A transposon polymorphic molecular marker LTR / Gypsy determining duck white feather traits and its identification method
Detection of the transposon polymorphic molecular marker LTR/Gypsy in the duck MITF gene through allelic-specific PCR technology has solved the problem of low efficiency and high cost of existing long-fragment PCR amplification methods, and achieved rapid, low-cost and accurate detection of white feather traits, which has important applications in the breeding industry.
Patent Information
- Application Number
- CN202211272204.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-18
- Publication Date
- 2025-05-23
- Estimated Expiration
- 2042-10-18
AI Technical Summary
The existing long-fragment PCR amplification method is used to detect that when transposons are inserted into polymorphic molecular markers, the amplification time is long, the efficiency is low, and the cost is high, making it difficult to meet the fast and low-cost detection needs.
Allelic-specific PCR technology is used to design specific allelic-specific primers to detect the transposon polymorphic molecular marker LTR/Gypsy in the duck MITF gene, and the genotype is judged through electrophoresis detection and analysis.
It has achieved rapid, low-cost and accurate detection of duck white feather traits, and can screen out meat ducks with white feather traits in the early stage, which is of great significance to the breeding industry.
Smart Images
Figure CN115820874B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of molecular biology, and in particular relates to a transposon polymorphic molecular marker LTR / Gypsy for determining duck white feather traits and an identification method. Background Art
[0002] my country is one of the world's largest waterfowl producers, with rich genetic resources and different germplasm characteristics. The feather colors of local ducks in my country are diverse, and feather pigmentation can affect consumer behavior. White feather traits can often obtain higher returns in the meat duck consumer market. Therefore, screening out white feather traits is of great significance for my country's meat duck farming industry.
[0003] The MITF gene, whose full name is microphthalmia transcription factor, is considered to be a key regulatory gene in the development of melanocytes. It plays an important role in the development, proliferation and survival of melanocytes, as well as in regulating the expression of related enzymes and melanosome proteins to ensure the production of melanin. In recent years, a study has compared the whole genome sequences of Beijing ducks, domestic ducks and wild ducks and found that a unique insertion fragment of about 6.6kb between exon 1M and the second exon of the Beijing duck MITF gene may be the key to silencing the expression of the Beijing duck MITF-M transcript.
[0004] Transposon insertion polymorphism (TIP) reveals different allele states at a site (i.e., transposon insertion and deletion), producing co-dominant markers. This marker can detect the presence or absence of transposon insertion at a specific site. It only requires the genome as a template and does not require enzyme digestion, linker addition, etc. It is conducive to automated operation and is particularly suitable for the analysis of a large number of samples. It can be applied to research on molecular assisted breeding of livestock and poultry and genetic evolution analysis.
[0005] At present, the long-fragment PCR amplification method is generally used to detect transposon insertion polymorphic molecular markers, but this method takes a long time to amplify and has extremely low efficiency, and has high requirements for DNA templates and polymerases, resulting in increased costs. In order to solve the shortcomings of long-fragment PCR amplification, the present invention uses allele-specific PCR technology to detect transposon insertion polymorphic molecular markers. Summary of the invention
[0006] In order to identify the white feather trait of ducks or breed white feather ducks, the present invention provides the following technical solution:
[0007] The object of the present invention is to provide a transposon polymorphic molecular marker LTR / Gypsy for determining duck white feather traits. The molecular marker is located in the intron region of the duck MITF gene, specifically at chr1: 5199184-5205876 of the duck genome, is an insertion type polymorphic molecular marker, and the nucleotide sequence is shown in SEQ ID NO.1, with a length of 6693 bp.
[0008] The present invention also provides the following application:
[0009] The present invention provides an application of a substance for detecting a transposon polymorphic molecular marker LTR / Gypsy in a duck MITF gene in identifying duck white feather traits;
[0010] Or, the present invention provides the use of a substance for detecting a transposon polymorphic molecular marker LTR / Gypsy in a duck MITF gene in the preparation of a product for identifying duck white feather traits;
[0011] Or, the present invention provides the use of a substance for detecting a transposon polymorphic molecular marker LTR / Gypsy in a duck MITF gene in breeding white-feathered ducks;
[0012] In an embodiment of the present invention, the substance for detecting the transposon polymorphic molecular marker LTR / Gypsy in the duck MITF gene includes the following 1) or 2):
[0013] 1) Amplifying allele-specific primers for the molecular marker LTR / Gypsy;
[0014] 2) a PCR reagent containing the primers;
[0015] The primers are composed of the following primer A and primer B;
[0016] The primer A consists of primer 6057F and primer 8388R; the primer B consists of primer 557F and primer 8388R; the primer 6057F contains the DNA molecule shown in SEQ ID NO.3; the primer 557F contains the DNA molecule shown in SEQ ID NO.2; and the primer 8388R contains the DNA molecule shown in SEQ ID NO.4.
