Primer probe set and method for detecting content of mRNA tumor vaccine in in vivo tissue

Abstract

The application discloses a primer probe set and a method for detecting the content of mRNA tumor vaccine in in-vivo tissues, wherein the primer probe set comprises a forward primer with a sequence as shown in SEQ ID NO. 1, a reverse primer with a sequence as shown in SEQ ID NO. 3, and a probe with a sequence as shown in SEQ ID NO. 4, or a forward primer with a sequence as shown in SEQ ID NO. 2, a reverse primer with a sequence as shown in SEQ ID NO. 3, and a probe with a sequence as shown in SEQ ID NO. 4. The application can accurately detect the content of mRNA tumor vaccine in in-vivo tissues by using a specific primer pair probe set and adopting a fluorescent quantitative PCR method, and the detection method has high sensitivity and high reproducibility.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and more specifically, this invention relates to a primer and probe set and method for detecting the content of mRNA tumor vaccines in tissues in vivo. Background Technology

[0002] In the face of life-threatening diseases such as cancer, vaccination is currently the most effective method for prevention and treatment. Tumor immunotherapy activates the body's own immune system to kill tumor cells, causing little or no harm to normal cells, and has great potential in cancer treatment. Tumor vaccines, as an important strategy in tumor immunotherapy, deliver tumor-associated antigens into antigen-presenting cells (APCs), thereby activating cellular immune responses and inhibiting tumor growth.

[0003] mRNA tumor vaccines deliver a small mRNA gene fragment encoding a target protein into cells, where it is translated into a protein in the cytoplasm. This protein then activates antigen-specific cytotoxic T lymphocytes (APCs), inducing their activation and proliferation to eliminate or inhibit cancer cells. mRNA tumor vaccines are a promising type of vaccine developed based on gene therapy, and they hold broad application prospects in the treatment of tumors and their infectious diseases.

[0004] When mRNA tumor vaccines are injected into the body, it is necessary to detect their content in tissues. Therefore, it is very meaningful to establish a detection method with high sensitivity and good reproducibility. Summary of the Invention

[0005] Based on this, one of the objectives of the present invention is to provide primers and probes for detecting the content of mRNA tumor vaccines in tissues in vivo. Using the primers and probes, the content of mRNA tumor vaccines in tissues in vivo can be detected with high sensitivity and high reproducibility.

[0006] The specific technical solutions for achieving the above-mentioned objectives include the following:

[0007] A primer-probe set for detecting the content of mRNA tumor vaccines in tissues in vivo, comprising: a forward primer with the sequence shown in SEQ ID NO.1, a reverse primer with the sequence shown in SEQ ID NO.3, and a probe with the sequence shown in SEQ ID NO.4.

[0008] A primer-probe set for detecting the content of mRNA tumor vaccine in tissues in vivo, comprising: a forward primer with the sequence shown in SEQ ID NO.2, a reverse primer with the sequence shown in SEQ ID NO.3, and a probe with the sequence shown in SEQ ID NO.4.

[0009] In some embodiments, the 5' end of the probe is marked with FAM and the 3' end of the probe is marked with MGB.

[0010] The present invention also provides the application of the primer and probe set described above for detecting the content of mRNA tumor vaccines in tissues in vivo in the preparation of a kit for detecting the content of mRNA tumor vaccines in tissues in vivo.

[0011] The present invention also provides a kit for detecting the content of mRNA tumor vaccines in tissues in vivo, comprising the above-mentioned primer and probe set.

[0012] In some embodiments, the working concentrations of the forward and reverse primers are both 200 nM to 500 nM, and the working concentration of the probe is 100 nM to 300 nM.

[0013] In some embodiments, the kit further includes Mg 2+ Mix buffer and Taq enzyme.

[0014] The present invention also provides a method for detecting the content of mRNA tumor vaccines in tissues in vivo, comprising the following steps: using RNA from tissues in vivo as a template, performing a real-time PCR amplification reaction using the above-mentioned kit.

[0015] In some embodiments, the reaction system of the quantitative PCR amplification reaction includes: Mg 2+ Mix buffer containing dNTPs, Taq enzyme, and primer / probe set.

[0016] In some embodiments, the reaction program for the real-time PCR amplification reaction includes: 55°C, 10 min, 94°C, 2 min; 94°C, 15 s, 58°C, 30 s, 68°C, 15 s, 40 cycles.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] In this invention, based on years of rich experimental experience, the inventors designed a large number of primer and probe sets for certain sequence regions in mRNA tumor vaccines, and screened two primer and probe sets from them. They found that by using these primer and probe sets and employing the real-time PCR method, the content of mRNA tumor vaccines in tissues in vivo can be accurately detected. Moreover, the detection method of this invention has high sensitivity and high reproducibility. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of the structure of the mRNA tumor vaccine sequence in this invention.

