The sensing system is used for detecting adenosine, and has the advantages of good selectivity, high sensitivity, low detection limit and wide detection range, etc. The linear range of the adenosine detection is 0.5-150 μM, the lower limit of detection is 15.67 nM, and the content of adenosine in serum can be detected with high precision.
[0034] As a preferred scheme, the adenosine detection step comprises:
[0035] 1) After the CRISPR-cas12a sensing system is reacted with a series of standard adenosine solutions with different concentrations, respectively, fluorescence is determined to obtain a series of fluorescence spectrum graphs, and the standard curve is drawn with the fluorescence intensity value at 528 nm in each fluorescence spectrum graph as the vertical coordinate and the standard adenosine concentration as the horizontal coordinate.
[0036] 2) The sample to be tested containing adenosine is reacted and measured according to step 1), to obtain the corresponding fluorescence intensity value, and the content of adenosine in the sample to be tested is calculated according to the standard curve.
[0037] The sensing system does not emit obvious fluorescence at 528 nm under 488 nm excitation due to the quenching effect of gold nanoparticles on FAM. In the presence of adenosine, the CRISPR-cas12a system emits strong fluorescence at 528 nm, that is, the sensing system can realize the release of the complementary strand of the aptamer under the action of adenosine, and the fluorescence of the molecular beacon is restored under the cutting action of the CRISPR-cas12a system.
[0038] As a preferred scheme, the reaction process in step 1) is as follows: the standard adenosine solution is added to the double aptamer for incubation, mixed with the cas12a / g-RNA complex, and then the gold nanoparticles loaded with the molecular beacon are added for mixing reaction.
[0039] Compared with the prior art, the present application has the following beneficial effects:
[0040] (1) The sensing system of the present application increases the concentration of the reporter in unit concentration by loading the molecular beacon on the gold nanoparticles, significantly improves the cutting efficiency of cas12a, and improves the sensitivity of the sensing system. At the same time, the process of recognizing non-nucleic acid substances by the CRISPIR-cas12a system is successfully converted into the process of recognizing the complementary strand of the aptamer by the CRISPIR-cas12a system, realizing the detection of non-nucleic acid substances by the CRISPIR-cas12a system, and expanding its application range;
[0041] (2) When the sensing system is applied to adenosine detection, it has the advantages of good selectivity, high sensitivity, low detection limit and wide detection range, and can detect the content of adenosine in serum with high precision;
[0042] (3) The preparation method of the sensing system is simple, low in cost and easy to operate, which is conducive to the expansion of production and application. BRIEF DESCRIPTION OF DRAWINGS
[0043] Figure 1 The figure is a schematic diagram of the preparation of the CRISPR-cas12a system based on double aptamer and gold nanoparticles loaded with molecular beacon of the present application and the detection of adenosine content in serum.
[0044] Figure 2 The figure is an agarose gel electrophoresis diagram of the response of the gold nanoparticle CRISPR-cas12a system based on double aptamer and loaded molecular beacon to adenosine.
[0045] Figure 3The fluorescence spectrum diagram of the CRISPR-cas12a system based on the dual aptamer and the gold nanoparticle loaded molecular beacon in Example 1 for detecting different concentrations of adenosine, wherein A is a maximum fluorescence value diagram of different concentrations of adenosine in the CRISPR-cas12a system based on the dual aptamer and the gold nanoparticle loaded molecular beacon; B is a standard regression curve diagram of adenosine concentration-maximum fluorescence value; C is a maximum fluorescence value diagram of different biomolecules and adenosine in the CRISPR-cas12a system based on the dual aptamer and the gold nanoparticle loaded molecular beacon.
[0046] Figure 4 All DNA and RNA base sequences used in the present application. DETAILED DESCRIPTION
[0047] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present application is not limited to the following specific embodiments.
[0048] Unless otherwise defined, all professional terms used herein have the same meaning as generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present application.
[0049] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by existing methods.
[0050] Example 1
[0051] An example of the application of the CRISPR-cas12a system based on the dual aptamer and the gold nanoparticle loaded molecular beacon in the present application is to use the sensing system for adenosine content detection, and the synthesis principle diagram of the sensing system is shown in Figure 1 .
