USH2A gene humanized mouse model and its establishment method and application

By replacing the mouse USH2A gene sequence with the human USH2A gene sequence in the USH2A gene humanized mouse model, a USH2A gene humanized mouse model containing the c.2802T>G mutation was constructed, which solved the problem of inaccurate simulation of the splicing skipping efficiency of USH2A gene exon 13 in the existing technology, and achieved accurate evaluation of the USH2A exon 13 deletion efficiency and effective screening of drug efficacy.

CN115843746BActive Publication Date: 2025-09-19GUANGZHOU REFORGENE MEDICINE CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202211232582.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-10
Publication Date
2025-09-19
Estimated Expiration
2042-10-10

AI Technical Summary

Technical Problem

Existing technologies make it difficult to accurately simulate the splicing skipping efficiency of exon 13 of the USH2A gene, resulting in the inability to effectively evaluate the efficacy of drugs in the humanized mouse model of the USH2A gene, especially the splicing skipping phenomenon in the case of the c.2802T>G mutation.

Method used

A humanized mouse model of the USH2A gene was constructed by replacing the knockout region of the mouse USH2A gene sequence with the knockin region of the human USH2A gene sequence, specifically USH2A exon 13 containing the pathogenic mutation c.2802T>G. Gene editing was performed using the CRISPR/Cas system to ensure that the selection and combination of intron fragments could accurately simulate the RNA splicing of human exons.

Benefits of technology

It has achieved an objective and accurate evaluation of the USH2A exon 13 deletion efficiency, can effectively screen specific and efficient drugs, accurately simulate the spontaneous splicing jump phenomenon of the c.2802T>G mutation, and expand the scope of drug evaluation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003882027060000101
    Figure BDA0003882027060000101
  • Figure BDA0003882027060000111
    Figure BDA0003882027060000111
  • Figure HDA0003882027070000011
    Figure HDA0003882027070000011
Patent Text Reader

Abstract

The present invention relates to a USH2A gene humanized mouse model, an establishment method, and an application thereof, and relates to the field of genetic engineering technology. The establishment method comprises: replacing a knockout region of a mouse USH2A gene sequence with a knockin region of a human USH2A gene sequence to establish a USH2A gene humanized mouse model; the knockin region comprises human USH2A exon 13, and the gene of human USH2A exon 13 comprises the pathogenic mutation c.2802T>G. The establishment method establishes a USH2A gene humanized mouse model comprising the pathogenic mutation c.2802T>G by replacing the knockout region of the mouse USH2A gene sequence with the knockin region of the human USH2A gene sequence, and can more objectively and accurately evaluate the elimination efficiency of USH2A exon 13.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a USH2A gene humanized mouse model, an establishment method thereof, and an application thereof. Background Art

[0002] Usher syndrome, also known as deafness-retinitis pigmentosa syndrome, is a hereditary disorder characterized by varying degrees of congenital sensorineural hearing loss and progressive vision loss caused by retinitis pigmentosa (RP). Clinically, Usher syndrome can be divided into three types: Type I, in which patients have congenital profound sensorineural hearing loss and loss of vestibular responses. Retinitis pigmentosa develops before puberty, leading to gradual blindness. Associated genes include MYO7A, CDH23, USH1C, and PCHD15. Type II, in which patients have congenital moderate to severe sensorineural hearing loss and normal vestibular responses. Retinitis pigmentosa develops during puberty, leading to gradual blindness. Associated genes include USH2A, GPR98, and WHRN. Type III, in which patients have progressive sensorineural hearing loss and normal vestibular responses. Retinitis pigmentosa develops in late puberty, leading to gradual blindness. Associated genes include CLRN1. Type II accounts for over 50% of Usher syndrome cases. Mutations in the USH2A gene are the most common cause of type II Usher syndrome, affecting over 50% of Usher syndrome patients. Mutations in the USH2A gene are also a key cause of nonsyndromic retinitis pigmentosa (NSRP).

[0003] USH2A is located on 1q41 and spans over 800 kb in the genome. It encodes a large transmembrane protein, usherin, which is anchored to the plasma membrane of retinal photoreceptor cells and inner ear hair cells and is essential for ciliary development and maintenance. In the retina, usherin is a key component of the USH2 complex and is thought to play a role in stabilizing the outer segments of photoreceptors. USH2A has two isoforms. The predominant isoform in retinal cells contains 72 exons and a coding region of approximately 15.6 kb. The extracellular portion of the usherin protein contains numerous repetitive domains, including 10 laminin EGF-like (LE) domains and 35 fibronectin type 3 (FN3) domains. Human USH2A exon 13 is 642 bp in length, encoding amino acids 723–936, representing four of the 10 LE domains in the usherin protein.

[0004] Mutations in exon 13, exon 50, and intron 40 of the USH2A gene can cause Usher syndrome. To date, more than 1,000 pathogenic mutations distributed throughout the USH2A gene have been identified, among which exon 13 is the most frequently mutated exon in the USH2A gene, accounting for approximately 35%. Mutations in exon 13 of the USH2A gene include c.2802T>G (p.Cys934Trp, the most frequent mutation in Chinese patients), c.2299delG (p.E767SfsX21, the most frequent mutation in European and American patients), c.2276G>T (amino acid change: p.C759F), c.2522C>A (p.S841Y), c.2242C>T (p.Gln748X), c.2541C>A (C847X), c.2761 delC (Leu921fs) and c.2776C>T (p.R926C), c.2209C>T, c.2310delA, c.2391_2392deITG, c.2431A>T, c.2431_ 2432delAA, c.2440C>T, c.2525dup, c.2610C>A, c.2755C>T, c.2176T>C, c.2236C>G, c.2296T>C, c.2332G>T.