[0020] Figure 2This is the standard curve for detection using primer-probe set F1+R1+P in Experiment Example 1 of this invention.

[0021] Figure 3 This is the standard curve for detection using the primer-probe set F2+R1+P in Experiment Example 1 of this invention.

[0022] Figure 4 This is the standard curve for detection using primer-probe set F1+R2+P in Experiment Example 1 of this invention.

[0023] Figure 5 This is the standard curve for detection using the primer-probe set F2+R2+P in Experiment Example 1 of this invention.

[0024] Figure 6 The results (Copies / mg) show the content of the mRNA tumor vaccine in various tissues of mice in Experiment Example 3 of this invention.

[0025] Figure 7 The results (pg / mg) show the content of the mRNA tumor vaccine in various tissues of mice in Experiment Example 3 of this invention.

[0026] Figure 8 The results (pg / mg) show the content of the mRNA tumor vaccine in various tissues of tumor-bearing and non-tumor-bearing mice in Experiment Example 4 of this invention.

[0027] Figure 9 The results (Copies / mg) show the content of the mRNA tumor vaccine in various tissues of tumor-bearing and non-tumor-bearing mice in Experiment Example 4 of this invention. Detailed Implementation

[0028] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0029] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0030] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products unless otherwise specified.

[0031] In this invention, the mRNA tumor vaccine sequence has the following characteristics: Figure 1 The structure of the miRNA tumor vaccine sequence includes a 5' UTR, CDS, hinge linker, MITD, 3' UTR, and PolyA: polyadenylated tail. Specifically, 5' UTR is the 5' untranslated region; CDS is the vaccine coding region; L is the hinge linker; MITD is the MHC class I transport domain; 3' UTR is the 3' untranslated region; and PolyA is the polyadenylated tail.

[0032] Hinge Linker (SEQ ID No. 5):

[0033] GGCGGCAGTGGCGGCGGGGGTTCCGGAGGT

[0034] MITD (SEQ ID No. 6):

[0035] ATCGTGGGCATTGTTGCTGGCCTGGCTGTCCTAGCAGTTGTGGTCATCGGAGCTGTGGTCGCTACCGTGATGTGTAGGAGGAAGAGTTCAGGTGGAAAAGGAGGGAGCTACTCTCAGGCTGCGAGCAGCGACAGTGCCCAGGGCTCTGATGTGTCTCTCACAGCTTAA

[0036] Based on years of experimental experience, the inventors designed two specific primer-probe sets by selecting specific sequence regions in mRNA tumor vaccines. Specific primer-probe set 1 can identify the hinge linker (SEQ ID No. 5) and MITD (SEQ ID No. 6) connection region (possessing detection specificity, enabling precise detection of the distribution of mRNA tumor vaccines in vivo), including the forward primer SEQ ID No. 1, the reverse primer SEQ ID No. 3, and the probe SEQ ID No. 4. Specific primer-probe set 2 can identify the MITD (MHC class I transport domain) region in mRNA vaccines (the MITD sequence is not altered in different tumor vaccine designs, thus achieving broad-spectrum detection), including the forward primer SEQ ID No. 2, the reverse primer SEQ ID No. 3, and the probe SEQ ID No. 4.

[0037] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0038] Example 1: Specific primer and probe set for detecting the content of mRNA tumor vaccine in tissues in vivo

[0039] The specific primer and probe set for detecting the content of mRNA tumor vaccines in tissues in vivo consists of two sets: F1 / R1 / P and F2 / R1 / P. The specific sequences are as follows:

[0040] Primer-probe set 1:

[0041] F1: 5'-GGGTTCCGGAGGTATCGTG-3' (SEQ ID No. 1)

[0042] R1: 5'-CCTCCTTTTTCCACCTGAACTCT-3' (SEQ ID No. 3)

[0043] P: 5'-TCACGGTAGCGACCACAGCTCCGAT-3' (SEQ ID No. 4)

[0044] The probe has a FAM fluorescent group labeled at 5' and an MGB labeled at 3'.

