A method for identifying yellow catfish, longnose catfish and their hybrid F1 generation and specific primers thereof

Abstract

The present invention relates to an identification method for yellow catfish, long snout catfish and their hybrid F1 generation and specific primers thereof. The identification method adopts specific primers composed of a forward primer SEQ ID NO.1 and a reverse primer SEQ ID NO.2, performs PCR amplification on the genomic DNA of the target fish, and detects the PCR amplification reaction product by agarose gel electrophoresis, and finally directly obtains the identification result according to the electrophoresis result. The identification method of the present invention only needs to perform PCR amplification and agarose gel electrophoresis on the genomic DNA of the fish species, and can directly obtain the identification result for yellow catfish, long snout catfish and their hybrid F1 generation according to the clear and obviously different amplified bands in the electrophoresis result, which is fast and accurate, low in cost, simple to operate and highly practical.

Description

Technical Field

[0001] The invention relates to an identification method for yellow catfish, longnose catfish and their hybrid F1 generation and specific primers thereof, belonging to the technical field of aquaculture. Background Art

[0002] Yellow catfish (Pelteobagrus fulvidraco) and longnose catfish (Leiocassis longirostris) belong to the genera Pelteobagrus and Leiocassis, respectively, of the family Catfish, order Siluriformes. They are two economically valuable aquaculture species in the family Catfish. They are tender, have few bones, and are delicious, and are deeply loved by consumers. Although the breeding scale of catfish is rapidly expanding, the related germplasm improvement research is obviously lagging behind. There have been many studies on distant hybridization of catfish, but no reports on the breeding of yellow catfish and longnose catfish. Yellow catfish has become an important freshwater fish breeding object due to its high survival rate and strong adaptability. Compared with yellow catfish, longnose catfish has the characteristics of fast growth rate and high nutritional value. In order to integrate the advantages of the two fish, the hybrid F1 generation obtained by Pelteobagrus fulvidraco (♀) and Longnose catfish (♂) has the advantages of fast growth and strong stress resistance, and is expected to be developed into a new strain of Pelteobagrus fulvidraco. However, since the hybrid F1 generation usually has the morphological characteristics of the two parents, it is easy to cause confusion and difficult to distinguish directly. It is urgent to develop identification technology means that can distinguish Pelteobagrus fulvidraco, Longnose catfish and their hybrid F1 generation.

[0003] Microsatellites are simple repetitive DNA sequences composed of 2 to 6 nucleotides with high variability, and are characterized by polymorphism, high heterozygosity, and codominant inheritance. Microsatellite markers have been used in the analysis of the genetic structure of aquatic animal populations, the identification of species genetic diversity, and the construction of genetic linkage maps. However, there have been no reports on the identification of yellow catfish, longnose catfish, and their hybrid F1 generations.

[0004] After searching, it was found that the invention patent application with application number CN201610159878.9 and application publication number CN105695590A disclosed a primer set, a kit and a method for identifying the hybrid of yellow catfish and long snout catfish, which can identify the male and female parents of the hybrid of yellow catfish and long snout catfish. However, this technical solution is used to identify the male and female parents of yellow catfish and long snout catfish, and cannot be used to distinguish yellow catfish, long snout catfish and their hybrid F1 generation; its primers are designed based on COI gene and ITS sequence, not designed for microsatellites; after the PCR amplification reaction based on COI gene, sequencing and construction of evolutionary tree cluster diagram are required to identify the parents of the hybrid, and the process is a bit cumbersome.

[0005] The invention patent with patent number CN201910755624.7 and authorization announcement number CN110331217B discloses a microsatellite marker paternity identification primer, method and application suitable for Nile tilapia, Aurelia tilapia and their hybrids. However, its technical solution is used to guide the population genetics and family pedigree management of these three tilapia in the breeding process, not to directly identify and distinguish these three tilapia. Moreover, these three tilapia are very different from yellow catfish, long snout catfish and their hybrid F1 generations, and cannot be directly applied. In addition, its technical means require the use of fluorescently labeled microsatellite primers for PCR amplification and multiple capillary electrophoresis typing, as well as the use of software for paternity identification, which is a bit cumbersome. Therefore, this technical solution does not provide any teaching or inspiration for identifying and distinguishing yellow catfish, long snout catfish and their hybrid F1 generations.

[0006] The invention patent with patent number CN202010344849.6 and authorization announcement number CN111394478B discloses a PCR microsatellite primer and a method for parentage identification of large yellow croaker. However, its technical solution is used to solve the existing problem of inbreeding and decreased genetic diversity of large yellow croaker. It can perform parentage identification between large yellow croaker samples according to genotype, but it is not used to directly identify and distinguish different fish species. Moreover, large yellow croaker is very different from yellow catfish, long snout catfish and their hybrid F1 generation, so it cannot be directly applied. In addition, its technical means require the use of software for parentage identification, which is a bit cumbersome. Therefore, this technical solution does not teach or inspire the identification and distinction of yellow catfish, long snout catfish and their hybrid F1 generation.