[0005] The USH2A coding region is approximately 15.6 kb long. Conventional gene therapy delivery methods (such as recombinant lentivirus, recombinant adeno-associated virus, etc.) are difficult to package such a large coding sequence, making it difficult to treat by directly delivering USH2A.

[0006] Existing technologies use the CRISPR / Cas system to edit genomic DNA to directly delete exon 13 or disrupt sites related to RNA splicing. Exon skipping can also be promoted by using single-base editors to modify key bases at the aforementioned splicing-related sites. Antisense oligonucleotides (AONs) are used to target and interfere with pre-mRNA splicing, which is more efficient in promoting exon skipping. However, according to existing research data, humanized mice with the c.2299delG mutation in the USH2A gene are unable to accurately simulate the efficacy of drugs on splicing skipping of the c.2802T>G mutation in USH2A exon 13. Summary of the Invention

[0007] To address the above issues, the present invention provides a method for establishing a humanized USH2A gene mouse model. This method replaces the knockout region of the mouse USH2A gene sequence with the knockin region of the human USH2A gene sequence to establish a humanized USH2A gene mouse model containing the pathogenic mutation c.2802T>G, which can more objectively and accurately evaluate the deletion efficiency of USH2A exon 13.

[0008] The present invention provides a method for establishing a USH2A gene humanized mouse model, which includes: replacing a knockout region of a mouse USH2A gene sequence with a knockin region of a human USH2A gene sequence to establish a USH2A gene humanized mouse model; the knockin region includes human USH2A exon 13, and the gene of human USH2A exon 13 includes the pathogenic mutation c.2802T>G.

[0009] The above-mentioned pathogenic mutation c.2802T>G indicates that the 2802nd base of the human USH2A gene changes from T to G. Therefore, the base at this site in the above-mentioned knock-in region sequence is G.

[0010] In the prior art, humanized mice carrying the USH2A gene with the c.2299delG mutation may experience false positives or their efficiency may not match the actual situation due to the obvious spontaneous splicing skipping of c.2299delG. Therefore, they are unable to accurately simulate the efficacy of drugs on splicing skipping of USH2A exon 13 with the c.2802T>G mutation. During the research process, the inventors discovered that the reason for the inability to accurately simulate the problem is that the combination of human USH2A intron fragments and mouse USH2A intron fragments may form new splicing sites or affect the function of the original splicing sites, resulting in abnormal splicing. Therefore, the inventors used the above method to construct a USH2A gene humanized mouse model. By comparing the efficiency of drug-induced splicing skipping in c.2299delG humanized mice and c.2802T>G humanized mice, they verified that the USH2A gene humanized mouse model containing the pathogenic mutation c.2802T>G can more objectively and accurately evaluate the efficiency of USH2A exon 13 deletion, thereby more effectively screening drugs that specifically and efficiently induce c.2802T>G USH2A exon 13 splicing skipping. At the same time, the mouse model obtained by the above method, in which the human USH2A intron fragment and the mouse USH2A intron fragment are combined, can simulate the RNA splicing of human and mouse exons and can also simulate the spontaneous splicing skipping phenomenon present in the c.2802T>G mutation.

[0011] The present invention can be widely used to evaluate the elimination efficiency of different "USH2A exon 13 deletion" technologies, such as gene knockout, RNA interference, etc. The gene knockout means that large fragments of exon 13 are removed in USH2A, or splicing-related sites such as splicing donor / acceptor sites are destroyed, resulting in the deletion of exon 13 at the gene, RNA or protein level. The RNA interference means that splicing-related sites such as splicing donor / acceptor sites are knocked out by targeting USH2A exon 13, inducing splicing skipping of exon 13, and promoting the deletion of exon 13 at the RNA level. Moreover, the present invention can achieve accurate quantification and comparison of the elimination efficiency for different "induced USH2A exon 13 deletion" technologies.

[0012] In one embodiment, the knock-in region includes a gene comprising human USH2A intron 12, human USH2A exon 13 and human USH2A intron 13 connected in sequence.

[0013] In one embodiment, the gene of human USH2A intron 12 includes a gene fragment of human USH2A intron 12 with a 3' end length of ≥490 bp, and the gene of human USH2A intron 13 includes a gene fragment of human USH2A intron 13 with a 5' end length of ≥703 bp.

[0014] In one embodiment, the gene of human USH2A intron 12 includes a gene fragment of human USH2A intron 12 with a 3' end length of ≥1500bp, and the gene of human USH2A intron 13 includes a gene fragment of human USH2A intron 13 with a 5' end length of ≥1500bp.

[0015] In one embodiment, the gene of human USH2A intron 12 includes a gene fragment of human USH2A intron 12 with a 3' end length of ≥1600 bp, and the gene of human USH2A intron 13 includes a gene fragment of human USH2A intron 13 with a 5' end length of ≥1599 bp.

[0016] In one embodiment, the gene of human USH2A intron 12 includes a gene fragment of 1611 bp in length at the 3' end of human USH2A intron 12, and the gene of human USH2A intron 13 includes a gene fragment of 1599 bp in length at the 5' end of human USH2A intron 13.

[0017] The present invention selects a longer human USH2A intron fragment, provides more candidate target sites, and expands the scope of evaluable drugs.

