Application of lncRNA DDIT4-AS1 and its diagnostic and therapeutic preparations for breast cancer

By targeting lncRNA DDIT4-AS1, PCR detection reagents and shRNA/siRNA technology, combined with chemotherapy drugs, the shortcomings in breast cancer diagnosis and treatment are solved, and more efficient diagnostic and therapeutic effects are achieved.

CN115820848BActive Publication Date: 2025-08-12THE SECOND XIANGYA HOSPITAL OF CENT SOUTH UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210958176.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-11
Publication Date
2025-08-12
Estimated Expiration
2042-08-11

AI Technical Summary

Technical Problem

The prior art lacks effective biomarkers and therapeutic targets to improve the prognosis of breast cancer patients, and chemotherapy drugs are insufficiently sensitive, resulting in poor treatment effects.

Method used

Targeting lncRNA DDIT4-AS1, breast cancer diagnosis and treatment preparation are prepared by detecting its expression level and using PCR detection reagents or in situ hybridization detection reagents, shRNA and siRNA are designed to interfere with their expression, and combined with chemotherapeutic drugs such as paclitaxel, cisplatin, doxorubicin, etc.

Benefits of technology

It improves the diagnostic accuracy of breast cancer, inhibits the proliferation and migration of cancer cells, enhances the sensitivity to chemotherapy drugs, significantly inhibits the growth of subcutaneous transplanted tumors in nude mice, and enhances the effect of chemotherapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115820848B_ABST
    Figure CN115820848B_ABST
Patent Text Reader

Abstract

This invention discloses applications of the lncRNA DDIT4-AS1 and formulations for the diagnosis and treatment of breast cancer. The authors discovered that silencing the lncRNA DDIT4-AS1 can inhibit the proliferation and migration of breast cancer cells. Furthermore, silencing DDIT4-AS1 enhances the sensitivity of breast cancer cells to the chemotherapy drugs paclitaxel, doxorubicin, and cisplatin. Nude mouse tumorigenesis experiments further demonstrated that inhibiting DDIT4-AS1 expression enhances the anti-cancer effect of paclitaxel. This invention provides novel insights for future drug development, clinical diagnosis, and treatment, and holds significant social significance and market potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical field:

[0001] The present invention belongs to the field of biomedicine and relates to the use of lncRNA DDIT4-AS1 in the preparation of breast cancer diagnostic reagents, treatments, and chemotherapy sensitivity-enhancing preparations, as well as corresponding diagnostic and therapeutic preparations. Background technology:

[0002] Worldwide, approximately 1.2 million new cases of breast cancer occur annually, and approximately 400,000 deaths occur annually. The disease is increasing at a rate of 2% to 3% annually. In the United States, breast cancer incidence ranks first among female malignancies, and its mortality rate ranks second among malignant tumors. In China, breast cancer incidence has also jumped to the top among female malignancies, with the age of onset trending younger. Therefore, new biomarkers and therapeutic targets are urgently needed to improve patient outcomes. Over 90% of transcripts in the human genome are non-coding RNAs, which regulate gene expression at various levels. These RNAs not only regulate fundamental biological processes such as growth and development and organ function, but also play a crucial role in human disease, particularly cancer.

[0003] We have discovered for the first time that the lncRNA DDIT4-AS1 is closely associated with breast cancer progression. We further found that silencing DDIT4-AS1 inhibits the proliferation and migration of breast cancer cells. Furthermore, silencing DDIT4-AS1 enhances the sensitivity of breast cancer cells to chemotherapy drugs such as paclitaxel, cisplatin, and doxorubicin. Therefore, targeting lncRNA DDIT4-AS1 may enhance the efficacy of chemotherapy drugs, providing a new strategy and potential drug target for the clinical treatment of breast cancer. Summary of the invention:

[0004] The present invention discovered for the first time that the expression levels of lncRNA DDIT4-AS1 are different between breast cancer and normal breast tissue. It also found that inhibiting the expression of lncRNA DDIT4-AS1 can inhibit breast cancer proliferation, invasion and / or metastasis, indicating that lncRNA DDIT4-AS1 is a potential target for breast cancer diagnosis and treatment.

[0005] The purpose of the present invention can be achieved through the following technical solutions:

[0006] The primary purpose of the present invention is to provide a reagent for detecting the expression level of lncRNA DDIT4-AS1 for use in preparing a breast cancer diagnostic preparation; the lncRNA DDIT4-AS1 sequence is shown in SEQ ID NO.1.