[0017] The invention provides a method for identifying the white feather trait of a duck to be tested, comprising the following steps: detecting a transposon polymorphic molecular marker LTR / Gypsy in an intron region of a MITF gene of the duck to be tested, and determining the genotype through electrophoresis detection and analysis; the duck to be tested with a genotype of II has the white feather trait.
[0018] The invention provides a method for breeding white-feather ducks, comprising the following steps: detecting a transposon polymorphic molecular marker LTR / Gypsy in an intron region of a MITF gene of a test duck, and determining a genotype through electrophoresis detection and analysis; and breeding the test ducks with a genotype of II for seed preservation to obtain white-feather ducks.
[0019] In an embodiment of the present invention, the method for detecting the transposon polymorphic molecular marker LTR / Gypsy in the intron region of the duck MITF gene to be tested comprises the following steps: using primers consisting of primer A and primer B to perform allele-specific amplification on the duck to be tested, and then performing electrophoresis detection analysis;
[0020] If primer A can amplify an electrophoresis band of 2332 bp, and primer B has no amplification product, the genotype of the duck to be tested is II;
[0021] If primer A can amplify an electrophoresis band of 2332 bp, and primer B can amplify an electrophoresis band of 1139 bp, then the genotype of the duck to be tested is IW;
[0022] If primer A produces no amplification product, but primer B can amplify an electrophoresis band of 1139 bp, the genotype of the duck to be tested is WW.
[0023] The present invention also provides the application of transposon polymorphic molecular marker LTR / Gypsy in identifying duck white feather traits, using the material of detecting transposon polymorphic molecular marker LTR / Gypsy in duck MITF gene to perform allele PCR amplification, and judging the genotype through electrophoresis detection and analysis, and the duck to be tested with genotype II has the white feather trait.
[0024] The present invention also provides an application of the transposon polymorphic molecular marker LTR / Gypsy in breeding white-feathered ducks, wherein the material of the transposon polymorphic molecular marker LTR / Gypsy in the duck MITF gene is used to perform allele PCR amplification, and the genotype is determined through electrophoresis detection and analysis, and ducks to be tested with a genotype of II are selected for breeding to obtain white-feathered ducks.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] The duck MITF gene transposon polymorphic molecular marker LTR / Gypsy provided by the invention has high polymorphism and wide genome distribution. According to the transposon insertion polymorphism, specific allele-specific primers are designed for amplification, and then electrophoresis detection and analysis are performed. Only a genome template is required, no special equipment is required, the band pattern is clear, and detection can be performed simply, quickly, at low cost and accurately. Meat ducks with white feather traits can be screened out at an early stage, and the invention has important significance for my country's meat duck breeding industry. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1Comparison of genomic sequencing reads results of two alleles of MITF intron region structural variation;
[0028] Figure 2 Distribution of alleles of MITF gene intron region structural variation in ducks;
[0029] Figure 3 Results of allele-specific PCR detection of MITF intron region structural variation;
[0030] Figure 4 PCR amplification conditions for MITF gene structural variation;
[0031] Figure 5 Genotype distribution of MITF gene intron region structural variation detected by allele PCR. Specific implementation mode
[0032] The implementation scheme of the present invention will be described in detail below in conjunction with embodiments. However, the following embodiments are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. Those not specified in the embodiments are carried out according to conventional conditions or conditions recommended by the manufacturer. Reagents or instruments not specified by the manufacturer are all conventional products that can be obtained through commercial purchase.
[0033] The primers used in the present invention were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.
[0034] White-feathered ducks include Peking ducks, Cherry Valley ducks, and Orpington ducks;
[0035] Non-white-feathered ducks include Chinese local ducks (Jinding ducks, Kunshan Ma ducks, Loumen ducks, Jinyun Ma ducks, Mianyang Ma ducks, Jingjiang Ma ducks, Shaoxing ducks, Youxian Ma ducks, and Shanma ducks), wild ducks (mallards and spot-billed ducks).
[0036] Example 1 - Extraction of duck genomic DNA
[0037] Collect duck flocks of the above 14 breeds of ducks (mallards, spot-billed ducks, Jinding ducks, Kunshan Ma ducks, Loumen ducks, Jinyun Ma ducks, Mianyang Ma ducks, Jingjiang Ma ducks, Shaoxing ducks, Youxian Ma ducks, Shanma ducks, Cherry Valley ducks, Orpington ducks, Peking ducks), draw blood from the wing vein, put the blood into an anticoagulation tube, extract DNA using the conventional phenol-chloroform extraction method, and dilute it to 60 ng / ul for use as a template.