[0018] In one embodiment, the knockout region is replaced with the knockin region using the CRISPR / Cas9 system, wherein the CRISPR / Cas9 system includes Cas9 and gRNA, and the targeting domain of the gRNA targets the knockout region, and the knockout region includes mouse Ush2a exon 12.

[0019] Exon 12 of mouse USH2A is homologous to exon 13 of human USH2A, both of which are 642 bp in length. Removal of this exon did not cause subsequent frameshift mutations. After knocking out exon 12 of mouse USH2A, Usherin was still able to correctly locate and perform normal functions. Therefore, the inventors used mouse exon 12 as the knockout region.

[0020] In one embodiment, the knockout region includes the gene of mouse Ush2a intron 11, mouse Ush2a exon 12, and mouse Ush2a intron 12 connected in sequence;

[0021] The gene of mouse Ush2a intron 11 includes a gene fragment with a length of ≥490bp at the 3' end of mouse Ush2a intron 11, and the gene of mouse Ush2a intron 12 includes a gene fragment with a length of ≥703bp at the 5' end of mouse Ush2a intron 12.

[0022] In one embodiment, the gene of mouse Ush2a intron 11 includes a gene fragment of mouse Ush2a intron 11 with a 3' end length of ≥1500bp, and the gene of mouse Ush2a intron 12 includes a gene fragment of mouse Ush2a intron 12 with a 5' end length of ≥1500bp.

[0023] In one embodiment, the gene of mouse Ush2a intron 11 includes a gene fragment with a length of 1600-3586 bp at the 3' end of mouse Ush2a intron 11, and the gene of mouse Ush2a intron 12 includes a gene fragment with a length of 1500-15079 bp at the 5' end of mouse Ush2a intron 12.

[0024] In one embodiment, the gene of mouse Ush2a intron 11 includes a gene fragment with a length of 1670-3586 bp at the 3' end of mouse Ush2a intron 11, and the gene of mouse Ush2a intron 12 includes a gene fragment with a length of 1600-15079 bp at the 5' end of mouse Ush2a intron 12.

[0025] In one embodiment, the gene of mouse Ush2a intron 11 includes a gene fragment with a length of 1670 bp at the 3' end of mouse Ush2a intron 11, and the gene of mouse Ush2a intron 12 includes a gene fragment with a length of 1600 bp at the 5' end of mouse Ush2a intron 12.

[0026] In one embodiment, the establishment method includes the following steps:

[0027] Construction of a targeting vector: A targeting vector is constructed that sequentially contains a 5' homology arm, a recombination site, a knock-in region of the human USH2A gene sequence, and a 3' homology arm;

[0028] Microinjection: The targeting vector, Cas9 mRNA, and gRNA are mixed and injected into fertilized egg cells to obtain positive F0 generation mice;

[0029] Mating to obtain offspring mice: the above-mentioned positive F0 generation mice were mated with wild-type mice to obtain F1 generation heterozygous mice, and the F1 generation heterozygous mice were mated, identified and screened to obtain homozygous USH2A humanized gene knock-in mice.

[0030] In one embodiment, the targeting domain sequence of the gRNA is as follows:

[0031] ATTCCTAACGATACTCGCAG (SEQ ID NO:4), and TCCACAATGCTCTTACTTCC (SEQ ID NO:5).

[0032] The present invention also provides a USH2A gene humanized mouse model, in which the knockout region of the mouse USH2A gene sequence is replaced with the knockin region of the human USH2A gene sequence, wherein the knockin region includes human USH2A exon 13, and the gene of human USH2A exon 13 includes the pathogenic mutation c.2802T>G.

[0033] In one embodiment, the knock-in region includes the genes of human USH2A intron 12, human USH2A exon 13 and human USH2A intron 13 connected in sequence; the knock-out region includes the genes of mouse Ush2a intron 11, mouse Ush2a exon 12 and mouse Ush2a intron 12 connected in sequence.

[0034] In one embodiment, the gene of human USH2A intron 12 includes a gene fragment of human USH2A intron 12 with a 3' end length of ≥490 bp, and the gene of human USH2A intron 13 includes a gene fragment of human USH2A intron 13 with a 5' end length of ≥703 bp;

[0035] The gene of mouse Ush2a intron 11 includes a gene fragment with a length of ≥1500bp at the 3' end of mouse Ush2a intron 11, and the gene of mouse Ush2a intron 12 includes a gene fragment with a length of ≥1500bp at the 5' end of mouse Ush2a intron 12.

[0036] In one embodiment, the gene of human USH2A intron 12 includes a gene fragment of human USH2A intron 12 with a 3' end length of ≥1500 bp, and the gene of human USH2A intron 13 includes a gene fragment of human USH2A intron 13 with a 5' end length of ≥1500 bp;

[0037] The gene of mouse Ush2a intron 11 includes a gene fragment with a length of 1600-3586 bp at the 3' end of mouse Ush2a intron 11, and the gene of mouse Ush2a intron 12 includes a gene fragment with a length of 1500-15079 bp at the 5' end of mouse Ush2a intron 12.

[0038] In one embodiment, the gene of human USH2A intron 12 includes a gene fragment of human USH2A intron 12 with a 3' end length of ≥1600 bp, and the gene of human USH2A intron 13 includes a gene fragment of human USH2A intron 13 with a 5' end length of ≥1599 bp;

[0039] The gene of mouse Ush2a intron 11 includes a gene fragment with a length of 1670-3586 bp at the 3' end of mouse Ush2a intron 11, and the gene of mouse Ush2a intron 12 includes a gene fragment with a length of 1600-15079 bp at the 5' end of mouse Ush2a intron 12.