[0007] The inventor's research group of the present invention has applied for an invention patent "A specific primer and method for identifying dark-striped pufferfish, red-finned pufferfish and hybrid pufferfish" (patent number CN 202010781478.8, authorization announcement number CN111979336B). Using microsatellite marker technology, PCR amplification and agarose gel electrophoresis, dark-striped pufferfish, red-finned pufferfish and their hybrid pufferfish [dark-striped pufferfish (♀) × red-finned pufferfish (♂)] can be directly distinguished according to the electrophoresis results. However, this identification method is only applicable to dark-striped pufferfish, red-finned pufferfish and their hybrid pufferfish. These fish species are very different from yellow catfish, long-snout catfish and their hybrid F1 generations. Researchers cannot find a basis from the prior art to directly conclude that they can successfully establish an identification method using microsatellite marker technology for yellow catfish, long-snout catfish and their hybrid F1 generations. Only through practical research, continuous attempts and improvements can its feasibility be finally confirmed. The inventor's research team obtained the latest research results through practical research and used them to apply for a patent for this invention. Summary of the invention

[0008] The main purpose of the present invention is to overcome the problems existing in the prior art and provide a method for identifying yellow catfish, longnose catfish and their hybrid F1 generation, which is simple to operate and can quickly and accurately identify the three; at the same time, specific primers used in the identification method and a kit are also provided.

[0009] The technical solution of the present invention to solve the technical problem is as follows:

[0010] A method for identifying yellow catfish, longnose catfish and their hybrid F1 generation, characterized in that it comprises the following steps:

[0011] The first step is to take a fish as a target fish from a fish school, wherein the fish school contains one, two or three of yellow catfish, long snout catfish, and a hybrid F1 generation with yellow catfish as the female parent and long snout catfish as the male parent; extract the genomic DNA of the target fish;

[0012] The second step is to use specific primers to perform PCR amplification on the genomic DNA of the target fish; the specific primers are composed of a forward primer and a reverse primer, the sequence of the forward primer is shown in SEQ ID NO.1, and the sequence of the reverse primer is shown in SEQ ID NO.2; the sequence of the microsatellite marker targeted by the specific primers is 5′-aaataaataaataaat-3′;

[0013] The third step is to detect the PCR amplification reaction products by agarose gel electrophoresis; identify the target fish according to the agarose gel electrophoresis detection results: when the detection result has one band and is located at 150±10bp, the target fish is yellow catfish; when the detection result has one band and is located at 230±10bp, the target fish is longnose catfish; when the detection result has two bands, one band is located at 150±10bp and the other band is located at 230±10bp, the target fish is the hybrid F1 generation with yellow catfish as the female parent and longnose catfish as the male parent.

[0014] The inventor's research team learned in the preliminary research that the traditional screening method of microsatellite sequences mainly uses repeated probes to screen the genomic library and positive clone sequencing to develop the corresponding sequence and primers, which is difficult, time-consuming and inefficient. In practical research, the inventor's research team used a method of full coverage search of all microsatellites in the whole genome of yellow catfish to study, and obtained the target microsatellite and its specific primers more simply and quickly, and obtained the above-mentioned identification method based on microsatellite marker technology, which can quickly and accurately identify yellow catfish, longnose catfish and their hybrid F1 generation.

[0015] Preferably, in the first step, the fish school is composed of one, two or three of yellow catfish, longnose catfish, and a hybrid F1 generation with yellow catfish as the female parent and longnose catfish as the male parent; an appropriate amount of tissue is cut from the target fish, and then the genomic DNA of the target fish is extracted from the tissue; the tissue is the tail fin.

[0016] By adopting this preferred solution, the specific detailed features of the first step can be further optimized; among them, identification can be carried out using a small amount of tail fins, and there is no need to kill the target fish, which can further reduce the cost of identification.

[0017] Preferably, in the second step, the microsatellite marker targeted by the specific primers and its upstream and downstream sequences are shown as SEQ ID NO.3.

[0018] More preferably, the PCR amplification reaction system is a 20 μL system, containing: 7.4 μL of sterile water, 10 μL of 2×Taq PlusMix, 0.8 μL each of 10 μM forward and reverse specific primers, and 1 μL of genomic DNA of the target fish; the PCR amplification reaction program is: pre-denaturation at 95°C for 5 min; 33 cycles: denaturation at 95°C for 30 sec, annealing at 49.8°C for 30 sec, extension at 72°C for 30 sec; finally extension at 72°C for 5 min, and storage at 4°C.

[0019] By adopting the above preferred scheme, the specific detailed features of the second step can be further optimized, wherein the optimization and limitation of the PCR amplification reaction system and the amplification reaction program can make the second step more concise and efficient.

[0020] Preferably, in the third step, 4 μL DNA Marker 2000 and 3 μL PCR amplification reaction product are used for agarose gel electrophoresis detection.

