Molecular markers, primers and uses thereof linked to the trait of ear weight in millet

Abstract

The present invention belongs to the technical field of millet breeding, and specifically relates to a molecular marker linked to a millet spikelet weight trait, a primer and a use thereof. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1. The InDel molecular marker linked to the millet spikelet weight trait provided by the present invention can perform good typing of millet spikelet weight, and is used for the identification of millet spikelet weight trait and molecular marker-assisted breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of millet breeding, and particularly relates to a molecular marker linked to a millet ear grain weight trait, a primer and a use thereof. Background Art

[0002] Millet has the characteristics of low water consumption, drought and barrenness resistance, rich and balanced nutrition, and can be used as both food and feed. It is the main crop for the green development of dryland ecological agriculture. As a representative of coarse grain crops, millet plays an increasingly important role in meeting people's dietary health needs and promoting scientific and technological progress in the seed industry. Increasing millet yield is of great significance to promoting farmers' increased production and income. Ear-grain weight is one of the important agronomic traits that constitute crop yield. Exploring millet ear-grain weight-related genes and their excellent haplotypes is of great significance and application value to increasing millet yield.

[0003] InDel markers are the second largest type of highly polymorphic markers in plants besides SNP markers. Their advantages are: low development cost, simple typing, high accuracy, good stability, strong versatility, simple and convenient detection, etc. At present, InDel markers are widely used in germplasm resource analysis, genetic diversity analysis, kinship identification, germplasm identification, genetic map construction, QTL positioning and map-based cloning of important agronomic traits, etc.

[0004] At present, the molecular markers used in millet mainly include SSR and sequencing-based molecular markers. SSR markers are easy to use but the number of reports is still very limited. Sequencing-based molecular markers are mainly SNPs, which are expensive to use and therefore have certain application difficulties. This is far from enough for the development needs of millet genomics, especially for molecular marker-assisted selection breeding. Summary of the invention

[0005] In view of the above technical problems, the present invention provides the following technical solutions:

[0006] In a first aspect, the present invention provides a molecular marker linked to the millet grain weight trait, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO:1.

[0007] In a second aspect of the present invention, a primer for amplifying the molecular marker is provided, wherein the primers are InDel-20F and InDel-20R, and the primer sequences are:

[0008] InDel-20F: 5′-CGACAATTCCCTTGTCAACT-3′;

[0009] InDel-20R: 5′-ACGCAGGCTTTCTTTCATAG-3′.

[0010] The third aspect of the present invention provides a kit for detecting the molecular marker, comprising the primer.

[0011] The fourth aspect of the present invention provides an application of the molecular marker, the primer or the kit in the breeding of millet grain weight trait.

[0012] The fifth aspect of the present invention provides a use of the molecular marker, the primer or the kit in identifying the grain weight trait of millet.

[0013] A sixth aspect of the present invention provides a method for breeding millet for the trait of ear grain weight, comprising the following steps:

[0014] Using the genomic DNA of the offspring population produced by the hybridization of the female parent "Aininghuang" and the male parent "Jingu No. 21" as a template, PCR amplification is performed using the primers described in claim 2;

[0015] When the amplified band pattern is consistent with the female parent, Ai Ning Huang, the plant line shows a small grain weight per ear. When the amplified band pattern is consistent with the male parent, Jingu No. 21, the plant line shows a large grain weight per ear. When the amplified band pattern is a heterozygous band pattern, the plant line shows a grain weight per ear tending to an intermediate value.

[0016] Preferably, the PCR amplification reaction system is 10 μL, including: 1.0 μL 10×PCR buffer, 2.0 μL of 2 μmol·L -1 Bidirectional primer, 0.8 μL, concentration 2.5 mmol·L -1 dNTP, 0.1 μL Taq DNA polymerase, 1.0 μL at a concentration of 50 ng / μL -1 Template gDNA, sterile water 5.1μL.

[0017] Preferably, the PCR reaction program is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 35 cycles; final extension at 72°C for 5 min.