[0040] In one embodiment, the gene of human USH2A intron 12 includes a gene fragment of 1611 bp in length at the 3' end of human USH2A intron 12, and the gene of human USH2A intron 13 includes a gene fragment of 1599 bp in length at the 5' end of human USH2A intron 13;

[0041] The gene of mouse Ush2a intron 11 includes a gene fragment of 1670 bp in length at the 3' end of mouse Ush2a intron 11, and the gene of mouse Ush2a intron 12 includes a gene fragment of 1600 bp in length at the 5' end of mouse Ush2a intron 12.

[0042] The present invention also provides use of the USH2A gene humanized mouse model in evaluating the efficiency of USH2A exon 13 deletion or evaluating the efficacy of drugs for inducing USH2A mutations.

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] The present invention provides a method for establishing a humanized USH2A gene mouse model. The method replaces the knockout region of the mouse USH2A gene sequence with the knockin region of the human USH2A gene sequence to establish a humanized USH2A gene mouse model containing the pathogenic mutation c.2802T>G. This method can more objectively and accurately evaluate the deletion efficiency of USH2A exon 13. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Schematic diagram of the structure of MINIGENE-V1 in Example 1.

[0046] Figure 2 Schematic diagram of the structure of MINIGENE-V2 in Example 1.

[0047] Figure 3 Schematic diagram of the structure of MINIGENE-V3 in Example 1.

[0048] Figure 4 Schematic diagram of the structure of MINIGENE-V4 in Example 1.

[0049] Figure 5 This is a graph showing the results of evaluating the effects of different mutations, different host cells, and different intron fragments on spontaneous splicing skipping of exon 13 and transfection efficiency in the MINIGENE system in Example 1. Among them, lane 1 on the left: USH2A Minigene V1 transfected into 293T; lane 2: USH2A Minigene V2 transfected into 293T, no obvious signs of exon skipping were detected (wild-type USH2A-13 exon); lane 3: USH2A Minigene V3 transfected into 293T, a small amount of exon skipping was detected (including c.2802T>G mutation); lane 4: USH2A Minigene V4 transfected into 293T, no obvious signs of exon skipping were detected; lane 5: pCMV-EGFP transfected into 293T; lane 6: USH2A Minigene V1 transfected into N2A; lane 7: USH2AMinigene V2 transfected into N2A, no obvious signs of exon skipping were detected; lane 8: USH2A Minigene V3 transfected into N2A, obvious signs of exon skipping were detected (including c.2299delG mutation); lane 9: USH2A Minigene V4 was transfected into N2A, and no obvious signs of exon skipping were detected; lane 10: pCMV-EGFP was transfected into N2A; lane M on the right: GL DNAMarker 10000.

[0050] Figure 6 This is the result of DNA sequencing of the electrophoresis band in lane 9 in Example 1.

[0051] Figure 7 This is a graph showing the results of fluorescence microscopy detection of the effects of different mutations on spontaneous splicing skipping of exon 13 in Example 2.

[0052] Figure 8 This is a graph showing the results of flow cytometry detection of the effects of different mutations on spontaneous splicing skipping of exon 13 in Example 2.

[0053] Figure 9 Schematic diagram of the construction of a humanized mouse in Example 3 in which exon 13 of human USH2A carrying the c.2802T>G mutation and its flanking sequences replace exon 12 of mouse Ush2a and its flanking sequences.

[0054] Figure 10 Schematic diagram of the linearization of the targeting vector in Example 3.

[0055] Figure 11 This is the result of identifying the targeting vector by restriction enzyme digestion in Example 3, wherein, lane 1: SspI digestion of the vector obtained the correct 3.9 / 2.8 / 2.1 / 1.1 / 0.7 / 0.3 / 0.1 / 0.1kb bands; lane 2: SacI digestion obtained the correct 5.5 / 3.4 / 1.1 / 0.8 / 0.4 / 0.2kb bands; lane 3: DrdI digestion obtained the correct 6.6 / 1.9 / 1.5 / 1.2kb bands; lane 4: NotI digestion obtained the 11.2kb band.

[0056] Figure 12 USH2A EXON13 in Example 3 c.2802T>G Figure 1 shows the genetic identification results of homozygous humanized mice. Homozygous: one band of 594 bp; heterozygous: two bands of 594 bp and 619 bp; wild-type allele: one band of 619 bp. M: indicates Thermo Scientific GeneRuler 2000 bp DNA Ladder #MK001.

[0057] Figure 13 This is the result diagram of homozygote sequencing in Example 3.

[0058] Figure 14 The agarose gel electrophoresis diagram of the RT-PCR product in Example 4.

[0059] Figure 15 For the chimeric Ush2a in Example 4 c.2802T>G Sequencing results of normal splicing bands of pre-mRNA.

[0060] Figure 16 For the chimeric Ush2a in Example 4 c.2802T>G Sequencing results of spontaneously jumping bands of pre-mRNA.

[0061] Figure 17 In Example 5, AON was injected into the vitreous to induce USH2A EXON13 c.2802T>G Graph showing the frequency of hUSH2A exon 13 splicing skipping in humanized mouse retinal cells.

[0062] Figure 18 This is the agarose gel electrophoresis diagram of the retinal tissue RT-PCR products in Example 5. DETAILED DESCRIPTION

[0063] To facilitate understanding of the present invention, the present invention will be described more fully below with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the accompanying drawings. However, the present invention may be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the present disclosure.