[0021] By adopting the above preferred scheme, the specific details of the third step can be further optimized, so that the third step can be carried out more concisely and efficiently.

[0022] The present invention also provides:

[0023] A specific primer for identifying yellow catfish, longnose catfish and their hybrid F1 generation, characterized in that the specific primer consists of a forward primer and a reverse primer, the sequence of the forward primer is shown in SEQ ID NO.1, and the sequence of the reverse primer is shown in SEQ ID NO.2; the sequence of the microsatellite marker targeted by the specific primer is 5'-aaataaataaataaat-3'.

[0024] The specific primers can be used to smoothly implement the identification method using microsatellite marker technology, and can quickly and accurately identify yellow catfish, longnose catfish and their hybrid F1 generation.

[0025] The present invention also provides:

[0026] A kit for identifying yellow catfish, longnose catfish and their hybrid F1 generation is characterized in that the kit comprises the above-mentioned specific primers for identifying yellow catfish, longnose catfish and their hybrid F1 generation.

[0027] Preferably, the microsatellite marker targeted by the specific primer and its upstream and downstream sequences are shown in SEQ ID NO.3.

[0028] More preferably, the kit further comprises: sterile water and 2×Taq Plus Mix.

[0029] More preferably, the PCR amplification reaction system adopted by the kit when in use is a 20 μL system, containing: 7.4 μL of sterile water, 10 μL of 2×Taq Plus Mix, 0.8 μL each of 10 μM forward and reverse specific primers, and 1 μL of genomic DNA of the target fish; the PCR amplification reaction program adopted by the kit when in use is: pre-denaturation at 95°C for 5 min; 33 cycles: denaturation at 95°C for 30 sec, annealing at 49.8°C for 30 sec, extension at 72°C for 30 sec; finally extension at 72°C for 5 min, and storage at 4°C.

[0030] The kit can be used to smoothly implement the above identification method using microsatellite marker technology, and quickly and accurately identify yellow catfish, longnose catfish and their hybrid F1 generation.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] (1) The traditional method of identifying species using microsatellite marker technology requires adding an 18bp specific fluorescent fragment to the primer pair, adding a fluorescent reagent to the PCR amplification system, and then analyzing the PCR product using capillary electrophoresis technology. In the research process, the present invention optimizes the microsatellite marker technology, and does not need to add fluorescent primers and fluorescent reagents when performing PCR amplification using the DNA of three fish as templates. After screening out primers that can distinguish the three fish, it only needs to optimize the PCR amplification conditions for the screened primers, and the yellow catfish, longnose catfish and their hybrid F1 generation can be directly identified through the electrophoresis diagram.

[0033] (2) The identification method of the present invention only needs to perform PCR amplification and agarose gel electrophoresis on the genomic DNA of the fish species, and the identification results for the yellow catfish, longnose catfish and their hybrid F1 generation can be directly obtained based on the clear and significantly differentiated amplified bands in the electrophoresis results. The method is rapid and accurate, low in cost, simple to operate, and is not limited by the age, gender, group, etc. of the three types of fish individuals.

[0034] (3) The present invention can identify yellow catfish, longnose catfish and their hybrid F1 generations without killing the fish species, only by cutting off a small amount of tail fins, thereby avoiding economic losses caused by detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the electrophoresis result diagram of Example 1 of the present invention.

[0036] Figure 2 This is the electrophoresis result diagram of Comparative Example 1 of the present invention.

[0037] Figure 3 This is the electrophoresis result diagram of Comparative Example 2 of the present invention.

[0038] Figures 1 to 3 Among them, 1-8 are longnose catfish; 9-16 are hybrid F1 generation; 17-24 are yellow catfish; M-Marker.

[0039] Figure 4 This is the electrophoresis result diagram of Comparative Example 3 of the present invention.

[0040] Figure 5 This is the electrophoresis result diagram of Comparative Example 4 of the present invention.

[0041] Figure 4 and Figure 5 In the figure, 1-4 are longnose catfish; 5-8 are yellow catfish; 9-12 are hybrid F1 generation; M-Marker. DETAILED DESCRIPTION

[0042] In specific implementation, the identification method of the present invention for yellow catfish, longnose catfish and their hybrid F1 generation comprises the following steps:

[0043] The first step is to select a fish as a target fish from a fish school, wherein the fish school contains one, two or three of yellow catfish, longnose catfish, and a hybrid F1 generation with yellow catfish as the female parent and longnose catfish as the male parent; extract the genomic DNA of the target fish.

[0044] The fish school is composed of one, two or three of yellow catfish, longnose catfish, and hybrid F1 generation with yellow catfish as the female parent and longnose catfish as the male parent; an appropriate amount of tissue is cut from the target fish, and then the genomic DNA of the target fish is extracted from the tissue; the tissue is the tail fin of the target fish.

