Single-chain antibody of Claudin 16 or its antigen-binding portion and its application

Abstract

The present invention discloses a single-chain antibody against Claudin 16 or its antigen-binding portion and its application. The single-chain antibody or its antigen-binding portion contains a heavy chain variable region and a light chain variable region. The heavy chain variable region and the light chain variable region are both composed of a complementary region and a framework region. The complementary region of the heavy chain variable region and the light chain variable region are both composed of CDR1, CDR2, and CDR3. The amino acid sequences of the heavy chain variable region and the light chain variable region of the single-chain antibody are derived from antibodies secreted by the hybridoma cell line 4F7D7. The deposit number of the hybridoma cell line 4F7D7 is CCTCC NO: 2022233, and the deposit date is July 19, 2022. The depository is the China Center for Type Culture Collection. The single-chain antibody or its antigen-binding portion provided by the present invention has high sensitivity and strong specificity and can be used for the detection of human Claudin 16 protein to meet the needs of practical applications.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a single-chain antibody of Claudin 16 or an antigen-binding portion thereof and applications thereof. Background Art

[0002] Claudin (CLDN) is a key protein in tight junctions in normal human tissues. It possesses four transmembrane domains and is a crucial molecule in tight junctions. It participates in physiological processes such as the regulation of paracellular permeability and conductance, forming a paracellular barrier that controls the flow of molecules between cells. Claudin proteins form an integral family of membrane proteins crucial for the formation and function of tight junctions (TJs). Claudin-16 belongs to the Claudin protein family, which consists of 23 integral membrane proteins. Claudin-16, also known as Paracellin-1, is a renal tight junction protein essential for paracellular magnesium absorption. Regulation of TJ structure and function has been implicated in the development of epithelial tumors. Studies have shown that CLDN3 and CLDN4 are among the most highly upregulated genes in ovarian cancer. Furthermore, increased expression of Claudin-3 and Claudin-4 in ovarian cancer cells is associated with increased invasiveness, suggesting their involvement in promoting ovarian tumor development and metastasis. This study demonstrates that Claudin-16 can serve as a novel ovarian cancer-specific marker.

[0003] The commonly used method for detecting Claudin 16 is immunoassay, among which immunomagnetic beads can significantly improve the sensitivity and specificity of detection. Immunomagnetic beads are magnetic particles with specific antibodies immobilized on their surface. They can specifically capture the target and separate the immune complex under a certain magnetic field strength. Therefore, we have developed a single-chain antibody against Claudin 16. Compared with traditional antibody conjugates, the molecular weight of the single-chain antibody is significantly reduced, the absolute number of antibodies coupled to the magnetic bead surface is increased, and the sensitivity of the immunomagnetic beads is greatly improved.

[0004] In view of the fact that a single-chain antibody against Claudin 16 has not yet been developed in China, a single-chain antibody against Claudin 16 or its antigen-binding portion and its application are urgently needed. Summary of the Invention

[0005] To address the deficiencies of the prior art, the present invention provides a single-chain antibody of Claudin 16 or an antigen-binding portion thereof and applications thereof.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0007] The first object of the present invention is to provide a single-chain antibody or an antigen-binding portion thereof to Claudin 16, wherein the single-chain antibody or the antigen-binding portion thereof comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region are both composed of a complementary region determining region and a framework region; and the complementary region determining region of the heavy chain variable region and the light chain variable region are both composed of CDR1, CDR2 and CDR3;

[0008] The amino acid sequence of CDR1 of the heavy chain variable region is shown in positions 6-13 of SEQ ID No. 2;

[0009] The amino acid sequence of CDR2 of the heavy chain variable region is shown in positions 31-38 of SEQ ID No. 2;

[0010] The amino acid sequence of CDR3 of the heavy chain variable region is shown in positions 77-90 of SEQ ID No. 2;

[0011] The amino acid sequence of CDR1 of the light chain variable region is shown in positions 143-149 of SEQ ID No. 2;

[0012] The amino acid sequence of CDR2 of the light chain variable region is shown in positions 167-169 of SEQ ID No. 2;

[0013] The amino acid sequence of CDR3 of the light chain variable region is shown in positions 206-214 of SEQ ID No. 2.