[0064] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in this specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0065] source:

[0066] GL DNA Marker 10000 (Accurate Biology, Catalog Number: #AG11909), SteadyPure Agarose Gel DNA Purification Kit (Accurate Biology, Catalog Number: #AG21005), HiScript II One Step RT-PCR Kit (Novozymes #P611-01), expression vector pX601 (Addgene, Catalog Number: #61591).

[0067] Unless otherwise specified, the reagents, materials, and equipment used in this example are all commercially available; and the experimental methods, unless otherwise specified, are all conventional experimental methods in the art.

[0068] Example 1

[0069] MINIGENE cell experiment.

[0070] In this example, the effects of different mutations, different host cells, and different intron fragments on exon 13 spontaneous splicing skipping and transfection efficiency were evaluated in the MINIGENE system. The specific test method is shown below.

[0071] This example constructs four MINIGENEs:

[0072] MINIGENE-V1: mExon11-mExon12-mExon13 (m stands for mouse, h stands for human), the gene structure is mouse USH2A exon 11, 204 bp of the 5' end of mouse intron 11, 490 bp of the 3' end of mouse intron 11, mouse exon 12, 703 bp of the 5' end of mouse intron 12, 216 bp of the 3' end of mouse intron 12, and mouse exon 13, connected in series in the order of 5' to 3'; Figure 1 shown.

[0073] MINIGENE-V2: mExon11-hExon13-mExon13, the vector structure is: mouse exon 11, 192 bp of the 5' end of mouse intron 11, 1611 bp of the 3' end of human intron 12, human exon 13, 1599 bp of the 5' end of human intron 13, 216 bp of the 3' end of mouse intron 12, and mouse exon 13, connected in series in the order of 5' to 3', e.g. Figure 2 shown.

[0074] MINIGENE-V3: mExon11-hExon13 (c.2299delG)-mExon13. The vector structure is the same as MINIGENE-V2, except that the c.2299delG mutation is introduced into human exon 13. Figure 3 shown.

[0075] MINIGENE-V4: mExon11-hExon13 (c.2802T>G)-mExon13. The vector structure is the same as MINIGENE-V2, except that the c.2802T>G mutation is introduced into human exon 13. Figure 4 shown.

[0076] The MINIGENE-V(1-4) gene sequence was obtained by whole-genome synthesis and linearized by digesting pX601 with AgeI and EcoRI. The synthesized fragment was amplified by PCR, and a 5'-end PCR primer containing a sequence homologous to the 20 bp terminal of the linearized pX601 was added. The two fragments were recovered and recombined using a DNA assembly premix. The product was then transferred to ice and transformed into competent cells. Plated, single colonies were picked, and verified. The synthesized MINIGENE-V1-4 gene sequence was seamlessly inserted into the pCMV-EGFP vector to generate the pCMV-EGFP-MINIGENE-V(1-4) vector. This vector allows for the simultaneous transcriptional expression of EGFP and MINIGENE under the drive of the CMV promoter.

[0077] MINIGENE-V1 / V2 / V3 / V4 vectors were transfected into 293T cells and N2A cells using Lipofectamine 2000. CMV-EGFP vector was also used as a control. Cells were harvested 24-72 hours after transfection, and total RNA was extracted. RT-PCR was used to analyze the splicing of pre-RNA at exon 13 in MINIGENE.

[0078] The results show (such as Figure 5 After USH2A MINIGENE V3 (humanized exon 13, c.2299delG) was transfected into 293T cells and N2A cells, obvious signs of splicing occurred. The c.2299delG mutation indeed led to significant spontaneous splicing skipping of USH2A exon 13, indicating that the MINI-REP gene system can accurately reflect the effect of mutations on spontaneous splicing skipping of exon 13.

[0079] In addition, by comparing the transfection efficiency of MINIGENE-V1 and V2, it was found that increasing the length of the intron fragment had no significant effect on the transfection efficiency, but increased more potential target sites.

[0080] To confirm the RNA splicing of USH2A MINIGENE V4 (humanized exon 13, c.2802T>G) in host cells, the band in lane 9 was cut from the agarose gel and gel-purified using the SteadyPure Agarose Gel DNA Purification Kit. The recovered product was subjected to Sanger sequencing using EGFP-F. Partial sequencing results are shown in Figure 2. Figure 6As shown, mouse USH2A exon 11 is contiguous with human USH2A exon 13. RT-PCR and sequencing results after transfection of N2A cells with USH2A MINIGENE V4 (humanized exon 13, c.2802T>G) indicate that pre-RNA splicing in USH2A MINIGENE V4 is consistent with theoretical predictions. This indicates that selecting a longer intron fragment not only does not affect efficiency but also encompasses more human intron-specific splicing sites than a shorter intron fragment, facilitating the simulation of human exon 13 splicing.

[0081] Example 2

[0082] The effects of different mutations on exon 13 splicing were evaluated in MINI-REP cells.

[0083] To evaluate the effects of different mutations on the splicing of USH2A exon 13, MINI-REP genes containing different mutations were synthesized and corresponding MINI-REP gene reporter vectors were constructed. Flow cytometry was then used to analyze the splicing skipping of exon 13 containing different mutations in the MINI-REP gene system of the present invention.