[0045] In the second step, specific primers are used to perform PCR amplification on the genomic DNA of the target fish; the specific primers are composed of a forward primer and a reverse primer, the sequence of the forward primer is shown in SEQ ID NO.1, and the sequence of the reverse primer is shown in SEQ ID NO.2; the sequence of the microsatellite marker targeted by the specific primers is 5′-aaataaataaataaat-3′.

[0046] Among them, the microsatellite markers targeted by the specific primers and their upstream and downstream sequences are shown in SEQ ID NO. 3. The PCR amplification reaction system is a 20 μL system, containing: 7.4 μL of sterile water, 10 μL of 2×Taq Plus Mix, 0.8 μL of 10 μM forward and reverse specific primers, and 1 μL of genomic DNA of the target fish; the PCR amplification reaction program is: 95°C pre-denaturation for 5 minutes; 33 cycles: 95°C denaturation for 30 seconds, 49.8°C annealing for 30 seconds, 72°C extension for 30 seconds; finally 72°C extension for 5 minutes, and storage at 4°C.

[0047] Step 3: Use agarose gel electrophoresis to detect the PCR amplification reaction products; identify the target fish based on the agarose gel electrophoresis detection results:

[0048] When the test result shows one band at 150±10bp, the target fish is yellow catfish;

[0049] When the test result shows one band at 230±10bp, the target fish is longnose catfish;

[0050] When the detection result has two bands, one band is located at 150±10bp and the other band is located at 230±10bp, the target fish is a hybrid F1 generation with Pelteobagrus fulvidraco as the female parent and Catfish spheniscus longirostris as the male parent.

[0051] Among them, 4 μL DNA Marker 2000 and 3 μL PCR amplification reaction product were used for agarose gel electrophoresis detection.

[0052] The specific primers for identifying yellow catfish, longnose catfish and their hybrid F1 generation are composed of a forward primer and a reverse primer. The sequence of the forward primer is shown in SEQ ID NO.1, and the sequence of the reverse primer is shown in SEQ ID NO.2. The sequence of the microsatellite marker targeted by the specific primer is 5'-aaataaataaataaat-3'.

[0053] The invention discloses a kit for identifying yellow catfish, long snout catfish and their hybrid F1 generation, and the kit comprises the above-mentioned specific primers for identifying yellow catfish, long snout catfish and their hybrid F1 generation.

[0054] The microsatellite marker targeted by the specific primers and its upstream and downstream sequences are shown in SEQ ID NO.3.

[0055] The kit also includes: sterile water, 2×Taq Plus Mix.

[0056] The PCR amplification reaction system adopted by the kit when in use is a 20μL system, containing: 7.4μL of sterile water, 10μL of 2×TaqPlus Mix, 0.8μL each of 10μM forward and reverse specific primers, and 1μL of genomic DNA of the target fish; the PCR amplification reaction program adopted by the kit when in use is: pre-denaturation at 95℃ for 5min; 33 cycles: denaturation at 95℃ for 30sec, annealing at 49.8℃ for 30sec, extension at 72℃ for 30sec; finally extension at 72℃ for 5min, and storage at 4℃.

[0057] Note: The sequences involved in the above-mentioned technical solutions are as follows:

[0058] Forward primer sequence:

[0059] SEQ ID NO. 1: 5'-gggtaccgagagaggagaaacaga-3'.

[0060] Reverse primer sequence:

[0061] SEQ ID NO. 2: 5'-ccccggcttgctcattagtgatag-3'.

[0062] Microsatellite markers and their upstream and downstream sequences:

[0063] SEQ ID NO.3: 5′-ccagaaagagcatgactgatgcaatttttgctctgagaatgttaat gatagaagtacagagatggtcagaaggagctgcactgcgtctttgtggatttagagaaagcgtatgacagggtaccgagagaggagaaacagaacaaaaactaa[aaataaataaataaat]gcagacctac atacatacaagtcatctaaaaatattaatttaaaatactataacgtctctaacatctatcactaat gagcaagccgggggtgaagaaacattcgcggagatgatttgaggaagaaaccttgggaggaaccaagctcaga-3′, wherein the portion marked in brackets is the sequence of the microsatellite marker.

[0064] The present invention will be described in further detail below with reference to the accompanying drawings and in combination with embodiments, but the present invention is not limited to the examples given.

[0065] Example 1

[0066] This embodiment is an identification method for yellow catfish, longnose catfish and their hybrid F1 generation established through practical research.

[0067] The specific contents of this embodiment are as follows.

[0068] 1. Take samples

[0069] Three fish samples to be identified were collected. Among them, the yellow catfish came from the Lukou base of Nanjing Fisheries Science Research Institute; the longnose catfish came from Changzhou Yufan Aquaculture Co., Ltd.; the hybrid F1 generation with yellow catfish as the female parent (♀) and longnose catfish as the male parent (♂) was cultured and collected at the Lukou base of Nanjing Fisheries Science Research Institute.