[0014] Preferably, the amino acid sequence of the heavy chain variable region is shown as positions 1-101 of SEQ ID No. 2, and the amino acid sequence of the light chain variable region is shown as positions 117-222 of SEQ ID No. 2.

[0015] Preferably, the amino acid sequence of the single-chain antibody or its antigen-binding portion is as shown in SEQ ID No. 2; the amino acid sequences of the heavy chain variable region and the light chain variable region of the single-chain antibody are derived from the antibody secreted by the hybridoma cell line 4F7D7, the deposit number of the hybridoma cell line 4F7D7 is CCTCC NO: 2022233, the deposit date is July 19, 2022, the depository is the China Center for Type Culture Collection, and the depository address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0016] The single-chain antibody or its antigen-binding portion further comprises a protein tag. The protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag is a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag or a SUMO tag. For example, the amino acid sequence of the single-chain antibody or its antigen-binding portion is the sequence obtained by connecting the protein tag encoding gene to the end of the sequence shown in SEQ ID No. 2.

[0017] A second object of the present invention is to provide a biomaterial related to any of the above-mentioned single-chain antibodies or antigen-binding portions thereof, wherein the biomaterial is any of the following:

[0018] B1) a nucleic acid molecule encoding any of the above-mentioned single-chain antibodies or antigen-binding portions thereof;

[0019] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0020] B3) a recombinant vector containing the nucleic acid molecule described in B1);

[0021] B4) a recombinant vector containing the expression cassette described in B2);

[0022] B5) a recombinant microorganism containing the nucleic acid molecule described in B1);

[0023] B6) a recombinant microorganism containing the expression cassette described in B2);

[0024] B7) a recombinant microorganism containing the recombinant vector described in B3);

[0025] B8) A recombinant microorganism containing the recombinant vector described in B4).

[0026] Preferably, the nucleic acid molecule encoding any of the above-mentioned single-chain antibodies or antigen-binding portions thereof in B1) is a gene encoding any of the above-mentioned single-chain antibodies or antigen-binding portions thereof, and the gene is a DNA molecule as described in A) or B) below:

[0027] A) the gene sequence encoding CDR1 of the heavy chain variable region is shown at positions 16-39 of SEQ ID No. 1; the gene sequence encoding CDR2 of the heavy chain variable region is shown at positions 91-114 of SEQ ID No. 1; the gene sequence encoding CDR3 of the heavy chain variable region is shown at positions 229-270 of SEQ ID No. 1; the gene sequence encoding CDR1 of the light chain variable region is shown at positions 427-447 of SEQ ID No. 1; the gene sequence encoding CDR2 of the light chain variable region is shown at positions 499-507 of SEQ ID No. 1; and the gene sequence encoding CDR3 of the light chain variable region is shown at positions 616-642 of SEQ ID No. 1;

[0028] B) A DNA that is more than 90% identical to the DNA molecule defined in A) and encodes the single-chain antibody or the antigen-binding portion thereof.

[0029] The gene sequence encoding the heavy chain variable region is shown in positions 1-303 of SEQ ID No. 1, and the gene sequence encoding the light chain variable region is shown in positions 349-666 of SEQ ID No. 1. For example, the nucleic acid molecule sequence of B1) is shown in SEQ ID No. 1.

[0030] The third object of the present invention is to provide an immunomagnetic bead, wherein the magnetic bead surface of the immunomagnetic bead is coupled to any of the above-mentioned single-chain antibodies or the antigen-binding portion thereof.

[0031] The preparation method of the immunomagnetic beads comprises the following steps: (1) EDC-activated carboxyl magnetic beads and single-chain antibodies or their antigen-binding portions are mixed and shaken at room temperature for 12-18 hours to perform a coupling reaction. The concentration of the single-chain antibody or its antigen-binding portion is 2-5 mg / mL. The mass ratio of the single-chain antibody or its antigen-binding portion to the carboxyl magnetic beads is 1-5:100. (2) A blocking solution is used to block the activated residues on the surface of the magnetic beads that are not coupled to the single-chain antibody or its antigen-binding portion. (3) Magnetic separation is used to enrich the blocked coupled magnetic beads to obtain immunomagnetic beads.

[0032] The fourth object of the present invention is to provide a product for detecting the content of Claudin 16, comprising any of the above-mentioned single-chain antibodies or antigen-binding portions thereof.

