A β-amylase mutant and its application

Through site-directed mutation of β-amylase, the thermal stability and enzyme activity of the enzyme are improved, and the shortcomings of existing β-amylases in industrial production of maltose are solved, thereby achieving efficient maltose production and trehalose synthesis.

CN115851673BActive Publication Date: 2025-07-29JIANGNAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211130008.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-16
Publication Date
2025-07-29
Estimated Expiration
2042-09-16

AI Technical Summary

Technical Problem

The existing β-amylase has low enzyme activity, which cannot meet the needs of industrial production of maltose, and has insufficient thermal stability.

Method used

By performing site-directed mutations on the amino acid sequence of β-amylase, especially the glycine at 252 to threonine and the phenylalanine at 503 to serine, the mutant G252T, F503S and the combined mutant G252T/F503S are formed, which improves the thermal stability and enzyme activity of the enzyme.

Benefits of technology

The thermal stability of the mutant is significantly improved, the half-life reaches several times that of natural enzymes, and the enzyme activity is significantly improved. It is suitable for industrial production of maltose, and can be co-expressed with trehalose synthase to achieve a one-step synthesis of trehalose.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115851673B_ABST
    Figure CN115851673B_ABST
Patent Text Reader

Abstract

The present invention discloses a β - amylase mutant and its application, belonging to the technical field of genetic engineering. The β - amylase mutant provided by the present invention is obtained by site - directed mutagenesis of the amino acids at the 252nd and / or 503rd positions of the β - amylase with the amino acid sequence shown in SEQ ID NO.1. On the basis of natural β - amylase, through rational design and combined with site - directed mutagenesis biotechnology, the molecular structure of β - amylase is modified, the influence of the mutated residues on the thermal stability of the enzyme is analyzed, and finally the mutants G252T, F503S and the combined mutant G252T / F503S with improved stability are obtained. The β - amylase mutant of the present invention has significantly improved thermal stability while the enzyme activity is not affected. The β - amylase mutant of the present invention is more suitable for the application of catalyzing starch to produce maltose than the wild - type, and is more conducive to the flexibility of the production process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a β - amylase mutant and its application, belonging to the technical field of genetic engineering. Background Art

[0002] Maltose is a disaccharide formed by two glucose units linked by an α - 1,4 glycosidic bond. Due to the different positions of the C1 hydroxyl group, there are α - and β - two isomers. Maltose is sweet and delicious, rich in nutrition, and has the effects of detoxifying and beautifying the skin, invigorating the spleen and replenishing qi, moistening the lungs and relieving cough, etc. It is a food suitable for all ages and is mainly used in the processing of caramel color, candies, fruit juice beverages, wine - making, canned foods, soybean paste, and soy sauce.

[0003] β - amylase is an exo - type amylase widely present in higher plants such as barley, wheat, sweet potato, soybean, and microorganisms such as the genus Bacillus. It can sequentially cleave the α - 1,4 glycosidic bond from the non - reducing end of glycogen and starch to produce maltose. The enzyme activity of wild - type β - amylase is relatively low and cannot meet the requirements of industrial production. Obtaining a β - amylase mutant with increased enzyme activity has high industrial application value. Industrial production usually utilizes the combined action of β - amylase and pullulanase from plant sources or microbial sources to efficiently hydrolyze starch into maltose. Summary of the Invention

[0004] The purpose of the present invention is to solve the deficiencies of the prior art, provide a β - amylase mutant with improved thermal stability and increased enzyme activity, and use this mutant for the production of maltose.

[0005] The present invention provides a β - amylase mutant, using the β - amylase with the amino acid sequence shown in SEQ ID NO.1 as the starting sequence, and performing the following mutations:

[0006] (a) Mutating glycine at position 252 to threonine, named G252T;

[0007] (b) Mutating phenylalanine at position 503 to serine, named F503S;

[0008] (c) Mutating glycine at position 252 to threonine and mutating phenylalanine at position 503 to serine, named G252T / F503S.

[0009] The present invention also provides a gene encoding the β - amylase mutant.

[0010] The present invention also provides a recombinant expression vector carrying the gene.

[0011] In one embodiment, the expression vector includes, but is not limited to, pET series plasmids.

[0012] The present invention also provides a recombinant microorganism that expresses the β-amylase mutant or contains the gene.

[0013] In one embodiment, the recombinant microorganism uses Escherichia coli as the host and a pET series plasmid as the expression vector.

[0014] In one embodiment, the Escherichia coli includes but is not limited to Escherichia coli BL21(DE3).