[0007] Furthermore, the reagent for detecting the expression level of lncRNA DDIT4-AS1 includes a PCR detection reagent or an in situ hybridization detection reagent.

[0008] The primer sequence of the PCR detection reagent is further preferably:

[0009] F: CTGCCTACAACAGGTCATAACAAA, as shown in SEQ ID NO. 2;

[0010] R:AGCATGAAACAAAGGCTTAGGG, as shown in SEQ ID NO.3.

[0011] A second object of the present invention is to provide a breast cancer diagnostic kit, comprising a reagent for detecting the expression level of lncRNA DDIT4-AS1, preferably a PCR detection reagent or an in situ hybridization detection reagent; the primer sequence of the PCR detection reagent is (F: CTGCCTACAACAGGTCATAACAAA, R: AGCATGAAACAAAGGCTTAGGG); the lncRNA DDIT4-AS1 sequence is shown in SEQ ID NO.1.

[0012] The third object of the present invention is to provide an agent for inhibiting the expression of lncRNA DDIT4-AS1 for use in preparing a preparation for preventing and / or treating breast cancer; the sequence of the lncRNA DDIT4-AS1 is shown in SEQ ID NO.1.

[0013] Furthermore, the reagent for inhibiting the expression of lncRNA DDIT4-AS1 includes one or more shRNAs and siRNAs designed based on the DDIT4-AS1 gene. The targeting sequences of the shRNAs and siRNAs are preferably as shown in Table 1; also as shown in SEQ ID Nos. 4-11.

[0014] The fourth object of the present invention is to provide a breast cancer prevention and / or treatment preparation, comprising a lncRNA DDIT4-AS1 inhibitor; the lncRNA DDIT4-AS1 sequence is shown in SEQ ID NO.1.

[0015] Furthermore, the lncRNA DDIT4-AS1 inhibitor includes one or more shRNAs and siRNAs designed based on the DDIT4-AS1 gene. The targeting sequences of the shRNAs and siRNAs are shown in Table 1 and also in SEQ ID Nos. 4-11.

[0016] A fifth object of the present invention is to provide a reagent for inhibiting the expression of lncRNA DDIT4-AS1 for use in preparing a preparation for enhancing the sensitivity of breast cancer chemotherapy drugs; the lncRNA DDIT4-AS1 sequence is shown in SEQ ID NO.1.

[0017] Furthermore, the breast cancer chemotherapy drugs include one or more of paclitaxel, cisplatin, cyclophosphamide, 5-fluorouracil, doxorubicin, and mitomycin.

[0018] A sixth objective of the present invention is to provide a formulation for enhancing breast cancer chemotherapy sensitivity, comprising a lncRNA DDIT4-AS1 inhibitor; the lncRNA DDIT4-AS1 sequence is shown in SEQ ID NO. 1. Furthermore, the lncRNA DDIT4-AS1 inhibitor comprises one or more shRNAs or siRNAs designed based on the DDIT4-AS1 gene. The targeting sequences of the shRNAs and siRNAs are shown in Table 1 and are also shown in SEQ ID Nos. 4-11.

[0019] The breast cancer prevention and / or treatment preparation and the breast cancer chemotherapy drug sensitivity enhancement preparation of the present invention are in the form of one or more selected from tablets, capsules, injections, sprays, aerosols, powder sprays, gels, and suppositories.

[0020] The pharmaceutically acceptable carrier added to the above preparation is selected from one or more of fillers, disintegrants, lubricants, binders, colorants, preservatives, flavoring agents, antioxidants, and solvents.

[0021] cDNA sequence information of lncRNA DDIT4-AS1:

[0022] TTGAACATCAAGTGTATTCATGAACAGTGAGTATCTTATCTTCATGTAAACAGTTCTAGATGGAAGACCCAGATGGCACTCCTCCCGGGGAGGGGTTCCAGCCCCCACCCTCTCAGCCCCTCCCCTGCCAGCTCAACTCTGCAGTACACGATGGGGGAAGGCTTAAACGCAGCTGCCAGGTGTAATTTTTCAAGTGTCAAAGATCCCAAGTGATCCCTGACACCCACCCCTTCCTACTCTTACATTCATGCGTCTGTAAGATAGCTGCCTACAACAGGTCATAACAAAAATAATAAGGTACATGCTACACACACATCCAGCTGGAAGCCTTGTTGGCCCCTAAGCCTTTGTTTCATGCTACAGTACTGAGGGGTATGTGTCCCCAATGCACAGCCACCCGCACACAACTCAATGAGCTTCCTGGGAAACACTATTCCCCCACCTCCACCTTAGGTGGCTGCCTCAGTTTTCCAACCACAGGAATCAGTCCCTCAGCTCCTGCCTCTAGTCTCCACCCCAAAAGTTCAGTCGTCTCTGTCTTGGAGGGCACTGTCGGCCCCCTCAGGTTGAAGTTCAACACTCCTCAATGAGCAGCTGTTCCGAGCTGTACAGCTTCTTCTTGATGACTCGGAAGCCAGTGCTCAGCGTCAGGGACTGGCTGAAGCCAGGGAGGAAGGGAGAGTTGGCGGAGCTAAACAGCCCCTGGATCTTGGGCCAGAGTCGTGAGTCCAGGCGCAGCACGAGGGTCAGCTGGAAGGTGGGCACCAGGCTGGGGTCGAGTGCCAGCTGGCCCACGCTGTGGCAGCTCTTGCCCTGCTCCACGCAGACGTCCAGCAGCGCCCCCCGC

[0023] Table 1 Target sequences of shRNA and siRNA

[0024]

[0025]

[0026] Beneficial effects of the present invention:

[0027] The present invention found that lncRNA DDIT4-AS1 is highly expressed in breast cancer tissues and breast cancer cells, and is less expressed in breast cancer adjacent tissues and normal breast epithelial cells ( Figure 1 ), which can be used as a basis for breast cancer diagnosis. Interfering with the expression of lncRNADDIT4-AS1 can inhibit the proliferation and migration of breast cancer cells ( Figure 2-3 ); Interfering with the expression of lncRNA DDIT4-AS1 can enhance the sensitivity of breast cancer cells to chemotherapy drugs such as paclitaxel, cisplatin, and doxorubicin in a dose-dependent manner ( Figure 4 ). Silencing lncRNA DDIT4-AS1 alone can inhibit the growth of subcutaneous xenograft tumors in nude mice, and silencing DDIT4-AS1 further enhances the anti-tumor effect of paclitaxel in vivo ( Figure 5 ). Therefore, substances that inhibit DDIT4-AS1 expression or expression vectors that interfere with DDIT4-AS1 can be used in the preparation of drugs that inhibit breast cancer proliferation, invasion and / or metastasis, or enhance chemotherapy sensitivity. Description of the drawings:

[0028] Figure 1 Schematic diagram of the expression level of lncRNA DDIT4-AS1 in breast cancer and adjacent tissues, breast cancer cells and normal breast epithelial cells MCF10A.

[0029] Figure 2 Schematic diagram of the effect of silencing lncRNA DDIT4-AS on breast cancer cell proliferation.

[0030] Figure 3 Schematic diagram of the effect of silencing lncRNA DDIT4-AS on breast cancer cell migration.

[0031] Figure 4 Schematic diagram of how silencing lncRNA DDIT4-AS affects the sensitivity of breast cancer cells to chemotherapy drugs.

[0032] Figure 5 This is a diagram showing the results of the nude mouse tumor formation experiment of the present invention. Specific implementation method:

[0033] Example 1 Study on the expression level of LncRNA DDIT4-AS1 in breast cancer tissues and breast cancer cells

[0034] The BT549, MCF-7, MDA-MB-453, and 4T1 cell lines of the present invention were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, and the MDA-MB-231, MCF10A, T47D, and SKBR3 cell lines were from the Kunming Institute of Zoology of the Chinese Academy of Sciences.

[0035] Breast cancer tissue and adjacent adjacent tissue were collected from 69 patients undergoing surgical resection of breast cancer (69 patients were diagnosed with breast cancer and underwent mastectomy at the Department of Breast Surgery, Xiangya Second Hospital). Informed consent was obtained from the patients. Tissue samples were immediately frozen in liquid nitrogen after ex vivo removal. Breast cancer cells and MCF10A mammary epithelial cells were seeded in six-well plates and collected when the cells reached 90%-100% confluence. Total RNA was extracted from the tissues or cells using TRIzol and reverse transcribed. The expression of the lncRNA DDIT4-AS1 was detected by qPCR (primers F: CTGCCTACAACAGGTCATAACAAA, R: AGCATGAAACAAAGGCTTAGGG), using β-actin as an internal control (primer sequences F: ACCCTGAAGTACCCCATCGAG, SEQ ID No. 13, R: AGCACAGCCTGGATAGCAAC, SEQ ID No. 14). Figure 1 a shows that in breast cancer patient samples, the expression level of lncRNA DDIT4-AS1 in cancer tissues was higher than that in adjacent tissues, and the difference was statistically significant. Figure 1 b shows that compared with MCF10A, DDIT4-AS1 is expressed at higher levels in multiple breast cancer cell lines, especially in human MDA-MB-231, BT549 cells and mouse 4T1 cells.