[0052] 1) Mix 40 μL of 1 μM cas12a solution with 40 μL of 1.25 μM g-RNA solution, and react in a 37°C water bath for 30 minutes to obtain a cas12a / g-RNA mixture;
[0053] 2) Mix 15 μL of 100 μM adenosine aptamer solution and 15 μL of 25 μM aptamer complementary strand solution in 481.25 μL of NE buffer 2.1, react in a 95°C water bath for 5 minutes, and slowly cool to room temperature for 4 hours to obtain a dual aptamer;
[0054] 3) Take 1 mL of HAuCl4.4H2O (10 mg / mL), add 99 mL of deionized water, heat and stir to boiling, then quickly add 2 mL of 2% (w / V) sodium citrate solution, the solution immediately turns black, then slowly turns purple red, then heat the mixture to reflux for 15 minutes, then cool to room temperature to obtain a gold nanoparticle solution, which is stored in the refrigerator at 4℃ for standby;
[0055] 4) Take 3 μL of 100 μM molecular beacon aqueous solution, add 1 μL of 20 mM tris(2-carboxyethyl)phosphine solution, mix well and stand at room temperature for 1 hour, then add 100 μL of the above gold nanoparticle solution, then freeze in the refrigerator at -20℃ overnight, centrifuge the molecular beacon loaded gold nanoparticles at 12000 rpm for 3 times, then re-disperse in deionized water to obtain a gold nanoparticle solution loaded with molecular beacon;
[0056] 5) Different concentrations of standard adenosine (0.5, 1, 2, 5, 10, 20, 50, 75, 100 μM) solution is added to the double adapter in a 37℃ water bath for 60 minutes, then 20 μL of double adapter containing adenosine is added to 20 μL of CRISPR-cas12a / g-RNA, mixed well, then 10 μL of gold nanoparticle solution loaded with molecular beacon is added, and the reaction is carried out at room temperature for 10 minutes, and fluorescence detection is carried out under excitation light at 488 nm;
[0057] 6) The fluorescence method is used for determination, and the fluorescence spectrum of different concentrations of standard adenosine is obtained; the ratio of the fluorescence intensity at 528 nm in each fluorescence spectrum is taken as the vertical coordinate, and the standard adenosine concentration is taken as the horizontal coordinate to draw a standard curve.
[0058] Example 2
[0059] The application is based on an example of the application of the CRISPR-cas12a system based on double adapter and gold nanoparticles loaded with molecular beacon, and the sensing system is used for detecting the content of adenosine in serum.
[0060] 1) Mix 40 μL of 1 μM cas12a solution with 40 μL of 1.25 μM g-RNA solution, and react in a 37℃ water bath for 30 minutes to obtain a cas12a / g-RNA mixture;
[0061] 2) Mix 15 μL of 100 μM adenosine adapter solution and 3.75 μL of 100 μM adapter complementary chain solution in 481.25 μL of NE buffer 2.1, react in a 95℃ water bath for 5 minutes, and slowly cool to room temperature for 4 hours to obtain a double adapter;
[0062] 3) Take 1 mL of HAuCl4·4H2O (10 mg / mL), add 99 mL of deionized water. Heat and stir to boiling. Then quickly add 2 mL of 2% (w / V) sodium citrate solution, the solution immediately turns black, then slowly turns purple red, the mixture is heated to reflux for 15 minutes, then cooled to room temperature to obtain a gold nanoparticle solution, stored in the refrigerator at 4°C for standby;
[0063] 4) Take 3 μL of 100 μM aqueous solution of molecular beacon, add 1 μL of 20 mM tris(2-carboxyethyl)phosphine solution, mix well and stand at room temperature for 1 hour, then add 100 μL of the above gold nanoparticle solution, then put it in the refrigerator at -20°C overnight, centrifuge the molecular beacon-loaded gold nanoparticles at 12000 rpm for 3 times, then re-disperse them in deionized water to obtain a solution of molecular beacon-loaded gold nanoparticles;
[0064] 5) After diluting the serum sample ten times with NE buffer 2.1, add it to the double aptamer solution, incubate at 37°C water bath for 30 minutes, add the CRISPR-cas12 system containing molecular beacon-loaded gold nanoparticles, and detect the fluorescence under 488 nm excitation wave. The peak value at 528 nm is brought into the standard curve to calculate the content of adenosine in the serum.