[0033] The fifth object of the present invention is to provide a product for enriching Claudin 16-positive cells, comprising the above-mentioned immunomagnetic beads.

[0034] A sixth object of the present invention is to provide any of the above-mentioned single-chain antibodies or antigen-binding portions thereof, any of the above-mentioned biomaterials, the above-mentioned immunomagnetic beads, the above-mentioned product for detecting the content of Claudin 16, or the above-mentioned product for enriching Claudin 16-positive cells for any of the following uses:

[0035] (1) preparing a product for detecting Claudin 16, or detecting Claudin 16;

[0036] (2) preparing products for detecting the content of Claudin 16, or detecting the content of Claudin 16;

[0037] (3) Preparing a Claudin 16-enriched cell product, or a Claudin 16-enriched cell product.

[0038] A seventh object of the present invention is to provide a method for detecting Claudin 16 or Claudin 16 content, comprising the following steps:

[0039] (1) treating the sample to be tested with the above-mentioned immunomagnetic beads to obtain positive cells expressing Claudin 16;

[0040] (2) Enriching Claudin 16 in the sample using the above-mentioned immunomagnetic beads, using any of the above-mentioned single-chain antibodies or their antigen-binding portions as a secondary antibody, and determining whether the sample contains Claudin 16 or the content of Claudin 16 in the sample by immune reaction detection.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] The single-chain antibody in the present invention has a small molecular weight, strong tissue penetration ability, and low immunogenicity, and has a strong advantage over mAb in tumor treatment. The single-chain antibody has no Fc segment, which can reduce nonspecific adsorption while maintaining the affinity and specificity of the parent antibody. It can bind to the hapten monovalently and may have higher sensitivity, and is also suitable for the field of immunoassay.

[0043] The immunomagnetic beads of the present invention can enrich antigenic target substances in a short period of time. This not only significantly shortens sample detection time and eliminates the disadvantage of interference between immune complexes and other components in the sample during immunoassay, but also improves the sensitivity of the detection method. The present invention couples the prepared single-chain antibody with carboxyl magnetic beads to prepare the immunomagnetic beads. The immunomagnetic beads function to enrich the claudin 16 protein in the sample through magnetic separation technology and further isolate the claudin 16 in the sample. The claudin 16 content is then detected by establishing a double antibody sandwich chemiluminescence using an HRP-labeled secondary antibody.

[0044] Cell preservation:

[0045] The hybridoma cell line 4F7D7 involved in the present invention was obtained by screening by the inventors of the present invention. The preservation number of the hybridoma cell line 4F7D7 is CCTCC NO: 2022233, the preservation date is July 19, 2022, the preservation unit is the China Center for Type Culture Collection, and the preservation unit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, on the campus of Wuhan University. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 is the heavy chain gene V in Example 1 of the present invention H and light chain gene V L Schematic diagram of the results of 1% agarose gel identification;

[0047] Figure 2 This is a schematic diagram of SDS-PAGE display in Example 1 of the present invention;

[0048] Figure 3 The standard curve diagram of protein concentration and luminescence value in Example 5 of the present invention is drawn. DETAILED DESCRIPTION

[0049] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0050] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0051] Example 1: Preparation of Claudin 16 single-chain antibody.

[0052] 1. Preparation of Claudin 16 single-chain antibody gene fragment.

[0053] 1. Hybridoma Cell Recovery: Remove the desired hybridoma cell line 4F7D7 (accession number: CCTCC NO: C2022233, deposit date: July 19, 2022, deposited with China Center for Type Culture Collection, located at Wuhan University, 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province) that stably secretes Claudin16 monoclonal antibodies from the liquid nitrogen tank. Immediately thaw the cryovial in a 42°C water bath, then transfer the tube to a sterile 15mL centrifuge tube, add 5mL of complete culture medium (10% fetal bovine serum, 90% DMEM, 1% penicillin-streptomycin mixture), and centrifuge at 1000rpm for 3min. Discard the supernatant, add 5mL of complete culture medium to resuspend the cells, transfer them to a T25 cell culture flask, and culture them in a 37°C 5% CO2 cell culture incubator for a period of time. When the cells are confluent, stable, uniform in size, round and translucent, total RNA is extracted from the cells.

[0054] 2. Extraction of hybridoma cell RNA and synthesis of cDNA: Total RNA from the hybridoma cell line 4F7D7 was extracted using Trizol and quantified. The extracted total cell RNA was used as a template to synthesize cDNA by reverse transcription using a reverse transcription kit.