[0018] Compared with the prior art, the beneficial effects of the present invention are:

[0019] The InDel molecular marker linked to the millet grain weight trait and its amplification primers provided by the present invention can well type the millet grain weight, and can be used for molecular marker-assisted breeding of the millet grain weight trait according to the polymorphic difference, so as to provide molecular-assisted technical support for the early identification and screening breeding of the millet grain weight trait, and have important theoretical and practical guiding significance for accelerating the genetic breeding of high-yield millet varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a high-density genetic map;

[0021] Figure 2 The results of polyacrylamide gel electrophoresis after the amplification of InDel-20 in the parental Ai Ning Huang and Jingu No. 21 and some recombinant inbred lines; 1-11, some recombinant inbred lines; P1, Ai Ning Huang; P2, Jingu No. 21;

[0022] Figure 3 It is an analysis of spike-grain weight and marker typing. DETAILED DESCRIPTION

[0023] In order to clearly illustrate the technical features of this solution, the present invention is described in detail below through specific implementation methods and in conjunction with the accompanying drawings. The scope of the present invention is not limited to the following embodiments. Professionals in the field can understand that various changes and modifications can be made to the present invention without departing from the spirit and scope of the present invention.

[0024] The instruments, reagents, materials, etc. involved in the following embodiments, unless otherwise specified, are all conventional instruments, reagents, materials, etc. in the prior art and can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following embodiments, unless otherwise specified, are all conventional experimental methods, detection methods, etc. in the prior art.

[0025] Example 1

[0026] Obtaining QTLs and Molecular Markers Related to Ear Grain Weight in Millet

[0027] 1. Construction of genetic population

[0028] There are significant differences in the main agronomic traits of millet (plant height, ear length, ear weight, and tillering) between Ai Ning Huang and Jingu No. 21. In 2013, Ai Ning Huang was used as the female parent and Jingu No. 21 as the male parent for hybridization. In 2014, F1 hybrids were obtained, which were self-fertilized by single seed transmission. In 2019, the F6 generation, including 200 lines, was planted in the experimental field of the Millet Research Institute of Shanxi Agricultural University. The row length is 4 meters and the row spacing is 0.33 meters. Both parents and 200 lines are planted in double rows. The cultivation and management measures in the field experiment are consistent with the local field management.

[0029] 2. Construction of high-density genetic map

[0030] At the seedling stage, 127 strains were randomly selected from 200 strains, and the newly emerged leaves were collected, quickly frozen in liquid nitrogen, and then placed in a -80°C ultra-low temperature refrigerator for use.

[0031] 2.1 DNA extraction

[0032] The genomic DNA of the parents and 127 strains were extracted using the CTAB method. The specific method is as follows:

[0033] (1) Weigh 1.0 g of fresh leaves, cut them into pieces and put them into a mortar. Grind them with liquid nitrogen and add 750 μL of 1.5× CTAB. Grind them into a homogenate and transfer them into a 2 mL centrifuge tube. Transfer them into a centrifuge tube, mix them well and place them in a 65°C water bath for 45 min. Shake them slowly from time to time.

[0034] The formula of 1.5×CTAB is as follows (1L): 15g of CTAB, 75mL of 1mol / LTris.Cl (pH 8.0), 30mL of 0.5mol / LEDTA, 61.4g of NaCl, add deionized water to make up to 1L, add 2ml of mercaptoethanol before use to make the final concentration of mercaptoethanol 0.2ml / 100ml.

[0035] (2) After cooling to room temperature, add an equal volume of chloroform / isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol is 24:1) and gently mix until the lower layer turns dark green.

[0036] (3) Centrifuge at 12000 rpm for 10 min, transfer the upper aqueous phase to a new 1.5 mL centrifuge tube, add 2 times the volume of pre-cooled anhydrous ethanol, mix and let stand for 5 min. Place at -20°C for 30 min to precipitate DNA.

[0037] (4) Centrifuge at 12000 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate once, invert the centrifuge tube to dry the DNA, and add 200 μL of TE buffer to dissolve the DNA.