[0015] The present invention also provides a method for improving the thermal stability of β-amylase, which is based on the amino acid sequence shown in SEQ ID NO.1, and mutates glycine at position 252 to threonine and / or phenylalanine at position 503 to serine.

[0016] The present invention also provides the application of the β-amylase mutant in the preparation of maltose.

[0017] In one embodiment, the application is to catalyze the synthesis of maltose from starch using the β-amylase mutant.

[0018] Beneficial effects:

[0019] 1) Based on natural β-amylase, through rational design and combined with site-directed mutagenesis biotechnology, the molecular structure of β-amylase was modified. The effects of the mutated residues on enzyme activity were analyzed, and finally mutant strains with increased enzyme activity (G252T, F503S and the combined mutant G252T / F503S) were obtained.

[0020] 2) The half-life of natural β-amylase is 16.2 min. The half-life of the β-amylase mutant G252T / F503S provided by the present invention reaches 84.1 min at 45°C, which is 5.2 times that of natural β-amylase; the half-life of the β-amylase mutant G252T reaches 35.4 min at 45°C, which is 2.2 times that of natural β-amylase; the half-life of the β-amylase mutant F503S reaches 33.6 min at 45°C, which is 2.1 times that of natural β-amylase.

[0021] 3) The enzyme activity of the β-amylase mutant provided by the present invention is significantly improved. Under the condition of 40°C, with the relative enzyme activity of the control group being 100%, the mutant G252T / F503S, G252T, and F503S have relative enzyme activities of 151.2%, 132.4%, and 124.6% respectively.

[0022] 4) The β-amylase mutant obtained in the present invention is more suitable for the application of catalyzing starch to produce maltose than the wild type, which is more conducive to the flexibility of the production process.

[0023] 5) The co-expression strain of the β-amylase mutant and trehalose synthase provided by the present invention can achieve the one-step synthesis of trehalose from starch, which is convenient and fast and suitable for industrial production. Description of the Drawings

[0024] Figure 1 It is the test result of the half-life of wild-type β-amylase and β-amylase mutants G252T, F503S, and G252T / F503S at 50 °C.

[0025] Figure 2 It is the test result of the enzyme activity of wild-type β-amylase and β-amylase mutants G252T, F503S, and G252T / F503S at different pH values.

[0026] Figure 3 It is the test result of the enzyme activity of wild-type β-amylase and β-amylase mutants G252T, F503S, and G252T / F503S at different temperatures. Detailed Embodiments

[0027] The technical solution of the present invention will be further described below in conjunction with the drawings and specific embodiments. In the following embodiments, the media and formulations involved are as follows:

[0028] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl.

[0029] LB solid medium: Add 2% agar to the LB liquid medium.

[0030] The detection methods involved in the following embodiments are as follows:

[0031] β-Amylase enzyme activity assay method: Take 100 μL of pure enzyme with a concentration of 300 μg / mL and add it to a 900 μL reaction system containing 10 g / L soluble starch in 50 mM pH 6.0 sodium hydrogen phosphate-sodium dihydrogen phosphate buffer; react at 40 °C in a water bath for 10 min, then terminate the enzymatic reaction in a boiling water bath at 100 °C for 10 min, centrifuge to take the supernatant, dilute it to 10 mg / mL, and detect the content of maltose in the reaction solution by HPLC.

[0032] Definition of enzyme activity: Define the amount of enzyme required to catalyze the formation of 1 μmol of maltose from starch per minute under the conditions of 40 °C and pH 8.5 as one enzyme activity unit U.

[0033] Specific enzyme activity: Define as the enzyme activity U / mg of unit protein.

[0034] Example 1 Construction of a recombinant plasmid containing a β-amylase mutant

[0035] (1) Construction of recombinant plasmid containing wild-type β-amylase

[0036] Chemically synthesize the wild-type β-amylase gene with the nucleotide sequence shown in SEQ ID NO.2. After digestion with HindⅢ and EcoRⅠ enzymes and ligation with the pET-28a vector, the recombinant vector pET-28a-amyM carrying the wild-type β-amylase gene is prepared.

[0037] (2) Construction of recombinant vectors containing mutants

[0038] Using the whole plasmid PCR technique, perform site-directed mutagenesis with the recombinant vector pET-28a-amyM prepared in step (1) as the template to obtain recombinant plasmids pET-28a-amyMG201I, pET-28a-amyMG252T, pET-28a-amyMK351A, pET-28a-amyMF503S, pET-28a-amyMA316S, pET-28a-amyMG252T / F503S containing mutant genes.