[0055] 3. According to the results of the antibody subtype secreted by the hybridoma cell line 4F7D7, primers were designed. Using cDNA as a template, the corresponding primers were used to amplify the heavy chain gene V H and light chain gene V L The primer used for the heavy chain of the antibody was 4F7D7-V H F (whose sequence is shown in SEQ ID No.6: actagtcgacatggctgtcytrgbgctgytcytctg) and PrimerIgG (whose sequence is shown in SEQ ID No.7: cccaagcttccagggrccarkggataracngrtgg), and the primer used for the light chain of the antibody was 4F7D7-V L F (its sequence is shown in SEQ ID No. 8: actagtcgacatgaggrcccctgctcagwttyttggnwtctt) and PrimerKappa (its sequence is shown in SEQ ID No. 9: cccaagcttactggatggtgggaagatgga).

[0056] 4. The antibody heavy chain gene V amplified in step 3 H and light chain gene V L 1% agarose gel identification ( Figure 1 ). The amplified antibody heavy chain gene V H and light chain gene VL The PCR products were sequenced in one direction, and the antibody heavy chain gene V H and light chain gene V L variable region sequences.

[0057] 2. Design and synthesis of Claudin 16 single-chain antibody (4F7D7-scFv) gene fragment.

[0058] The heavy chain gene V H The variable region of the light chain gene V L The variable region of the antibody (whose amino acid sequence is shown in SEQ ID No. 4) was connected through a linker (whose amino acid sequence is shown in SEQ ID No. 5) to obtain the ScFv gene sequence, and Nanjing GenScript Biotechnology Co., Ltd. was commissioned to synthesize the gene sequence and connect it to the prokaryotic expression vector PET-28a.

[0059] 3. Transformation, expression and purification of 4F7D7-scFv single-chain antibody.

[0060] 1. Transform the PET-28a-4F7D7-scFv expression vector into BL21 colony-forming cells using the following steps:

[0061] Remove a tube (100 μl) of competent bacteria from a -70°C ultra-low temperature freezer, immediately melt it with your fingers, and then place it on ice for 5-10 minutes. Add 1 μL of the PET 28a-4F7D7-scFv expression vector, gently shake it, and place it on ice for 20 minutes. After gently shaking, place it in a 42°C water bath for 1-2 minutes for heat shock, then quickly return it to ice and let it stand for 3-5 minutes. In a clean bench, add 500 μl of LB medium to the above tube and gently mix it, then fix it to the spring frame of a shaker and shake it at 37°C for 45 minutes. In the clean bench, take 500 μl of the above transformation mixture and drop it onto a solid LB plate culture dish containing kanamycin. Spread it evenly with a sterile glass coating rod.

[0062] 2. Prokaryotic expression and purification of 4F7D7-scFv.

[0063] Select the recombinant bacteria with correct sequencing for expansion culture, draw 50μL of the correct sequenced bacterial solution into 5mL TB liquid culture medium (containing kanamycin), and culture overnight at 37℃ constant temperature shaker 180rpm. Inoculate the above overnight cultured bacterial solution into 100ml TB liquid culture medium (containing kanamycin) according to the inoculation amount of 1%, and shake at 180rpm, 37℃ until OD600 is 0.6. Then add IPTG 0.5mM to induce the culture, and induce the culture at 20℃, 180rpm overnight. Collect the bacterial solution and transfer it to a 50mL centrifuge tube. Centrifuge the bacterial solution at 4℃ 8000rpm for 5min to collect the bacteria. Wash the bacteria with pre-cooled PBS and repeat the centrifugation. Resuspend the bacteria with pre-cooled binding buffer and add 5mL binding buffer per gram of bacteria. Ultrasonication at 200W power on ice bath was used to disrupt the cells until the suspension became clear. The suspension was centrifuged at 10,000 rpm for 20 min at 4°C. The supernatant was collected as the crude 4F7D7-scFv extract and stored at 4°C for purification.

[0064] The prokaryotically expressed 4F7D7-scFv carries a 6xHis tag. Purification of the His-tagged 4F7D7-scFv was achieved by magnetic separation and elution with an imidazole gradient. The main steps are as follows:

[0065] (1) Mix the reagent bottle containing magnetic beads thoroughly, draw 400uL of magnetic beads into a centrifuge tube containing 1600uL of Binding Buffer (10mM imidazole), mix well, place on a magnetic separation stand for 10s, and discard the supernatant.