[0036] Example 2 Silencing lncRNA DDIT4-AS1 inhibits breast cancer cell proliferation

[0037] Two shRNAs and shNT lentiviral controls were designed and constructed for the mRNA sequence of Human lncRNA DDIT4-AS1 (the target sequences are shown in Table 1). The tool vector carrying the target sequence and the viral packaging helper plasmid were co-transfected into 293T cells. The virus was harvested 48-72 hours after transfection, and then concentrated, purified, and quality tested. Using the auxiliary transfection reagent polybrene, the qualified packaged virus was transfected into MDA-MB-231 and BT549 cells. After 24 hours, the culture medium was replaced with normal medium, and puromycin was used to select and establish a cell line with stable DDIT4-AS1 silencing. qPCR verified the effectiveness and specificity of the shRNA. The results are shown in Figure 2. Figure 2 As shown in a, both shRNAs can significantly inhibit the expression level of DDIT4-AS1 in cells.

[0038] Subsequently, CCK8, cell counting and plate clone formation experiments were performed using MDA-MB-231 and BT549 stable cell lines. The results showed that silencing DDIT4-AS1 reduced the proliferation ability of MDA-MB-231 cells ( Figure 2 bd), the difference was statistically significant.

[0039] Example 3 Silencing lncRNA DDIT4-AS1 inhibits breast cancer cell migration

[0040] Furthermore, control shRNA and shDDIT4-AS1-1 and shDDIT4-AS1-2 were transfected into human triple-negative breast cancer cells MDA-MB-231 and BT549, respectively, and the migration ability of breast cancer cells was detected by scratch test and Transwell assay. The results are shown in Figure 2. Figure 3 As shown in the results, after silencing DDIT4-AS1, the migration ability of MDA-MB-231 and BT549 cells was significantly reduced, and the difference was statistically significant.

[0041] Example 4 Silencing lncRNA DDIT4-AS enhances the sensitivity of breast cancer cells to chemotherapy drugs

[0042] MDA-MB-231 cells were transfected with control shRNA and shDDIT4-AS1-1 / 2, seeded in 96-well plates at 3000 cells / well, and treated with paclitaxel (PTX), cisplatin (DDP), or doxorubicin (DOX) at varying concentrations for 48 h. Cell viability was detected by CCK8. Figure 4 The results showed that silencing DDIT4-AS1 could enhance the sensitivity of breast cancer cells to paclitaxel, cisplatin, and doxorubicin, respectively.

[0043] Example 5 Silencing DDIT4-AS1 enhances the inhibitory ability of paclitaxel on breast cancer cell tumorigenesis in nude mice

[0044] To further determine the effect of lncRNA DDIT4-AS1 on breast cancer growth and sensitivity to paclitaxel, a control group and breast cancer cells MDA-MB-231 with stable DDIT4-AS1 silencing were subcutaneously inoculated into nude mice to establish a nude mouse xenograft tumor model. The effect of paclitaxel treatment (10 mg / kg, intraperitoneal injection once every three days) on tumor growth was then observed. After the start of administration, tumor volume and mouse body weight were measured and recorded every two days between the different groups, and the in vivo tumor growth curve was plotted ( Figure 5 b) and weight change curve ( Figure 5 c); On day 12, the mice were anesthetized, and the tumors were removed, photographed, and weighed ( Figure 5a); Tumor tissue was cut into pieces and fixed with paraformaldehyde, and then immunohistochemical analysis of Ki67, a tumor proliferation marker, was performed ( Figure 5 d). In summary, silencing DDIT4-AS1 significantly inhibited breast cancer growth, and silencing DDIT4-AS1 could further significantly enhance the sensitivity of breast cancer to paclitaxel.

Claims

1. Use of a reagent for detecting the expression level of lncRNA DDIT4-AS1 in preparing a breast cancer diagnostic preparation; the lncRNA DDIT4-AS1 sequence is shown in SEQ ID NO. 1; the breast cancer is triple-negative breast cancer.

2. The use according to claim 1, characterized in that The reagent for detecting the expression level of lncRNA DDIT4-AS1 is a PCR detection reagent or an in situ hybridization detection reagent.