[0039] The designed primer sequences are as follows:

[0040] G201I_F: GCCCTGCAATTGAAATTCGTTATCCGTCTTATAC

[0041] G201I_R: GAATTTCAATTGCAGGGCCTCCTGA

[0042] G252T_F: GGCATGGACCACCAATTTAACATCTACATCGC

[0043] G252T_R: ATTGGTGGTCCATGCCTGATTAACGC

[0044] K351A_F: ACGCGTTTGCGACGGCTAAATTAGATATCACC

[0045] K351A_R: TAGCCGTCGCAAACGCGTCCAAAAGCC

[0046] F503S_F: CCGTTTATTCGCCTGCCAGTCAAAGTG

[0047] F503S_R: TGGCAGGCGAATAAACGGTTCCTCTCCAAT

[0048] A316S_F: CAATTGGTTCGAAAGTGGCAGGAATCCATTG

[0049] A316S_R: CCACTTTCGAACCAATTGGTACGTTAAAAGTG

[0050] Among them, the PCR amplification program was set as follows: First, pre-denature at 95°C for 5 min; then enter 30 cycles; denature at 95°C for 30 s, anneal at 72°C for 40 s, extend at 58°C for 3.5 min, and hold at 4°C. The PCR products were detected by 0.8% agarose gel electrophoresis.

[0051] The final amplified fragment was treated with Dpn I enzyme in a 37°C water bath for 1 h to remove the template, and then the PCR mixture was chemically transformed into E. coli BL21 competent cells. The transformation solution was spread on an LB solid medium containing kanamycin (50 μg / mL), and the plasmid was extracted and sequenced. The sequencing work was completed by Genewiz Suzhou. The verified correct recombinant plasmids were named pET-28a amyMG201I, pET-28a amyMG252T, pET-28a amyMK351A, pET-28a amyMF503S, pET-28a amyMA316S, and pET-28a amyMG252T / F503S, respectively.

[0052] Example 2 Construction of Recombinant Escherichia coli Expressing β-Amylase Mutants

[0053] The recombinant plasmids pET-28a amyMG201I, pET-28a amyMG252T, pET-28a amyMK351A, pET-28a amyMF503S, pET-28a amyMA316S, and pET-28a amyMG252T / F503S obtained in Example 1 were respectively transformed into E. coli BL21 competent cells, and the genetically engineered bacteria: E. coli / pET-28a amyMG201I, E. coli / pET-28a amyMG252T, E. coli / pET-28a amyMK351A, E. coli / pET-28a amyMF503S, E. coli / pET-28a amyMA316S, and E. coli / pET-28a amyMG252T / F503S were respectively prepared.

[0054] Example 3 Expression of β-Amylase Mutants

[0055] The genetically engineered bacteria prepared in Example 2 were respectively inoculated into 10 mL of LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C and 200 rpm to prepare seed solutions;

[0056] The prepared seed solution was transferred to 100 mL of LB liquid medium containing 50 μg / mL kanamycin at an inoculation amount of 2% (v / v), and cultured at 37 °C and 200 rpm until the OD 600 reached 1.0. IPTG with a final concentration of 1 mM was added, and the culture was continued at 30 °C for 20 h to obtain a fermentation broth. 100 mL of the prepared fermentation broth was centrifuged at 8000 rpm and 4 °C for 5 min to obtain cell pellets. After washing the cells 3 times, they were resuspended in 10 mL of PB buffer (pH 6.0). The resuspended cells were treated with an ultrasonic disruptor in an ice bath for 30 min, and then centrifuged for 30 min (8000×g, 4 °C). The supernatant was taken to obtain a crude enzyme solution.

[0057] The supernatant was filtered through a 0.22 μm filter, and then further loaded onto a 1 mL Ni affinity column, which was pre-equilibrated with 50 mM washing buffer (20 mM Tris and 500 mM NaCl, pH 7.4), and then eluted with an elution buffer (20 mM Tris, 500 mM NaCl and 500 mM imidazole, pH 7.4) using a linear gradient to elute unbound proteins and β-amylase; pure enzyme solutions of wild-type amyM, mutant G201I, mutant G252T, mutant G252T / F503S, mutant F503S, mutant K351A, and mutant A316S were respectively prepared.

[0058] The above pure enzyme solutions were respectively analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE), as Figure 1 shown. The results showed that there was an obvious band at 76.81 kDa, indicating the expression of β-amylase.