[0070] 2. Extract DNA from samples

[0071] The DNA extraction kit of Sangon Bioengineering Co., Ltd. was used to extract the genomic DNA of the three fish species, 8 fish of each species, for a total of 24 samples.

[0072] 3. Screening of microsatellite loci and primer synthesis

[0073] First, the microsatellite screening software MISA was used to screen the microsatellites in the yellow catfish genome, and then Primer5.0 software was used to batch develop microsatellite primers for the whole genome of yellow catfish. 200 pairs of microsatellite primers were selected and synthesized (the primers were synthesized by Sangon Biotech Co., Ltd.).

[0074] 4. Analysis of experimental results of yellow catfish, longnose catfish and their hybrid F1 generation

[0075] The DNA of the three fish species extracted in step 2 was used for PCR amplification, and agarose gel electrophoresis was used to test the amplification of the microsatellite primers synthesized in step 3 in the three fish species. The specific process is as follows:

[0076] 1) PCR amplification system

[0077] The PCR amplification reaction system (20 μL) was as follows: 2× Taq Plus Mix (10 μL), sterile water (7.4 μL), 10 μM forward and reverse specific primers (0.8 μL each), and the fish DNA sample to be identified (1 μL).

[0078] 2) PCR amplification reaction

[0079] Pre-denaturation at 95°C for 5 min on a PCR amplification instrument; 33 cycles: denaturation at 95°C for 30 sec, annealing at 49.8°C for 30 sec, extension at 72°C for 30 sec; finally extension at 72°C for 5 min, and storage at 4°C.

[0080] 3) Agarose gel electrophoresis detection

[0081] Take 4 μL DNA Marker 2000 and 3 μL PCR amplification reaction product for agarose gel electrophoresis detection.

[0082] 4) Determine specific primers based on electrophoresis bands

[0083] A total of 200 pairs of microsatellite primers were synthesized. After PCR amplification and agarose gel electrophoresis, primers that can be successfully amplified in yellow catfish, longnose catfish and their hybrid F1 generation and whose products can produce obvious difference bands after step 3) detection were selected. Finally, a pair of specific primers was obtained. The electrophoresis diagram of the PCR amplification product obtained using this pair of specific primers is as follows: Figure 1 As shown, according to the comparison of the electrophoresis bands with the standard marker: the one with one band at about 150bp is the yellow catfish; the one with one band at about 230bp is the longnose catfish; the one with two bands at about 150bp and 230bp is the hybrid F1 generation.

[0084] The specific primers are:

[0085] Forward primer sequence:

[0086] SEQ ID NO. 1: 5'-gggtaccgagagaggagaaacaga-3'.

[0087] Reverse primer sequence:

[0088] SEQ ID NO. 2: 5'-ccccggcttgctcattagtgatag-3'.

[0089] The microsatellite markers targeted by this specific primer and their upstream and downstream sequences:

[0090] SEQ ID NO.3: 5′-ccagaaagagcatgactgatgcaatttttgctctgagaatgttaat gatagaagtacagagatggtcagaaggagctgcactgcgtctttgtggatttagagaaagcgtatgacagggtaccgagagaggagaaacagaacaaaaactaa[aaataaataaataaat]gcagacctac atacatacaagtcatctaaaaatattaatttaaaatactataacgtctctaacatctatcactaat gagcaagccgggggtgaagaaacattcgcggagatgatttgaggaagaaaccttgggaggaaccaagctcaga-3′, wherein the portion marked in brackets is the sequence of the microsatellite marker.

[0091] For the above-mentioned microsatellite markers, using the above-mentioned specific primers, the target fish genomic DNA can be extracted, PCR amplified, and agarose gel electrophoresis can be performed in sequence, and the species of the target fish can be directly identified based on the electrophoresis result graph, that is, it can be identified whether the target fish is yellow catfish, longnose catfish and their hybrid F1 generation.

[0092] Comparative Example 1

[0093] This comparative example is an example produced by the inventor when optimizing PCR amplification reaction conditions in practical research.

[0094] 1. Take samples

[0095] For the specific sample collection steps, refer to step 1 of Example 1.

[0096] 2. Extract DNA from samples

[0097] The specific steps for extracting DNA refer to step 2 of Example 1.

[0098] 3. Screening of microsatellite loci and primer synthesis

[0099] The specific primers obtained in Example 1 are composed of a forward primer and a reverse primer. The sequence of the forward primer is shown in SEQ ID NO.1, and the sequence of the reverse primer is shown in SEQ ID NO.2. See Example 1 for details.

[0100] 4. Analysis of experimental results of yellow catfish, longnose catfish and their hybrid F1 generation

[0101] Using the DNA of the three fishes extracted in step 2, PCR amplification was performed using the primers in step 3, and the amplification was verified by agarose gel electrophoresis.

[0102] The specific steps are as follows:

[0103] 1) PCR amplification system

[0104] For the specific PCR amplification system, refer to step 1 of step 4 of Example 1).