[0038] Example 2 - Discovery of the transposon polymorphic molecular marker LTR / Gypsy in the intron region of the duck MITF gene and its correlation with the white feather trait of ducks
[0039] Using the duck whole genome resequencing data obtained in our laboratory, we identified genomic structural variations by analyzing genome depth and coverage. Fisher's exact test and differentiation index F ST Methods The differential structural variation between white-feathered ducks (Peking duck, Cherry Valley duck) and non-white-feathered ducks (Chinese local duck, wild duck) was compared. The most significant site was located in the intron region of the duck MITF gene. First-generation sequencing analysis revealed that the structural variation was caused by transposon insertion. There were 1289bp LTR structures at the 5' and 3' ends of the inserted sequence, which had obvious transposon characteristics. The structural variation can be divided into insertion type and wild type by comparing the reads of genome sequencing data (see Figure 1 ). By analyzing the allele frequency of this structural variation in white-feathered duck breeds and non-white-feathered duck breeds, it was found that the insertion allele and deletion allele were different in white-feathered duck breeds and non-white-feathered duck breeds. The white-feathered duck breed was 100% insertion type, and the wild type frequency in non-white-feathered duck breeds was as high as 0.97 (see Figure 2 ).
[0040] Example 3 - Identification of two alleles caused by the transposon polymorphic molecular marker LTR / Gypsy in the intron region of MITF by long-range PCR
[0041] The structural variation alleles in the intron region of the MITF gene of the above 14 duck breeds with different feather colors were detected. The structural variation was genotyped by long-fragment PCR amplification and first-generation Sanger sequencing. A total of two alleles were found. The insertion type (type I): there was an insertion at chr1: 5199184-5205876, the nucleotide sequence is shown in SEQ ID NO.1, and the insertion length is 6693bp. The wild type (type W) did not have an insertion at this position (see Figure 1 ).
[0042] The long fragment PCR used primers 557F and 8388R as shown in Table 3 below, the amplification program was as shown in Table 1 below, and the reaction system was as shown in Table 2 below.
[0043] Table 1 shows the long fragment PCR amplification program
[0044]
[0045] Table 2 is the reaction system for long fragment PCR amplification
[0046]
[0047]
[0048] Example 4 - Identification of two alleles caused by the transposon polymorphic molecular marker LTR / Gypsy in the intron region of MITF using allelic PCR technology
[0049] Specific allele-specific primers were designed for the transposon insertion sequence, that is, upstream and downstream primers were designed through the flanking region sequences at both ends of the transposon insertion to amplify the deletion type, and a third primer was designed on the transposon sequence to cooperate with the upstream or downstream primers at both ends to amplify the insertion type. The primer sequences are shown in Table 3. According to the physical position and amplification combination of the primer design, primer A composed of 6057F and 8388R primers was used to identify the I allele; primer B composed of 557F and 8388R primers was used to identify the W allele; it can be concluded that the W allele band size is 1139bp, and the I allele band size is 2332bp. The WW genotype shows a band of 1139bp; the IW genotype shows two bands of 1139bp and 2332bp; the II genotype shows a band of 2332bp ( Figure 3 ), allele-specific PCR amplification conditions were as follows Figure 4 The reaction system is shown in Table 4.
[0050] Table 3 shows the primers for PCR detection of MITF gene structural variation
[0051] Primer name Primer sequence (5'--3') sequence name 557F TCAACTGCTATCCTCTATCAGATTTCAA SEQ ID NO.2 6057F GTGAAGAGAGATGAGAGACACCGTTGG SEQ ID NO.3 8388R GATGTGCGTTGGGCTCGTAGG SEQ ID NO.4
[0052] Table 4 is the reaction system for allele-specific PCR amplification
[0053] Element volume PCR Mix 10ul 557F / 6057F 0.5ul 8388R 0.5ul DNA 1ul ddH2O 8ul Total 20ul
[0054] Example 5 - Verification of the correlation between the transposon polymorphic molecular marker LTR / Gypsy in the MITF gene and the duck white feather trait using allelic PCR technology
[0055] The genomic DNA obtained in Example 1 was used as an amplification template, and the allele-specific primers shown in Table 3 and the reaction system shown in Table 4 were used to perform typing detection on the genotypes of the above 14 duck breeds. The results showed that among the non-white-feathered duck breeds, such as the wild ancestors of domestic ducks, the mallard and the spot-billed duck, and the local domestic ducks (Jinding duck, Kunshan shelduck, Loumen duck, Jinyun shelduck, Mianyang shelduck, Jingjiang shelduck, Shaoxing duck, Youxian shelduck and mountain shelduck) all showed wild homozygous genotypes (WW) and insertion / wild heterozygous genotypes (IW); while among the white-feathered duck breeds, the Cherry Valley duck, the Austrian white star duck and the Beijing duck were all insertion homozygous genotypes (II), and the distribution frequencies were as follows: Figure 5 shown.