[0066] (2) Mix 2 mL of 4F7D7-scFv extract and 2 mL of Binding Buffer in equal volumes, add to the above centrifuge tube, invert to mix, shake for 30 minutes, and then place on a magnetic separation rack for magnetic separation, and discard the supernatant.

[0067] (3) Add 2 mL of Wash Buffer (50 mM imidazole) and wash repeatedly to remove the contaminating proteins on the magnetic beads. Measure the protein concentration using Nanodrop while washing until no protein flows out.

[0068] (4) Finally, wash the target protein bound to the magnetic beads with ELution Buffer (300 mM imidazole) and collect the eluate, which is the purified 4F7D7-scFv. Repeat the elution and measure the protein concentration using Nanodrop until no protein flows out.

[0069] (5) The magnetic beads were washed thoroughly with Elution Buffer and ultrapure water and stored at 4°C in 20% (v / v) ethanol for the next purification.

[0070] (6) The eluate obtained in step (4) was dialyzed with PBS for 48 h, and the target protein was collected to obtain purified 4F7D7-scFv, which was a 4F7D7-scFv single-chain antibody solution. SDS-PAGE showed that the size of the single-chain antibody was about 25 KD ( Figure 2 ).

[0071] (7) Finally, the protein concentration of the 4F7D7-scFv single-chain antibody solution was measured by a BCA protein quantification kit and was 5.56 mg / ml.

[0072] Example 2: Preparation of Claudin 16 immunomagnetic beads.

[0073] 4F7D7-scFv was coupled to EDC-activated carboxylated magnetic beads (0.8 μm) to prepare Claudin16 immunomagnetic beads. The specific steps are as follows:

[0074] 1. Activation of magnetic beads

[0075] Mix the magnetic bead sample and pipette 10 mg into a 1.5 mL centrifuge tube. Vortex to mix thoroughly, place on a magnetic separation rack for 3 minutes, and remove the supernatant. Add 500 μL of 4°C pre-chilled MES buffer (0.5 M MES, pH 5.0-6.0) to wash the magnetic beads. Vortex to mix thoroughly for 15 seconds, immediately separate by magnetic separation, and remove the supernatant. Repeat three times. Activate the magnetic beads by adding 500 μL of EDC solution (10 mg / mL, prepared in cold MES buffer). Place on a vertical mixer and activate at room temperature for 40 minutes.

[0076] 2. Antibody-Magnetic Bead Coupling (Preparation of Immunomagnetic Beads)

[0077] 1) The Claudin 16 single-chain antibody solution obtained in Example 1 was diluted with MES buffer to obtain a single-chain antibody dilution solution with a protein concentration of 5 mg / mL.

[0078] 2) Add 100 μg of the scFv dilution from step 1) to the centrifuge tube containing the activated magnetic beads and vortex mix for 15 seconds. Place on a vertical mixer and mix vertically at room temperature for 12-18 hours to allow the magnetic beads to couple to the 4F7D7-scFv.

[0079] 3) Add 500 μL of blocking solution (2% BSA, 100 mM ethanolamine, pH 8.0) to the magnetic beads obtained in step 2), vortex for 15 seconds, and react in a vertical mixer at room temperature for 4 hours to block the activated residues uncoupled to 4F7D7-scFv. The magnetic beads were enriched using a magnetic separation rack, and the supernatant was discarded.

[0080] 4) Add 500 μL of Storage Buffer (PBS solution containing 0.1% P300) to the magnetic beads obtained in step 3) in a centrifuge tube, mix thoroughly, and collect the magnetic beads using a magnetic separation rack. Discard the supernatant. Repeat this process three times.

[0081] 5) Add 500 μL of Storage Buffer to the magnetic beads obtained in step (4) in a centrifuge tube, mix thoroughly, and store at 4°C for later use.

[0082] Example 3: Enrichment and separation of Claudin16-positive cells using immunomagnetic beads.

[0083] 1. Add 500 μL of the cell sample to be separated to the above 1 ml of immunomagnetic beads, mix gently, and capture the cells on a shaker at 37°C for 30 minutes to allow the claudin16-positive cells to fully react with the immunomagnetic beads. Wash the immunomagnetic beads three times with PBST solution.