[0105] 2) PCR amplification reaction

[0106] Pre-denaturation at 95°C for 5 min on a PCR amplification instrument; 33 cycles: denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec; finally extension at 72°C for 5 min, and storage at 4°C.

[0107] Compared with Example 1, the annealing temperature is higher.

[0108] 3) Agarose gel electrophoresis detection

[0109] For specific steps, refer to step 3 of step 4 in Example 1).

[0110] 4) Electrophoresis results

[0111] The electrophoresis of PCR amplification products is shown in Figure 2 As shown in the figure, it can be seen that the amplified bands of yellow catfish, longnose catfish and their hybrid F1 generation are relatively disordered; Figure 1 compared to, Figure 2 Therefore, compared with Example 1, using different annealing temperature conditions in the PCR amplification reaction cannot accurately distinguish between yellow catfish, longnose catfish and their hybrid F1 generation.

[0112] Comparative Example 2

[0113] This comparative example is another example produced by the inventors when optimizing PCR amplification reaction conditions in practical research.

[0114] 1. Take samples

[0115] For the specific sample collection steps, refer to step 1 of Example 1.

[0116] 2. Extract DNA from samples

[0117] The specific steps for extracting DNA refer to step 2 of Example 1.

[0118] 3. Screening of microsatellite loci and primer synthesis

[0119] The specific primers obtained in Example 1 are composed of a forward primer and a reverse primer. The sequence of the forward primer is shown in SEQ ID NO.1, and the sequence of the reverse primer is shown in SEQ ID NO.2. See Example 1 for details.

[0120] 4. Analysis of experimental results of yellow catfish, longnose catfish and their hybrid F1 generation

[0121] Using the DNA of the three fishes extracted in step 2, PCR amplification was performed using the primers in step 3, and the amplification was verified by agarose gel electrophoresis.

[0122] The specific steps are as follows:

[0123] 1) PCR amplification system

[0124] For the specific PCR amplification system, refer to step 1 of step 4 of Example 1).

[0125] 2) PCR amplification reaction

[0126] Pre-denaturation at 95°C for 5 min on a PCR amplification instrument; 40 cycles: denaturation at 95°C for 30 sec, annealing at 49.8°C for 30 sec, extension at 72°C for 30 sec; finally extension at 72°C for 5 min, and storage at 4°C.

[0127] Compared with Example 1, the number of cycles is greater.

[0128] 3) Agarose gel electrophoresis detection

[0129] For specific steps, refer to step 3 of step 4 in Example 1).

[0130] 4) Electrophoresis results

[0131] The electrophoresis of PCR amplification products is shown in Figure 3 As shown in the figure, it can be seen that the amplified bands of yellow catfish, longnose catfish and their hybrid F1 generation are chaotic and darker; Figure 1 compared to, Figure 3 Therefore, compared with Example 1, using different cycle conditions in the PCR amplification reaction cannot accurately distinguish between yellow catfish, longnose catfish and their hybrid F1 generation.

[0132] Comparative Examples 1 and 2 are typical examples produced by the inventors in their practical research to optimize the PCR amplification reaction conditions. With them as representatives, the inventors finally optimized the PCR amplification reaction conditions used in Example 1 after repeated in-depth practical research. Only under these conditions can the identification method of the present invention be successfully implemented and the three fish can be distinguished by the bands with obvious differences in the electrophoresis diagram.

[0133] Comparative Example 3

[0134] This comparative example is an example generated by the inventors when testing 200 pairs of microsatellite primers in practical research.

[0135] 1. Take samples

[0136] For the specific sample collection steps, refer to step 1 of Example 1.

[0137] 2. Extract DNA from samples

[0138] The specific steps for extracting DNA refer to step 2 of Example 1.

[0139] 3. Screening of microsatellite loci and primer synthesis

[0140] The primers used in this comparative example are one pair of the 200 pairs of microsatellite primers selected in Example 1, and are different from the specific primers obtained in Example 1.

[0141] The microsatellite primers used in this comparative example are:

[0142] Forward primer sequence: 5′-agctctttctgtgtgctgatcagg-3′.

[0143] Reverse primer sequence: 5′-GCCTCAAGCAGTTCAAGTCTTTTCA-3′.

[0144] The microsatellite markers targeted by the microsatellite primers and their upstream and downstream sequences:

[0145] 5′-aagttacacgtgaagcaggacgtgttaaatgtcgcaggtctacaggatgacaaatgaa aagctctttctgtgtgctgatcagggtggtcacgtgttaacgacatgttgctggatcatttaaaaaaaaaccctcgtgaattataatagaat[taataataataa]agtcgatgtactgaaaagactttgaa ctgcttgaggcaagatcgaacgcgcatgcgcagttactcctgtccctttttacggctgtgttttat ttagttatttctttattcgatgacaagaacattaataatgtgttcagagccggaaatg-3′, wherein the part marked in brackets is the sequence of the microsatellite marker.