[0065] As can be seen from Figure 1 , the preparation process of the CRISPR-cas12a system based on double aptamer and molecular beacon-loaded gold nanoparticles is relatively simple. After the molecular beacon is connected to the gold nanoparticles, the fluorescence of the molecular beacon is quenched by the gold nanoparticles because the maximum absorption of the gold nanoparticles matches the maximum emission spectrum of the FAM group on the molecular beacon. When adenosine is present, the adenosine aptamer in the double aptamer recognizes adenosine and undergoes structural conversion, freeing the aptamer complementary strand. The g-RNA in the CRISPR-cas12a system recognizes the aptamer complementary strand, which activates the transcleavage ability of cas12a. Cas12a cuts the molecular beacon loaded on the gold nanoparticles through non-specific cleavage, restores the fluorescence of the FAM group on the molecular beacon, and thus realizes the fluorescence detection of adenosine.
[0066] As can be seen from Figure 2 , when the adenosine aptamer complementary strand exists (either alone or free after the adenosine aptamer in the double aptamer recognizes adenosine), it can activate the transcleavage function of cas12a in the CRISPR-cas12a system, cut the molecular beacon loaded on the gold nanoparticles, and produce new DNA bands, which confirms that this sensing system has good recognition function for adenosine.
[0067] As can be seen from Figure 3As can be seen, the CRISPR-cas12a system based on dual aptamer and gold nanoparticles loaded with molecular beacon has good response performance to adenosine, and the probe can produce obvious fluorescence at 528 nm. The linear range of the sensing system for adenosine detection is 0.5-150 μM, and the detection lower limit is 15.67 nM. It can be seen that the sensing system has good linear range and selectivity for adenosine detection.
Claims
1. A CRISPR-cas12a sensing system based on dual aptamer and gold nanoparticle loaded molecular beacon, characterized in that: The gold nanoparticles comprise a cas12a / g-RNA complex, a double aptamer and a molecular beacon loaded gold nanoparticle; The double aptamer is an adenosine aptamer and its complementary strand; The maximum emission wavelength of the FAM fluorescent emitting group in the molecular beacon is 528nm; The maximum absorption wavelength of the gold nanoparticles is 520nm, and the diameter is 13-16nm; The cas12a / g-RNA complex is obtained by mixing and incubating cas12a and g-RNA; The double aptamer is obtained by mixing and incubating the aptamer and its complementary strand; The gold nanoparticles loaded with the molecular beacon are obtained by mixing and reacting gold nanoparticles with a solution of tris(2-carboxyethyl)phosphine containing the molecular beacon; The base sequence of the adenosine aptamer is 5'-ACCTGGGGGAGTATTGCGGAGGAAGGTCAAGGTTTG-3'; The base sequence of the adenosine aptamer complementary strand is 5'GTGTGTTTACCTGGGTATTCCCAGGTAAACACACAAACCTTGACCTTCC-3'; The base sequence of the g-RNA is 5'-UAAUUUCUACUAAGUGUAGAUAAGGUUUGUGUGUUUACCUG-3'; The base sequence of the molecular beacon is 5'SH-TTTTTTTTTTGATCATACTTTATTTGTATGATC-FAM3'.
2. The CRISPR-cas12a sensing system based on dual aptamer and loaded molecular beacon gold nanoparticles according to claim 1, characterized in that: The molar ratio of the cas12a to the g-RNA is 1:1.25-5. 3.The CRISPR-cas12a sensing system based on dual aptamer and loaded-molecular beacon gold nanoparticles according to claim 1, wherein: The molar ratio of the aptamer to its complementary strand is 2-4:1.