[0084] 2. Add 500 μL of elution buffer to the above magnetic beads, resuspend the magnetic beads, vortex to mix, react on a shaker at 37°C for 30 minutes to elute the cells, then use a magnetic separation rack for magnetic separation and save the supernatant. The supernatant is the separated Claudin16-positive cells.

[0085] 3. Wash the tubes with 500 μL of 0.01 M PBS (pH 7.4), vortex to mix, and remove the supernatant by magnetic separation. Repeat three times. Finally, resuspend the immunomagnetic beads in 100 μL of Storage Buffer in a centrifuge tube and store at 4°C until needed. As the immunomagnetic beads are used more frequently, the antigen capture rate decreases. To ensure complete antigen capture, the immunomagnetic beads were reused three times.

[0086] Example 4: Enrichment of Claudin 16 in isolated samples using immunomagnetic beads.

[0087] 1. Add 500 μL of claudin 16 protein solution to the immunomagnetic bead centrifuge tube, vortex to mix, and perform antigen capture on a shaker at 37°C for 30 minutes to allow the antigen (i.e., claudin 16 protein) to fully react with the immunomagnetic beads. After magnetic separation, retain the supernatant for determination of antigen capture efficiency. Wash the immunomagnetic beads three times with PBST solution.

[0088] 2. Add 500 μL of elution buffer to the above magnetic beads, resuspend the magnetic beads, vortex to mix, react on a shaker at 37°C for 30 minutes to elute the antigen, then use a magnetic separation rack for magnetic separation and save the supernatant. The supernatant is the separated Claudin16-positive sample.

[0089] 3. Wash the tubes with 500 μL of 0.01 M PBS (pH 7.4), vortex to mix, and remove the supernatant by magnetic separation. Repeat three times. Finally, resuspend the immunomagnetic beads in 100 μL of Storage Buffer in a centrifuge tube and store at 4°C until needed. As the immunomagnetic beads are used more frequently, the antigen capture rate decreases. To ensure complete antigen capture, the immunomagnetic beads were reused three times.

[0090] Example 5: Detection of claudin 16 content in samples using immunomagnetic beads.

[0091] 1. Preparation of chemiluminescence standard curve.

[0092] 1) Add 100 μl of claudin 16 standard protein solution of different concentrations to the immunomagnetic bead centrifuge tube, vortex to mix, and incubate on a shaker at 37°C for 30 min to allow the protein to fully react with the immunomagnetic beads. After magnetic separation, wash the immunomagnetic beads three times with PBST solution.

[0093] 2) Add 100 μL of horseradish peroxidase-labeled single-chain antibody (0.5 μg / ml) to each tube, incubate at 37°C for 30 min, and wash 3-5 times with 1× PBST solution.

[0094] 3) Add 100 μL of chemiluminescent substrate to each tube and measure the luminescence value on a chemiluminescence instrument (Table 1).

[0095] 4) Draw a standard curve based on protein concentration and luminescence value ( Figure 3 ).

[0096] 2. Detect the claudin 16 content in the sample.

[0097] 1) Add 100 μL of the sample to be tested to the immunomagnetic bead centrifuge tube, vortex to mix, and react on a shaker at 37°C for 30 minutes to allow the sample and protein to fully react with the immunomagnetic beads. After magnetic separation, wash the immunomagnetic beads three times with PBST solution.

[0098] 2) Add 100 μL of horseradish peroxidase-labeled single-chain antibody (0.5 μg / ml) to each tube, incubate at 37°C for 30 min, and wash 3-5 times with 1× PBST solution.

[0099] 3) Add 100 μL of chemiluminescent substrate to each well and measure the luminescence value on a chemiluminescence instrument.

[0100] 4) Calculate the claudin 16 content in the sample based on the calibration curve prepared above and the luminescence value obtained in step 3 (Table 1).