[0045] Primer and probe set 2:

[0046] F2: 5'-CCTGGCTGTCCTAGCAGT-3' (SEQ ID No. 2)

[0047] R1: 5'-CCTCCTTTTTCCACCTGAACTCT-3' (SEQ ID No. 3)

[0048] P: 5'-TCACGGTAGCGACCACAGCTCCGAT-3' (SEQ ID No. 4)

[0049] The probe has a FAM fluorescent group labeled at 5' and an MGB labeled at 3'.

[0050] Example 2: Method for detecting the content of mRNA tumor vaccine in tissues in vivo

[0051] Using the two primer / probe sets F1 / R1 / P and F2 / R1 / P from Example 1, respectively, an RT-PCR kit (Invitrogen, Cat#12574-026; its components include: reagents required for RT-PCR reaction, specifically Mg) was used. 2+ The RT-PCR amplification reaction (using a mix buffer containing dNTPs and Taq polymerase) can be performed to detect the content of mRNA tumor vaccines in tissues in vivo. The RT-PCR reaction system is shown in Table 1. The RT-PCR reaction procedure is shown in Table 2.

[0052] Table 1 Reaction System

[0053]

[0054] Table 2 Reaction Procedure

[0055]

[0056] Experimental Example 1: Screening of Specific Primer-Probe Sets

[0057] This experiment designed a large number of primer-probe sets, and selected the following four sets for experimentation:

[0058] 1. F1 / R1 / P, the sequence is SEQ ID No. 1 / SEQ ID No. 3 / SEQ ID No. 4.

[0059] 2. F2 / R1 / P, the sequence is SEQ ID No.2 / SEQ ID No.3 / SEQ ID No.4.

[0060] 3. F1 / R2 / P, the sequence is SEQ ID No.1 / SEQ ID No.7 / SEQ ID No.4.

[0061] R2: 5'-TCGCAGCCTGAGAGTAGC-3' (SEQ ID No. 7)

[0062] 4. F2 / R2 / P, the sequence is SEQ ID No.2 / SEQ ID No.7 / SEQ ID No.4.

[0063] R2: 5'-TCGCAGCCTGAGAGTAGC-3' (SEQ ID No. 7)

[0064] The standard curves for the above four primer-probe sets were determined using standard samples, as follows:

[0065] Take out the frozen RNA standard (STD, Shenzhen Xinhe Biomedical Technology Co., Ltd.) and thaw it on ice. Vortex to mix well, then briefly centrifuge and dilute with DEPC water to the corresponding concentration in Table 3.

[0066] Table 3

[0067]

[0068] Using four different primer and probe sets, and employing the detection method of Example 2, RT-PCR amplification was performed on RNA standards of different concentrations (Table 3). Standard curves were plotted based on the Cq. values ​​and corresponding copy number logarithmic values ​​generated by different concentrations of standards, and the calculation formula for the standard curves was obtained. The standard curves are shown in the figure below. Figure 1 , Figure 2 , Figure 3 and Figure 4 As shown.

[0069] Calculate r of the standard curve 2 and the amplification efficiency of the reaction, standard curve r 2 A standard curve is considered acceptable if the coefficient of determination is ≥0.98, the amplification efficiency is within the range of 90% to 110%, the backcalculation value is within ±15% of the labeled value, the lower limit of quantitation is within ±20%, and there are at least 6 effective gradients.

[0070] from Figures 2-3 It can be seen that, using primer / probe set 1 (F1+R1+P) and primer / probe set 2 (F2+R1+P), the r of its standard curve is... 2 The amplification efficiency of the reaction meets the requirements and can be used for the detection of the mRNA tumor vaccine content in tissues in vivo. Among them, primer-probe set 1 (F1+R1+P) showed the best performance.

[0071] from Figures 4-5 It can be seen that, using primer and probe set 3 (F1+R2+P) and primer and probe set 4 (F2+R2+P), the r of its standard curve is... 2 The amplification efficiency of the reaction did not meet the requirements, therefore, it could not be used for the detection of the content of the mRNA tumor vaccine in tissues in vivo.

[0072] Experimental Example 2: Methodological Validation of the Detection Method of the Present Invention

[0073] In this experimental example, the accuracy, precision, selectivity, robustness, and recovery rate of the detection method of the present invention were tested using standard samples and primer probe set 1 (F1+R1+P), demonstrating the reliability of the detection method of the present invention.

[0074] Specifically, it includes:

[0075] 1. Accuracy and Precision

[0076] The accuracy and precision of the quantitative detection results of the standard samples were analyzed.