[0059] To test the effect of site-directed mutagenesis on enzyme activity, the prepared pure enzyme solution was assayed for enzyme activity according to the method in the implementation manner. Using wild-type amyM as a control, its enzyme activity was 42.5 U / mg. The calculation method of relative enzyme activity was: under the same conditions, the enzyme activity of this enzyme was divided by the enzyme activity of the wild type. The results are shown in Table 1. The relative enzyme activities of mutant G252T and F503S and their combined mutants were all higher than that of the wild type. Among them, the enzyme activity of the combined mutant G252T / F503S was increased by 51.2% compared with the wild type.

[0060] Table 1 Relative enzyme activities of different β-amylases at 40 °C

[0061]

[0062] Example 4 Enzymatic property test of amyM mutants

[0063] 1. Thermal stability

[0064] Respectively take the pure enzyme solutions of wild - type amyM, mutant G252T, mutant F503S, and mutant G252T / F503S prepared in Example 3, place them in a 50°C constant - temperature water bath, sample once every 20 minutes, measure their residual enzyme activity according to the method for measuring trehalose synthase enzyme activity, and calculate the half - life (t 1 / 2 ), compare their thermal stabilities, and the test results are as shown in Figure 1 and Table 3.

[0065] Table 3 Half - lives of different β - amylases at 50°C

[0066]

[0067] Figure 1 It shows that the enzyme activity decreases continuously with the increase of time. The enzyme activities of single - mutation and double - mutation are higher than that of the wild - type throughout the process. The thermal - stability half - lives of the two groups of single - mutations have been significantly improved. The half - life of the double - mutation can reach 84.1 h, which is 5.2 times that of the wild - type.

[0068] 2. Optimal pH

[0069] Respectively place the pure enzyme solutions of wild - type amyM, mutant G252T, mutant F503S, and mutant G252T / F503S prepared in Example 3 in 50 mM buffer containing sodium dihydrogen phosphate / disodium hydrogen phosphate (pH 5.0 - 9.0), and measure the enzyme activity with the initial enzyme activity of the non - incubated sample as 100%. The results are shown in Figure 2 .

[0070] The relative enzyme activities of mutant G252T / F503S are higher than those of the wild - type enzyme at pH 5.0 - 9.0, and the optimal pH is 8.0, which is similar to that of the wild - type.

[0071] 3. Optimal temperature

[0072] Respectively place the pure enzyme solutions of wild - type amyM, mutant G252T, mutant F503S, and mutant G252T / F503S prepared in Example 3 in 50 mM buffer containing sodium dihydrogen phosphate / disodium hydrogen phosphate (pH 8.0), set the reaction temperature to 20 - 50°C, and measure the enzyme activity with the initial enzyme activity of the non - incubated sample as 100%. The results are shown in Figure 3 .

[0073] As can be seen from Figure 3 , the optimal temperature of the mutant is 40°C, which is similar to that of the wild - type.

[0074] Although the present invention has been disclosed above in the preferred embodiments, it is not intended to limit the present invention. Anyone skilled in this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A β-amylase mutant, characterized in that, Starting from the β-amylase with the amino acid sequence shown in SEQ ID NO.1, the following mutations were made: (a) Mutating the glycine at position 252 to threonine; (b) Mutating the glycine at position 252 to threonine and mutating the phenylalanine at position 503 to serine.

2. A gene encoding the β-amylase mutant according to claim 1.

3. A recombinant expression vector carrying the gene according to claim 2.

4. The recombinant expression vector according to claim 3, characterized in that, The expression vector is a pET series plasmid.

5. A recombinant microorganism, characterized in that, Expressing the β-amylase mutant according to claim 1, or containing the gene according to claim 2.

6. The recombinant microorganism according to claim 5, wherein, Using Escherichia coli as the host bacterium and a pET series plasmid as the expression vector.

7. The recombinant microorganism according to claim 6, characterized in that, Using Escherichia coli BL21(DE3) as the host.

8. A method for improving the thermal stability of β-amylase, characterized in that, Based on the amino acid sequence shown in SEQ ID NO.1, mutating the glycine at position 252 to threonine, or; Based on the amino acid sequence shown in SEQ ID NO.1, mutating the glycine at position 252 to threonine and mutating the phenylalanine at position 503 to serine.

9. Use of the β-amylase mutant according to claim 1 in the preparation of maltose.

10. Use of the β-amylase mutant according to claim 1 or the recombinant microorganism according to any one of claims 5 to 7 in the hydrolysis of soluble starch in the food field.

Citation Information

Patent Citations

  • Amylase mutant having improved heat stability and construction method and application thereof

    CN103789285A

  • Beta-amylase mutant with improved heat stability

    CN107164345A