[0084] Construction of exon 13 minigene and expression vector: EXON13 mut It represents USH2A exon 13 containing a pathogenic mutation, and its upstream and downstream intron sequences, i.e., a MINIGENE containing a mutation. Mut represents a mutation. The MINIGENE (minigene) of exon 13 is a gene containing USH2A intron 12 (selecting a gene fragment with a length of 192bp at the 5' end of the intron in series with a gene fragment with a length of 1611bp at the 3' end) - exon 13 - intron 13 (selecting a gene fragment with a length of 1599bp at the 5' end of the intron in series with a gene fragment with a length of 216bp at the 3' end). After synthesizing the MINIGENE minigene of exon 13, it was inserted into the reporter gene EGFP to obtain the MINI-REP gene structure of EGFP. left -Exon13 mut -EGFP right The MINI-REP gene was obtained by whole gene synthesis, and the corresponding restriction sites AgeI and EcoRI were set at both ends of the synthetic gene sequence. It was then integrated into the expression vector pX601 by restriction enzyme ligation to construct the MINI-REP gene reporter vector pCMV-EGFP. left -Exon13 mut -EGFP right carrier.

[0085] In this example, the mutations contained in exon 13 of the MINI-REP gene were c.2802T>G and c.2299delG, respectively. The 5' end 192 bp of intron 12 fragment was selected in series with the 3' end 1611 bp, and the 5' end 1599 bp of intron 13 fragment was selected in series with the 3' end 216 bp. The corresponding MINI-REP gene vector pCMV-EGFPleft-Exon13 was constructed. c.2802T>G -EGFPright, pCMV-EGFPleft-Exon13 c.2299delG -EGFPright. According to the transient transfection method of Example 1, the two MINI-REP gene vectors were transfected into host cells using the transfection reagent Lipofectamine 2000. In this example, 293T cells were selected as the host cells. The MINI-REP gene vector without mutation was used as a negative control, and the MINI-REP gene vector without exon 13 was used as a positive control. 24 hours after transfection, the cells in each group that emitted EGFP green fluorescence were observed by fluorescence microscopy. The results are as follows: Figure 7 As shown, the proportion of EGFP-positive cells in different mutation experimental groups was detected by flow cytometry, and the results are shown in the following table. Among them, the proportion of spontaneous splicing jump (EGFP-positive) cells in the c.2802T>G and c.2299delG mutation experimental groups detected by flow cytometry was 9.4% and 41.7%, respectively. Figure 8 shown.

[0086] Table 1 The proportion of EGFP-positive cells in different mutation experimental groups detected by flow cytometry

[0087] Experimental group EGFP positive rate (%) <![CDATA[pCMV-EGFP left -Exon13 WT -EGFP right ]]> 7.6 <![CDATA[pCMV-EGFP left -Exon13 c.2802T>G -EGFP right ]]> 9.4 <![CDATA[pCMV-EGFP left -Exon13 c.2299delG -EGFP right ]]> 41.7 <![CDATA[pCMV-EGFP left -EGFP right ]]> 89.6

[0088] The results showed that both c.2802T>G and c.2299delG can cause spontaneous splicing skipping in exon 13, with c.2299delG showing a significant rate of spontaneous splicing skipping, significantly higher than c.2802T>G. Therefore, when evaluating treatments that induce splicing skipping, the presence of the c.2299delG mutation may result in false positives or mismatches in efficacy, affecting the accuracy of subsequent testing of the efficacy of drugs that induce USH2A exon 13 deletion.

[0089] Example 3

[0090] USH2A exon 13 humanized mice carrying the c.2802T>G mutation (USH2A EXON13 c.2802T>G ) construction and verification.

[0091] The mouse USH2A gene (NCBI reference sequence: NM_021408.3) is located on mouse chromosome 1, and a total of 71 exons have been identified, of which the ATG start codon is located in exon 1 and the TGA stop codon is located in exon 71. In the gene knock-in model, mouse USH2A gene exon 12 plus partial flanking sequence [approximately 1670 bp upstream of exon 12 (i.e., 3' end of mouse intron 11) to approximately 1600 bp downstream of exon 12 (i.e., 5' end of mouse intron 12)] was replaced with human USH2A gene exon 13 plus partial flanking sequence [approximately 1611 bp upstream of exon 13 (i.e., 3' end of human intron 12) to approximately 1599 bp downstream of exon 13 (i.e., 5' end of human intron 13)] plus insertion sequence, wherein the insertion sequence between mouse intron 11 and human intron 12 is: 5'-AGTACTGATATCACGTAAACGGCCACAAGTTCGATT-3' (SEQ ID NO: 51). NO:1); the insertion sequence between human intron 13 and mouse intron 12 is: 5'-TGTCAGACTGGTCCGAATCCACGGTACCCCTCAGG-3' (SEQ ID NO:2). The restriction sites and identification primer sequences introduced by these two sequences facilitate rapid and accurate identification during vector construction. The c.2208T to G mutation was introduced into human USH2A exon 13, and the USH2A exon 13 humanized mouse (USH2A EXON13) carrying the c.2802T>G mutation was c.2802T>G ) is shown in the schematic diagram of the construction Figure 9 shown.

[0092] High-fidelity Taq DNA polymerase was used to amplify the mouse genomic fragment containing homology arms (HAs) from the BAC clone and sequentially assembled with the recombination site and selection marker into a targeting vector. The linearization diagram of the targeting vector is shown in the figure. Figure 10 The results of restriction enzyme digestion to identify the targeting vector are shown in Figure 11 shown.

[0093] The targeting vector (ie, donor template vector) sequence (11203 bp) is shown in SEQ ID NO: 3 below.