[0056] Example 6 - Application of transposon polymorphic molecular marker LTR / Gypsy in MITF gene and its detection material
[0057] 1. Application of the transposon polymorphic molecular marker LTR / Gypsy in the MITF gene and its detection substances in identifying duck white feather traits
[0058] Step 1: Collect the ducks to be tested, collect blood from the wing vein, put the blood into an anticoagulant tube, extract DNA using phenol extraction method, and dilute to 60ng / ul as an amplification template for standby use;
[0059] Step 2: Using allele PCR technology, with diluted genomic DNA as template, using primers consisting of primer A and primer B to detect the transposon polymorphic molecular marker LTR / Gypsy in the intron region of MITF, and analyzing by electrophoresis detection,
[0060] If primer A can amplify an electrophoresis band of 2332 bp, and primer B has no amplification product, the genotype of the duck to be tested is II;
[0061] If primer A can amplify an electrophoresis band of 2332 bp, and primer B can amplify an electrophoresis band of 1139 bp, then the genotype of the duck to be tested is IW;
[0062] If primer A does not amplify a product, but primer B can amplify a 1139 bp electrophoresis band, the genotype of the duck to be tested is WW;
[0063] Step 3: According to the results of genotyping, the duck to be tested with genotype II has the white feather trait.
[0064] 2. Application of the transposon polymorphic molecular marker LTR / Gypsy in the MITF gene and its detection substances in breeding white-feathered ducks
[0065] Step 1: Collect the ducks to be tested, collect blood from the wing vein, put the blood into an anticoagulant tube, extract DNA using phenol extraction method, and dilute to 60ng / ul as an amplification template for standby use;
[0066] Step 2: Using allele PCR technology, with diluted genomic DNA as template, using primers consisting of primer A and primer B to detect the transposon polymorphic molecular marker LTR / Gypsy in the intron region of MITF, and analyzing by electrophoresis detection,
[0067] If primer A can amplify an electrophoresis band of 2332 bp, and primer B has no amplification product, the genotype of the duck to be tested is II;
[0068] If primer A can amplify an electrophoresis band of 2332 bp, and primer B can amplify an electrophoresis band of 1139 bp, then the genotype of the duck to be tested is IW;
[0069] If primer A does not amplify a product, but primer B can amplify a 1139 bp electrophoresis band, the genotype of the duck to be tested is WW;
[0070] Step 3: Based on the results of gene typing and combined with the breeding program selection, if white-feathered ducks are selected, individuals with genotype II are selected for breeding, thereby selecting the feather color traits of the duck flock.
Claims
1. A transposon polymorphic molecular marker LTR / Gypsy that determines duck white feather traits, Features: The molecular marker is located in the intron region of the duck MITF gene and is an insertion-type polymorphic molecular marker, and the nucleotide sequence is shown in SEQ ID NO.
1.
2. Detection of the transposon polymorphic molecular marker LTR / Gypsy in duck MITF gene and its application in identifying duck white feather traits. Features: The molecular marker is located at chr1: 5199184-5205876 of the duck genome, is an insertion-type polymorphic molecular marker, and the nucleotide sequence is shown in SEQ ID NO.
1.
3. Application of the substance detecting the transposon polymorphic molecular marker LTR / Gypsy in the duck MITF gene in the preparation of products for identifying duck white feather traits, Features: The molecular marker is located at chr1: 5199184-5205876 of the duck genome, is an insertion-type polymorphic molecular marker, and the nucleotide sequence is shown in SEQ ID NO.
1.
4. Application of the substance detecting the transposon polymorphic molecular marker LTR / Gypsy in duck MITF gene in breeding white-feather ducks, Features: The molecular marker is located at chr1: 5199184-5205876 of the duck genome, is an insertion-type polymorphic molecular marker, and the nucleotide sequence is shown in SEQ ID NO.
1.