[0038] (5) The integrity of the genomic DNA was detected using 0.8% agarose gel, and the concentration and purity of the DNA were detected using a Qubit fluorescence quantification instrument. The obtained genomic DNA of the parents and 127 millet recombinant inbred lines was stored at -20°C for future use.

[0039] 2.2 Resequencing

[0040] The qualified DNA samples were used for DNA library construction. Library construction and resequencing were completed by Beijing Biomark Technology Co., Ltd. The brief steps included: 2 μg DNA samples were randomly broken into fragments of 350 bp in length using a Covaris crusher, and the library was constructed strictly according to the reagents and consumables recommended in the instruction manual of TruSeq Library ConstructionKit. The DNA fragments were repaired at the end, ployA tailed, sequencing adapters were added, purified, PCR amplified, etc. to complete the entire library preparation. The constructed library was sequenced using the Illumina HiSeq 2000 sequencing platform.

[0041] 2.3. Construction of high-density genetic map

[0042] A total of 30.74Gbp of clean data was obtained for the parents, and 176.06Gbp of data was obtained for the 127 offspring. Q30 was above 80%. A total of 1,177,119 SNPs were detected between the parents, of which 712,243 SNP markers were suitable for RIL genetic map construction with a depth of no less than 4X. Figure 1 ) There are 216,303 SNP markers and 4,360 bins. The total distance among the 9 linkage groups is 1,016.06 cM, and the average distance is 0.23 cM. The basic information of the genetic map is shown in Table 1.

[0043] Table 1 Basic information of genetic map

[0044]

[0045]

[0046] 3. QTL location and stability detection of grain weight per spike

[0047] R / qtl was used to locate QTLs for grain weight per ear under multi-year and multi-location conditions.

[0048] The results showed (Table 2): In 2019-2021, the spikelet weight qGW5 (44,892,140-45,214,807) was detected in Changzhi, explaining phenotypic variation of 13.08%-28.46%. In 2020, qGW1 (27,905,372-28,210,386) and qGW5 (44,365,982-44,390,267) were detected in Datong, explaining phenotypic variation of 6.47% and 12.13%, respectively; qGW7 (20,323,553-20,472,025) was detected in Yuci, explaining phenotypic variation of 6.21%. In 2021, qGW1 (4,922,851-4,996,016) and qGW5 (44,892,140-45,214,807) were detected in Datong, explaining 7.44% and 21.00% of the phenotypic variation, respectively; qGW1 (4,341,598-4,852,224), qGW5 (44,788,126-44,812,330), and qGW6 (31,677,332-31,730,012) were detected in Yuci, explaining 6.52%, 23.29% and 4.02% of the phenotypic variation, respectively (Table 1). qGW5 (44,892,140-45,214,807) was detected under four environmental conditions and explained 13.08-28.46% of the phenotypic variation, indicating that the QTL was stable and was the main QTL controlling grain weight per ear.

[0049] Table 2 QTL mapping results of grain weight per ear under multiple environmental conditions

[0050]

[0051]

[0052] 4. Obtaining InDel molecular markers heavily linked to millet spikelets

[0053] In the physical interval of qGW5 (44,892,140-45,214,807), the differences in insertion and deletion sites (InDel) between the parents were searched, and primers were designed using prime3.0 300bp upstream and downstream of the InDel site. PCR amplification was performed using the genomic DNA of the maternal parent "Aininghuang" and the paternal parent "Jingu 21" as templates.

[0054] The PCR reaction system was 10 μL, including: 1.0 μL 10×PCR buffer, 2.0 μL bidirectional primers (2 μmol·L -1 ), 0.8 μL dNTP (2.5 mmol·L -1 ), 0.1 μL Taq DNA polymerase, 1.0 μL template gDNA (about 50 ng·μL -1 ), sterile water 5.1 μL.

[0055] The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 35 cycles, and final extension at 72°C for 5 min.