[0077] Accuracy calculation method: Accuracy = (Measured value / True value) * 100%;

[0078] Precision calculation method: Coefficient of variation (CV) = Standard deviation (SD) / Arithmetic mean of the calculation results (X) * 100%;

[0079] The mean accuracy of each standard sample is generally within ±15%, and the accuracy of the lower limit of quantitation is within ±20%; the coefficient of variation is generally no more than 15%, and the coefficient of variation of the lower limit of quantitation shall not exceed 20%.

[0080] The results of the accuracy and precision verification are shown in Table 4.

[0081] Table 4

[0082]

[0083] 2. Selectivity

[0084] One normal C57BL / 6J mouse was selected, and the liver tissue was removed after euthanasia. The liver tissue was added to a centrifuge tube at a rate of 15 mg / tube, and divided into 3 tubes. 1 μL of 1×10⁻⁶ oz. solution was added to tube 1. 9 Copies / μL of standard, add 1μL of 1×10⁻⁶ standard to tube 2. 6 Copies / μL of standard were added to tube 3 with 1μL of DEPC water. RNA was then extracted using an RNA extraction kit (TIANGEN, Cat#DP431) and the concentration was determined.

[0085] The kit (primers and probes F1+R1+P) and detection method of Example 2 were used for RT-PCR amplification and detection. The results are shown in Table 5.

[0086] Table 5

[0087]

[0088] Note: PC: Positive control, the test well contains standard STD1; NC: Negative control, the test well contains DEPC water; N / A: indicates that the target amplification product was not detected.

[0089] The results in Table 5 show that no specific amplification products were detected in tube 3, while specific amplification products were detected in tubes 1 and 2, indicating that the primer-probe set in this invention has specific selectivity.

[0090] 3. Durability

[0091] The durability of the primer-probe set was verified by examining its specificity and universality across different sites, based on liver tissue and then by repeating the assay in peripheral blood.

[0092] Three normal C57BL / 6J mice were selected, and peripheral blood (1 mL / mouse) was collected from the orbital venous plexus. The mouse blood was centrifuged, and the serum was mixed. The serum was then divided into three tubes at a rate of 140 μL / tube. 1 μL of 1×10⁻⁶ serum was added to tube 1. 9 Copies / μL of standard, add 1μL of 1×10 to tube 2. 6 Copies / μL of standard were added to tube 3 with 1μL of DEPC water. RNA was then extracted using an RNA extraction kit (TIANGEN, Cat#DP315-R) and the concentration was determined.

[0093] The kit (primers and probes F1+R1+P) and detection method of Example 2 were used for RT-PCR amplification and detection. The results are shown in Table 6.

[0094] Table 6

[0095]

[0096] Note: PC: Positive control, the test well contains standard STD1; NC: Negative control, the test well contains DEPC water; N / A: indicates that the target amplification product was not detected.

[0097] The results in Table 6 show that no specific amplification products were detected in tube 3, while specific amplification products were detected in tubes 1 and 2, indicating that the primers and probes in this invention are robust.

[0098] 4. Recovery rate

[0099] Several normal C57BL / 6J mice were used, and peripheral blood (1 mL / mouse) was collected from the orbital venous plexus. The mouse blood was centrifuged to obtain serum, which was then aliquoted into 10 1.5 mL centrifuge tubes at a concentration of 140 μL / tube. Different concentration gradients of standard STD were added to the corresponding aliquoted serum centrifuge tubes, and an equal volume of DEPC water was added to the control tubes. RNA was extracted from the serum sample tubes containing STD, and RT-PCR amplification was performed using the kit (primers and probes F1+R1+P) and detection method described in Example 2.

[0100] Substitute the measured Cq. values ​​into the standard curve to calculate the corresponding detection values ​​(Copies), and then calculate the spiked recovery rate.

[0101] Spiked recovery rate = (Spiked sample value - Sample value) / Spiked amount × 100%

[0102] The results are shown in Table 7.

[0103] Table 7

[0104]

[0105] As shown in Table 7, the average recovery rate was 22.33%.

[0106] Experimental Example 3: Detection of drug content in various tissues of mice after a single dose

[0107] The detection method of this invention was used to detect the drug content in various tissues of mice that had received a single dose of mRNA tumor vaccine (manufactured by Shenzhen Xinhe Biomedical Technology Co., Ltd., product number XH101m). This verified the in vivo detection effectiveness of the method of this invention.

[0108] Specifically, the following steps are included:

[0109] 1. A single dose of 50 μg was administered to several normal C57BL / 6J mice. Then, at 2h, 6h, 24h, 48h, 72h, 120h, and 168h, one male and one female mouse were taken out and peripheral blood (0.5-1 mL / mouse) was collected from the orbital venous plexus. Serum was then separated.