[0146] 4. Analysis of experimental results of yellow catfish, longnose catfish and their hybrid F1 generation

[0147] Using the DNA of the three fishes extracted in step 2, PCR amplification was performed using the primers in step 3, and the amplification was verified by agarose gel electrophoresis.

[0148] The specific steps are as follows:

[0149] 1) PCR amplification system

[0150] For the specific PCR amplification system, refer to step 1 of step 4 of Example 1).

[0151] 2) PCR amplification reaction

[0152] Pre-denaturation at 95°C for 5 min on a PCR amplification instrument; 40 cycles: denaturation at 95°C for 30 sec, annealing at 59°C for 30 sec, extension at 72°C for 30 sec; finally extension at 72°C for 5 min, and storage at 4°C.

[0153] Note: The above amplification reaction conditions have been optimized for the primers used.

[0154] 3) Agarose gel electrophoresis detection

[0155] For specific steps, refer to step 3 of step 4 in Example 1).

[0156] 4) Electrophoresis results

[0157] The electrophoresis of PCR amplification products is shown in Figure 4 As shown, the partial amplified bands of yellow catfish, longnose catfish and their hybrid F1 generation were compared with Figure 1 It can be seen from the comparison that the individual bands of the three fish species are darker and have not been successfully amplified. Therefore, compared with Example 1, this primer pair cannot accurately distinguish between yellow catfish, long snout catfish and their hybrid F1 generation.

[0158] Comparative Example 4

[0159] This comparative example is another example produced by the inventors when testing 200 pairs of microsatellite primers in practical research.

[0160] 1. Take samples

[0161] For the specific sample collection steps, refer to step 1 of Example 1.

[0162] 2. Extract DNA from samples

[0163] The specific steps for extracting DNA refer to step 2 of Example 1.

[0164] 3. Screening of microsatellite loci and primer synthesis

[0165] The primers used in this comparative example are another pair of the 200 pairs of microsatellite primers selected in Example 1, and are different from the specific primers obtained in Example 1.

[0166] The microsatellite primers used in this comparative example are:

[0167] Forward primer sequence: 5′-GGCTGCGATCCGGTTCAGTTTAT-3′.

[0168] Reverse primer sequence: 5′-aacccatgaatctaagaggcacgc-3′.

[0169] The microsatellite markers targeted by the microsatellite primers and their upstream and downstream sequences:

[0170] 5′-ataatttctaacatttcgtttatcatcattttaaatttcgttccctgcagttcagcga cgatccgcttctcgcccgtcgcgtgcggctgcgatccggttcagttttattgtttttattgttttcctttatattcttactgttaccatgta[tttctttctttctttc]tttttttttttttttttttttaaga aaacctgatagcgtgcctcttagattcatgggtttcttaatgtgttttttcctaaagaccagcagt tatactttatataaagatgtgttgatccttatttttaaatgccattaaacaaaaaagcctc-3′, wherein the part marked in brackets is the sequence of the microsatellite marker.

[0171] 4. Analysis of experimental results of yellow catfish, longnose catfish and their hybrid F1 generation

[0172] Using the DNA of the three fishes extracted in step 2, PCR amplification was performed using the primers in step 3, and the amplification was verified by agarose gel electrophoresis.

[0173] The specific steps are as follows:

[0174] 1) PCR amplification system

[0175] For the specific PCR amplification system, refer to step 1 of step 4 of Example 1).

[0176] 2) PCR amplification reaction

[0177] Pre-denaturation at 95°C for 5 min on a PCR amplification instrument; 40 cycles: denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec; finally extension at 72°C for 5 min, and storage at 4°C.

[0178] Note: The above amplification reaction conditions have been optimized for the primers used.

[0179] 3) Agarose gel electrophoresis detection

[0180] For specific steps, refer to step 3 of step 4 in Example 1).

[0181] 4) Electrophoresis results

[0182] The electrophoresis of PCR amplification products is shown in Figure 5 As shown, the amplified bands of yellow catfish, longnose catfish and their hybrid F1 generation were compared with Figure 1 Compared with the above, the amplified bands of the three fish species were indistinguishable, and the three fish species could not be distinguished. Therefore, compared with Example 1, this primer pair could not accurately distinguish the yellow catfish, longnose catfish and their hybrid F1 generation.

[0183] Comparative Examples 3 and 4 are typical examples produced by the inventors when testing 200 pairs of microsatellite primers in practical research. With them as representatives, except for the microsatellite primers obtained in Example 1, the remaining microsatellite primers are difficult to achieve the effect of accurately distinguishing yellow catfish, long snout catfish and their hybrid F1 generations, which also shows that the specific primers that can accurately distinguish yellow catfish, long snout catfish and their hybrid F1 generations obtained by the inventors through practical research are not expected before the research, and only through actual practical research verification can we know whether specific primers that meet the requirements can be found.