[0056] The amplified products were detected by 1% agarose gel electrophoresis. The primers were selected to amplify normally, and the PCR products were in accordance with the predicted size. The products were recovered and sequenced to confirm the sequence of the differential sites. Finally, InDel-20 ( Figure 2 ). The polymorphic locus of InDel-20 is located at position 45065823 of chromosome 5 of foxtail millet.

[0057] The amplification primers designed for the polymorphic site where InDel-20 is located are:

[0058] InDel-20F: 5′-CGACAATTCCCTTGTCAACT-3′, as shown in SEQ ID NO: 2;

[0059] InDel-20R: 5′-ACGCAGGCTTCTTTTCATAG-3′, as shown in SEQ ID NO:3.

[0060] The female parent, Ai Ning Huang, has an A at this locus, and the male parent, Jingu No. 21, has an ACAGT at this locus.

[0061] Example 2

[0062] Application of molecular marker InDel-20 in identification of ear-grain weight in millet

[0063] InDel-20 was used to amplify in the RIL population. It was found that when the amplified band pattern was consistent with the female parent, Ai Ning Huang (band pattern A), the strain showed a small spikelet weight value. When the amplified band pattern was consistent with the male parent, Jingu No. 21 (band pattern B), the strain showed a large spikelet weight value. When the amplified band pattern showed a heterozygous band pattern (band pattern H), the strain showed a spikelet weight value that tended to the intermediate value ( Figure 2 and Figure 3 ).

[0064] The above specific implementation manner cannot be used as a limitation on the protection scope of the present invention. For those skilled in the art, any substitution, improvement or change made to the implementation manner of the present invention falls within the protection scope of the present invention.

[0065] The matters not described in detail in the present invention are all known technologies to those skilled in the art.

Claims

1. A molecular marker linked to the trait of ear weight in millet, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1: CGACAATTCCCTTGTCAACTAGGGGAGCTATTTTATACTTCATGCATCAA AATCTGTGATAAAAAATCACAAAAAATTACATGACTAAATGTTTGAAACTCT A{A / ACAGT}AAGGCAAACCTTAGGGACTATGAAAAGAAGCCTGCGT; Position 104 of SEQ ID NO: 1 has the polymorphism of A / ACAGT.

2. A primer for amplifying the molecular marker according to claim 1, characterized in that: The primers are InDel-20F and InDel-20R, and the primer sequences are: InDel-20F: 5′-CGACAATTCCCTTGTCAACT-3′; InDel-20R: 5′-ACGCAGGCTTTCTTTCATAG-3′.

3. A kit for detecting the molecular marker according to claim 1, characterized in that: Comprising the primers described in claim 2.

4. Use of the molecular marker according to claim 1 or the kit according to claim 3 in the breeding of millet grain weight trait.

5. Use of the molecular marker according to claim 1 or the kit according to claim 3 in identifying the trait of ear weight of millet.

6. A method for breeding millet for the trait of ear weight, characterized in that: The following steps are involved: Using the genomic DNA of the offspring population produced by the hybridization of the female parent Ai Ning Huang and the male parent Jingu No. 21 as a template, PCR amplification is performed using the primers described in claim 2; When the amplified band pattern is consistent with that of the female parent, Ai Ning Huang, the plant line shows a small grain weight per ear; when the amplified band pattern is consistent with that of the male parent, Jingu No. 21, the plant line shows a large grain weight per ear; when the amplified band pattern is a heterozygous band pattern, the plant line shows a grain weight per ear tending to an intermediate value.

7. The method according to claim 6, characterized in that The PCR amplification reaction system is 10 μL, including: 1.0 μL 10×PCR buffer, 2.0 μL of 2 μmol·L -1 Bidirectional primer, 0.8 μL, concentration 2.5 mmol·L -1 dNTPs, 0.1 μL Taq DNA polymerase, 1.0 μL at a concentration of 50 ng / μL -1 Template gDNA, sterile water 5.1μL.

8. The method according to claim 7, characterized in that The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 35 cycles; and final extension at 72°C for 5 min.

Images