[0101] Table 1: Claudin 16 content in samples

[0102]

[0103]

[0104] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A single-chain antibody or antigen-binding portion thereof against Claudin 16, characterized in that: The single-chain antibody or its antigen-binding portion comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region are both composed of a complementary region determining region and a framework region; the complementary region determining region of the heavy chain variable region and the light chain variable region are both composed of CDR1, CDR2 and CDR3; The amino acid sequence of CDR1 of the heavy chain variable region is shown in positions 6-13 of SEQ ID No. 2; The amino acid sequence of CDR2 of the heavy chain variable region is shown in positions 31-38 of SEQ ID No. 2; The amino acid sequence of CDR3 of the heavy chain variable region is shown in positions 77-90 of SEQ ID No. 2; The amino acid sequence of CDR1 of the light chain variable region is shown in positions 143-149 of SEQ ID No. 2; The amino acid sequence of CDR2 of the light chain variable region is shown in positions 167-169 of SEQ ID No. 2; The amino acid sequence of CDR3 of the light chain variable region is shown in positions 206-214 of SEQ ID No.

2.

2. The single-chain antibody or antigen-binding portion thereof according to claim 1, wherein The amino acid sequence of the heavy chain variable region is shown as positions 1-101 of SEQ ID No. 2, and the amino acid sequence of the light chain variable region is shown as positions 117-222 of SEQ ID No.

2.

3. The single-chain antibody or antigen-binding portion thereof according to claim 1 or 2, wherein The amino acid sequence of the single-chain antibody or its antigen-binding portion is shown in SEQ ID No. 2; the amino acid sequences of the heavy chain variable region and the light chain variable region of the single-chain antibody are derived from the antibody secreted by the hybridoma cell line 4F7D7, the preservation number of the hybridoma cell line 4F7D7 is CCTCC NO: 2022233, the preservation date is July 19, 2022, the preservation unit is the China Center for Type Culture Collection, and the preservation unit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, on the campus of Wuhan University.

4. A biomaterial related to the single-chain antibody or antigen-binding portion thereof according to any one of claims 1 to 3, characterized in that: The biological material is any one of the following: B1) a nucleic acid molecule encoding the single-chain antibody or antigen-binding portion thereof according to any one of claims 1 to 3; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1); B4) a recombinant vector containing the expression cassette described in B2); B5) a recombinant microorganism containing the nucleic acid molecule described in B1); B6) a recombinant microorganism containing the expression cassette described in B2); B7) a recombinant microorganism containing the recombinant vector described in B3); B8) A recombinant microorganism containing the recombinant vector described in B4).

5. The biomaterial according to claim 4, characterized in that The nucleic acid molecule encoding the single-chain antibody or antigen-binding portion thereof according to any one of claims 1 to 3 in B1) is a gene encoding the single-chain antibody or antigen-binding portion thereof according to any one of claims 1 to 3, and the gene is a DNA molecule according to A) or B) below: A) The gene sequence encoding CDR1 of the heavy chain variable region is shown at positions 16-39 of SEQ ID No. 1; the gene sequence encoding CDR2 of the heavy chain variable region is shown at positions 91-114 of SEQ ID No. 1; the gene sequence encoding CDR3 of the heavy chain variable region is shown at positions 229-270 of SEQ ID No. 1; the gene sequence encoding CDR1 of the light chain variable region is shown at positions 427-447 of SEQ ID No. 1; the gene sequence encoding CDR2 of the light chain variable region is shown at positions 499-507 of SEQ ID No. 1; and the gene sequence encoding CDR3 of the light chain variable region is shown at positions 616-642 of SEQ ID No. 1; B) A DNA that is more than 90% identical to the DNA molecule defined in A) and encodes the single-chain antibody or the antigen-binding portion thereof.

6. Immunomagnetic beads, characterized in that The magnetic bead surface of the immunomagnetic beads is coupled with the single-chain antibody or antigen-binding portion thereof according to any one of claims 1 to 3.

7. A product for detecting the content of Claudin 16, characterized in that: The invention comprises the single-chain antibody or antigen-binding portion thereof according to any one of claims 1 to 3.

8. A method for enriching Claudin 16-positive cell products, characterized in that: Comprising the immunomagnetic beads according to claim 6.

9. The single-chain antibody or antigen-binding portion thereof according to any one of claims 1 to 3, the biomaterial according to claim 4 or 5, the immunomagnetic beads according to claim 6, the product according to claim 7, or the product according to claim 8, in any of the following uses: (1) Preparation of products for detecting Claudin 16; (2) Preparation of products for detecting Claudin 16 content; (3) Preparation of Claudin 16-positive enriched cell products.

Images