5. The use according to any one of claims 2 to 4, Features: The material for detecting the transposon polymorphic molecular marker LTR / Gypsy in duck MITF gene includes the following 1) or 2): 1) Amplifying allele-specific primers for the molecular marker LTR / Gypsy; 2) a PCR reagent containing the primers; The primers consist of the following primer A and primer B; The primer A is composed of primer 6057F and primer 8388R; the primer B is composed of primer 557F and primer 8388R; the primer 6057F is a DNA molecule shown in SEQ ID NO.2; Primer 557F is the DNA molecule shown in SEQ ID NO.3; Primer 8388R is the DNA molecule shown by SEQ ID NO.
4.
6. A method for identifying the white feather traits of a duck to be tested, It is characterized in that The method comprises the following steps: detecting the transposon polymorphic molecular marker LTR / Gypsy in the intron region of the MITF gene of the duck to be tested, and determining the genotype through electrophoresis detection and analysis; the duck to be tested with genotype II has the white feather trait; the detection of the transposon polymorphic molecular marker LTR / Gypsy in the intron region of the MITF gene of the duck to be tested comprises the following steps: performing allele-specific amplification on the duck to be tested using the primers described in claim 5, and then performing electrophoresis detection and analysis; If primer A can amplify an electrophoresis band of 2332 bp, and primer B has no amplification product, the genotype of the duck to be tested is II; If primer A can amplify an electrophoresis band of 2332 bp, and primer B can amplify an electrophoresis band of 1139 bp, then the genotype of the duck to be tested is IW; If primer A produces no amplification product, but primer B can amplify an electrophoresis band of 1139 bp, the genotype of the duck to be tested is WW.
7. A method for breeding white-feathered ducks, It is characterized in that The method comprises the following steps: detecting the transposon polymorphic molecular marker LTR / Gypsy in the intron region of the MITF gene of the duck to be tested, and determining the genotype through electrophoresis detection and analysis; breeding the duck to be tested with a genotype of II for seed preservation to obtain white-feathered ducks; the detection of the transposon polymorphic molecular marker LTR / Gypsy in the intron region of the MITF gene of the duck to be tested comprises the following steps: performing allele-specific amplification on the duck to be tested using the primers described in claim 5, and then performing electrophoresis detection and analysis; If primer A can amplify an electrophoresis band of 2332 bp, and primer B has no amplification product, the genotype of the duck to be tested is II; If primer A can amplify an electrophoresis band of 2332 bp, and primer B can amplify an electrophoresis band of 1139 bp, then the genotype of the duck to be tested is IW; If primer A produces no amplification product, but primer B can amplify an electrophoresis band of 1139 bp, the genotype of the duck to be tested is WW.
8. Use of the transposon polymorphic molecular marker LTR / Gypsy according to claim 1 in identifying duck white feather traits, It is characterized in that The method comprises the following steps: using the material for detecting the transposon polymorphic molecular marker LTR / Gypsy in the duck MITF gene to perform allele PCR amplification, and then performing electrophoresis detection and analysis to determine the genotype, and the duck to be tested with genotype II has the white feather trait; the method for detecting the genotype by using the material for detecting the transposon polymorphic molecular marker LTR / Gypsy in the duck MITF gene comprises the following steps: performing allele-specific amplification on the duck to be tested with the primers described in claim 5, and then performing electrophoresis detection and analysis; If primer A can amplify an electrophoresis band of 2332 bp, and primer B has no amplification product, the genotype of the duck to be tested is II; If primer A can amplify an electrophoresis band of 2332 bp, and primer B can amplify an electrophoresis band of 1139 bp, then the genotype of the duck to be tested is IW; If primer A produces no amplification product, but primer B can amplify an electrophoresis band of 1139 bp, the genotype of the duck to be tested is WW.
9. Application of the transposon polymorphic molecular marker LTR / Gypsy according to claim 1 in breeding white-feather ducks, It is characterized in that The method comprises the following steps: using the material for detecting the transposon polymorphic molecular marker LTR / Gypsy in the duck MITF gene to perform allele PCR amplification, and performing electrophoresis detection and analysis to determine the genotype, and selecting the duck to be tested with a genotype of II for breeding, so as to obtain white-feathered ducks; the method for detecting the genotype by using the material for detecting the transposon polymorphic molecular marker LTR / Gypsy in the duck MITF gene comprises the following steps: performing allele-specific amplification on the duck to be tested with the primers described in claim 5, and then performing electrophoresis detection and analysis; If primer A can amplify an electrophoresis band of 2332 bp, and primer B has no amplification product, the genotype of the duck to be tested is II; If primer A can amplify an electrophoresis band of 2332 bp, and primer B can amplify an electrophoresis band of 1139 bp, then the genotype of the duck to be tested is IW; If primer A produces no amplification product, but primer B can amplify an electrophoresis band of 1139 bp, the genotype of the duck to be tested is WW.