[0184] In summary, the specific primers obtained through practical research of the present invention can be used to identify yellow catfish, longnose catfish and their hybrid F1 generation. The identification method established on this basis only needs to perform PCR amplification and agarose gel electrophoresis on the genomic DNA of the fish species, and the three fish can be directly distinguished according to the clear and obviously different amplified bands in the electrophoresis results. The method is fast and accurate, low in cost, simple to operate, and highly practical, and is not limited by the individual age, gender, group, etc. of the three fish.

[0185] In addition to the above embodiments, the present invention may also have other implementation modes. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. A method for identifying yellow catfish, longnose catfish and their hybrid F1 generation, characterized in that: The following steps are involved: The first step is to take a fish as a target fish from a fish school, wherein the fish school contains one, two or three of yellow catfish, long snout catfish, and a hybrid F1 generation with yellow catfish as the female parent and long snout catfish as the male parent; extract the genomic DNA of the target fish; The second step is to use specific primers to perform PCR amplification on the genomic DNA of the target fish; the specific primers are composed of a forward primer and a reverse primer, the sequence of the forward primer is shown in SEQ ID NO.1, and the sequence of the reverse primer is shown in SEQ ID NO.2; The sequence of the microsatellite marker targeted by the specific primer is 5′-aaataaataaataaat-3′; the PCR amplification reaction system is a 20 μL system, containing: 7.4 μL of sterile water, 10 μL of 2×Taq Plus Mix, 0.8 μL of 10 μM forward and reverse specific primers, and 1 μL of genomic DNA of the target fish; the PCR amplification reaction program is: 95°C pre-denaturation for 5 minutes; 33 cycles: 95°C denaturation for 30 seconds, 49.8°C annealing for 30 seconds, 72°C extension for 30 seconds; finally 72°C extension for 5 minutes, and storage at 4°C; The third step is to detect the PCR amplification reaction products by agarose gel electrophoresis; identify the target fish according to the agarose gel electrophoresis detection results: when the detection result has one band and is located at 150±10bp, the target fish is yellow catfish; when the detection result has one band and is located at 230±10bp, the target fish is longnose catfish; when the detection result has two bands, one band is located at 150±10bp and the other band is located at 230±10bp, the target fish is the hybrid F1 generation with yellow catfish as the female parent and longnose catfish as the male parent.

2. A method for identifying yellow catfish, longnose catfish and their hybrid F1 generation according to claim 1, characterized in that, in the first step, the fish school is composed of one, two or three of yellow catfish, longnose catfish and hybrid F1 generation with yellow catfish as the female parent and longnose catfish as the male parent; an appropriate amount of tissue is cut from the target fish, and then the genomic DNA of the target fish is extracted from the tissue; the tissue is the tail fin.

3. The identification method for yellow catfish, longnose catfish and their hybrid F1 generation according to claim 1, characterized in that: In the second step, the microsatellite marker targeted by the specific primer and its upstream and downstream sequences are shown in SEQ ID NO.

3.

4. The identification method for yellow catfish, longnose catfish and their hybrid F1 generation according to claim 1, characterized in that: In the third step, 4 μL DNA Marker 2000 and 3 μL PCR amplification reaction product were used for agarose gel electrophoresis detection.

5. A specific primer for identifying yellow catfish, longnose catfish and their hybrid F1 generation, characterized in that: The specific primer is composed of a forward primer and a reverse primer, the sequence of the forward primer is shown in SEQ ID NO.1, and the sequence of the reverse primer is shown in SEQ ID NO.2; The sequence of the microsatellite marker targeted by the specific primer is 5′-aaataaataaataaat-3′.

6. An identification kit for yellow catfish, longnose catfish and their hybrid F1 generation, characterized in that: The kit comprises the specific primers for identifying yellow catfish, longnose catfish and their hybrid F1 generations as described in claim 5.

7. The identification kit for yellow catfish, longnose catfish and their hybrid F1 generation according to claim 6, characterized in that: The microsatellite marker targeted by the specific primer and its upstream and downstream sequences are shown in SEQ ID NO.

3.

8. The identification kit for yellow catfish, longnose catfish and their hybrid F1 generation according to claim 7, characterized in that: The kit also includes sterile water and 2×Taq Plus Mix.

9. The identification kit for yellow catfish, longnose catfish and their hybrid F1 generation according to claim 8, characterized in that: The PCR amplification reaction system adopted by the kit when in use is a 20 μL system, containing: 7.4 μL of sterile water, 10 μL of 2×TaqPlus Mix, 0.8 μL each of 10 μM forward and reverse specific primers, and 1 μL of genomic DNA of the target fish; the PCR amplification reaction program adopted by the kit when in use is: pre-denaturation at 95°C for 5 minutes; 33 cycles: denaturation at 95°C for 30 seconds, annealing at 49.8°C for 30 seconds, and extension at 72°C for 30 seconds; and finally extension at 72°C for 5 minutes, and storage at 4°C.

Images