[0094] Two gRNAs targeting the mouse USH2A gene (guide sequences are SEQ ID NO: 4: ATTCCTAACGATACTCGCAG; SEQ ID NO: 5: TCCACAATGCTCTTACTTCC), a targeting vector containing "human Ush2a exon 13 + partial flanking sequence (~1611bp upstream to ~1599bp downstream of exon 13)" and Cas9 mRNA were co-injected into mouse fertilized eggs to produce targeted knock-in mouse offspring.

[0095] F0 generation mice were identified by PCR and genotyped by sequence analysis. Genotype identification primer pair 1 is as follows (annealing temperature 60.0°C):

[0096] F1: 5'-taagagattagcaaccgtcctcg-3' (SEQ ID NO: 6), R1: 5'-caagaactccaatgaaggcaagtt-3' (SEQ ID NO: 7), band size 594 bp;

[0097] Genotype identification primer pair 2 is as follows (annealing temperature 60.0°C):

[0098] F2: 5'-tcctcgctgaagattacctcctta-3' (SEQ ID NO: 8), R2: 5'-gggcactggatatggagaaaagta-3' (SEQ ID NO: 9), band size is 619 bp.

[0099] F0 generation mice were crossed with wild type mice to obtain F1 generation heterozygous mice and their genotypes were identified. The hybrid heterozygous F1 mice were mated to produce homozygous F2 mice and their genotypes were identified and verified. Figure 12 shown.

[0100] The homozygous gene was further sequenced using sequencing primer pair 3 (SEQ ID NO: 10: 5'-TCCTCGCTGAAGATTACCTCCTTA-3'; SEQ ID NO: 11: 5'-ACCTGTGGGAATCCCTTTAACATT-3') and a mutant sequence primer (F1). Figure 13 shown.

[0101] Example 4

[0102] USH2A EXON13 c.2802T>G Pre-mRNA splicing and spontaneous splicing skipping of chimeric USH2A in humanized mice.

[0103] 1. USH2A EXON13c.2802T>G Total RNA was extracted from the retina of homozygous humanized mice.

[0104] Homozygous USH2A EXON13 c.2802T>G The retinal samples of humanized mice were placed in a centrifuge tube, and 500 μl of Trizol reagent and a small amount of 1 mm RNase-free zirconium oxide grinding beads were added. The samples were ground using a high-speed cryogenic tissue grinder under the following conditions: -10°C, 70 Hz, 90 seconds per grinding, and a 30-second pause every 5 times. 100 μl of 1-Bromo-3-chloropropane (BCP) was added to the ground samples, and the samples were shaken vigorously and placed at room temperature for 5 minutes, followed by centrifugation at 12,000 g and 4°C for 15 minutes.

[0105] After centrifugation, separate the liquid layers and pipette 200 μl of the upper layer into a new centrifuge tube. Add 400 μl of isopropanol and mix thoroughly by inverting the tube several times. Incubate on ice for 10 minutes. After centrifugation, the RNA precipitate accumulates at the bottom of the tube. Remove the liquid by aspirating. Add 800 μl of 75% ethanol and centrifuge at 7500 g at 4°C for 10 minutes. After centrifugation, the RNA precipitate accumulates at the bottom of the tube. Remove as much liquid as possible and open the lid to dry. Dissolve the RNA precipitate in 50 μl of RNase-free water to obtain homozygous USH2A EXON13. c.2802T>G Retinal RNA from humanized mice.

[0106] 2. RT-PCR amplification of target region and Sanger sequencing.

[0107] 400 ng of each retinal RNA sample was used for one-step RT-PCR using the HiScript II One Step RT-PCR Kit. The reagents and conditions for RT-PCR are shown in the table below.

[0108] Table 2 RT-PCR reagents and conditions

[0109]

[0110] The RT-PCR product was analyzed by agarose gel electrophoresis, and two bands were visible, such as Figure 14 shown.

[0111] Will Figure 14The upper and lower bands in the above analysis were separated from the gel and purified using the SteadyPure Agarose GelDNA Purification Kit. The purified products of the upper band were confirmed by Sanger sequencing using mUSH2A-RTPCR-F2 (SEQ ID NO: 12: TGAAGGGCCTCAGTGTGATCG), mUSH2A-RTPCR-R2 (SEQ ID NO: 13: AGTTCCATTCGAGGCTCCTGC), and hExon13-R (SEQ ID NO: 14: CTTATCACAGTTGCAAGGCAGAC). The lower band was confirmed by Sanger sequencing using mUSH2A-RTPCR-F2 and mUSH2A-RTPCR-R2. The sequencing results of the normal splicing bands were shown (as shown in Figure 2). Figure 15 shown), USH2A EXON13 c.2802T>G Humanized mouse chimeric USH2A c.2802T>G The splicing jump of pre-mRNA is normal. No new splicing site is generated by the chimeric intron of the present invention (no new exon is introduced), nor is the splicing of normal exons affected (normal human or mouse exons are not removed). It can simulate the normal splicing of USH2A pre-mRNA. At the same time, the sequencing results of the spontaneously skipped bands show that (such as Figure 16 shown), USH2AEXON13 c.2802T>G Humanized mouse chimeric USH2A c.2802T>G The results showed that there was a certain degree of spontaneous splicing jump in the pre-mRNA of USH2A, indicating that the mouse model can simulate the spontaneous splicing jump of human USH2A exon 13 carrying the c.2802T>G mutation, and the spontaneous splicing jump probability of the chimeric mice was much lower than that of the chimeric mice carrying the c.2299delG mutation in exon 13. In the early experiments, the spontaneous jump probability of the chimeric humanized mice exceeded 50%, close to 60%.