[0110] 2. After dissecting the euthanized mouse, remove the corresponding tissues (heart, liver, spleen, lung, kidney, mesenteric lymph nodes, abdominal lymph nodes, skin at the injection site, and skin on the contralateral side) and grind them.

[0111] 3. RNA was extracted from the obtained serum and tissues and the concentration was measured. The samples were then frozen at -20℃ for later use.

[0112] 4. After all time points of samples have been processed, RT-PCR detection was performed uniformly according to the kit (primers and probes are F1+R1+P) and method in Example 2;

[0113] 5. Substitute the test results into the standard curve (Table 4, Cq. = -3.155 × Log). STD The mRNA tumor vaccine content in various tissues in the body was obtained by calculation using (+40.798).

[0114] The results are as follows Figure 6 and Figure 7 As shown in the figure, the results of tissue analysis at different time points in mice showed that: except for the control skin, mRNA was detected in the skin, blood, and various tissues at the injection sites. The mRNA abundance was highest in the skin and lymph nodes at the injection sites, significantly higher than in other tissues, and remained for a longer period of time. In most of the sites where mRNA was detected, the peak value was reached at 2 hours and then decreased over time. Except for the control skin, blood, and lymph nodes, the spleen had a higher detection value than other tissues.

[0115] The results of this study demonstrate the metabolic characteristics of the drug in animals, providing a reference for future clinical applications.

[0116] Example 4: Detection of drug content in various tissues of tumor-bearing and non-tumor-bearing mice after a single drug administration.

[0117] Using the detection method of this invention, the drug content in various tissues of tumor-bearing and non-tumor-bearing mice that received a single dose of mRNA tumor vaccine (manufactured by Shenzhen Xinhe Biomedical Technology Co., Ltd., product number XH101m) was detected to investigate whether there were differences. The specific steps included:

[0118] 1. In tumor-bearing mice (tumors were induced in mice using conventional methods), the tumor size reached 100 mm. 3 At approximately 10:00 AM, tumor-bearing mice and non-tumor-bearing mice were given a single dose of 10 μg. Then, at 6:00 AM, 24:00 AM, 72:00 AM, and 168:00 AM, one mouse was removed from each mouse, and peripheral blood (0.5-1 mL / mouse) was collected from the orbital venous plexus. Serum was then separated.

[0119] 2. After dissecting the euthanized mouse, remove the corresponding tissues (liver, spleen, lungs, lymph nodes, skin at the injection site, skin on the contralateral side, and tumor tissue) and grind them.

[0120] 3. RNA was extracted from the obtained serum and tissues and the concentration was measured. The samples were then frozen at -20℃ for later use.

[0121] 4. After all time points of samples have been processed, RT-PCR detection was performed uniformly according to the kit (primers and probes are F1+R1+P) and method in Example 2;

[0122] 5. Substitute the test results into the standard curve (Table 4, Cq. = -3.155 × Log). STDThe mRNA tumor vaccine content in various tissues in the body was obtained by calculation using (+40.798).

[0123] The results are as follows Figures 8-9 As shown in the figure, the results of tissue analysis at different time points in tumor-bearing and non-tumor-bearing mice showed that the mRNA vaccine did not cause differences in tissue distribution between tumor-bearing and non-tumor-bearing mice. Except for the control skin, mRNA was detected in the skin, blood, and various tissues at the injection site. The mRNA abundance was highest in the skin at the injection site, significantly higher than in other tissues, and remained for a longer period of time. In addition, the mRNA distribution in the spleen was also higher than in other tissues, indicating that the spleen, as an immune organ, can effectively exert the vaccine effect and activate specific immunity.

[0124] The results of this experiment demonstrate that drug distribution is not affected by tumors, and non-tumor-bearing animals can be used instead of tumor-bearing animals to evaluate drug pharmacokinetics.

[0125] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0126] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. The application of a primer-probe set in the preparation of a kit for detecting the content of mRNA tumor vaccines in in vivo tissues, wherein the primer-probe set comprises: The forward primer with the sequence shown in SEQ ID NO.1, the reverse primer with the sequence shown in SEQ ID NO.3, and the probe with the sequence shown in SEQ ID NO.4; Alternatively, the primer-probe set may include: a forward primer with the sequence shown in SEQ ID NO.2, a reverse primer with the sequence shown in SEQ ID NO.3, and a probe with the sequence shown in SEQ ID NO.

4.

2. The application according to claim 1, characterized in that, The 5' end of the probe is marked with FAM, and the 3' end of the probe is marked with MGB.

Images