[0112] Example 5

[0113] Utilizing USH2A EXON13 c.2802T>G Humanized mice were used to evaluate the effects of drug-induced exon 13 splicing skipping.

[0114] AON (based on SEQ ID NO:15: 5′-TGATCACACCTAAGCCCTAAA-3′, with each base modified by 2′-O-methoxy and phosphorothioate, the sequence shown in SEQ ID NO:15 is an RNA sequence, wherein T is the standard letter representation in the WIPO sequence table, which is actually uracil U, to obtain 5′-MU*MG*MA*MU*MC*MA*MC*MA*MC*MC*MU*MA*MA*MG*MC*MC*MC*MU*MA*MA*MA*-3′, “M” indicates 2′-O-methoxy modification, and “*” indicates phosphorothioate) was injected intravitreally into hUSH2A EXON13 and 15 μg (1 μL). c.2802T>G Gene knock-in humanized mice, hUSH2AEXON13 c.2299delG The gene was knocked into the eyes of humanized mice, and mice without treatment were used as blank controls (nontreated). Three weeks after injection, the experimental mice were sacrificed, and the retinal tissues were taken to extract RNA and reverse transcribe it into cDNA. RT-PCR and qRT-PCR experiments were performed using the corresponding primers in the table below to detect the same AON for USH2A EXON13. c.2802T>G Humanized mice and USH2AEXON13 c.2299delG Differences in the effects of inducing splicing skipping in humanized mice.

[0115] Table 3 List of RT-PCR primers and qRT-PCR probes

[0116]

[0117] The results are as follows Figure 17 、 Figure 18 As shown in the table below, the results show that USH2A EXON13 c.2802T>G Humanized mice can be used to simulate and evaluate in vivo targeted induction of USH2A by AONs c.2802T>G Effects of splicing skipping of exon 13. AON in USH2AEXON13 c.2802T>G The efficiency of inducing human USH2A exon 13 splicing skipping in humanized mice is close to the estimated efficiency of AON inducing human USH2A exon 13 splicing skipping in wild-type mice, indicating that EXON13 c.2802T>G The spontaneous skipping background interference of humanized mouse hUSH2A exon 13 (interference in the evaluation of splicing skipping drugs) is not significant; although AON is present in USH2A exon 13 c.2802T>G 、USH2A EXON13 c.2299delGBoth humanized mice can induce human USH2A exon 13 splicing skipping, but the induction effect is significantly different. c.2802T>G The effect of gene knock-in inducing splicing skipping in humanized mice was significantly lower than that in USH2A EXON13 c.2299delG Humanized mice presented.

[0118] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0119] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. A method for establishing a USH2A gene humanized mouse model, characterized in that: The establishment method includes: replacing the knockout region of the mouse USH2A gene sequence with the knockin region of the human USH2A gene sequence to establish a USH2A gene humanized mouse model; The knock-in region includes sequentially connected human USH2A intron 12, human USH2A exon 13 and human USH2A intron 13 genes, the human USH2A exon 13 gene includes the pathogenic mutation c.2802T>G, the human USH2A intron 12 gene includes a gene fragment with a 3' end length of 1611 bp of human USH2A intron 12, and the human USH2A intron 13 gene includes a gene fragment with a 5' end length of 1599 bp of human USH2A intron 13; The knockout region includes the mouse Ush2a intron 11, mouse Ush2a exon 12 and the gene of mouse Ush2a intron 12 connected in sequence, the gene of mouse Ush2a intron 11 includes a gene fragment with a length of 1670bp at the 3' end of mouse Ush2a intron 11, and the gene of mouse Ush2a intron 12 includes a gene fragment with a length of 1600bp at the 5' end of mouse Ush2a intron 12.

2. The establishment method according to claim 1, characterized in that The knockout region is replaced with the knockin region using the CRISPR / Cas9 system, wherein the CRISPR / Cas9 system includes Cas9 and gRNA, and the targeting domain of the gRNA targets the knockout region.

3. The establishment method according to any one of claims 1-2, characterized in that: The following steps are involved: Construction of a targeting vector: A targeting vector is constructed that sequentially contains a 5' homology arm, a recombination site, a knock-in region of the human USH2A gene sequence, and a 3' homology arm; Microinjection: The targeting vector, Cas9 mRNA, and gRNA are mixed and injected into fertilized egg cells to obtain positive F0 generation mice; Mating to obtain offspring mice: the above-mentioned positive F0 generation mice were mated with wild-type mice to obtain F1 generation heterozygous mice, and the F1 generation heterozygous mice were mated, identified and screened to obtain homozygous USH2A humanized gene knock-in mice.

4. The establishment method according to claim 3, characterized in that: The targeting domain sequence of the gRNA is as follows: ATTCCTAACGATACTCGCAG (SEQ ID NO:4), and TCCACAATGCTCTTACTTCC (SEQ ID NO:5).

5. Use of the USH2A gene humanized mouse model established by the method according to any one of claims 1 to 4 in evaluating the efficiency of USH2A exon 13 deletion or evaluating the efficacy of drugs used to induce USH2A mutations.

Citation Information

Patent Citations

  • GRNA targeting to pre-mRNA of USH2A gene, delivery system and CRISPR-Cas system

    CN115704023A

  • MINI-REP gene for evaluating USH2A exon 13 removal efficiency and expression vector and application thereof

    CN115704031A

  • Gene editing system for treating usher syndrome

    WO2023191570A1

  • Construction of non-human primate usher syndrome disease model having USH2a gene mutation

    WO2025092716A1