Method for detecting miRNA-21 by colorimetry with combination of smartphone app and dsn enzyme microfluidic chip
The method of detecting miRNA-21 by combining a smartphone APP with a DSN enzyme microfluidic chip colorimetric method solves the problems of complex operation and low sensitivity in the existing technology, and achieves highly selective and sensitive miRNA detection, which is suitable for early disease screening.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-29
- Publication Date
- 2026-04-14
AI Technical Summary
Existing miRNA detection methods suffer from problems such as complex operation, low sensitivity, and insufficient detection specificity, especially on microfluidic chips, where it is difficult to achieve high selectivity and high sensitivity.
A method for colorimetric detection of miRNA-21 using a smartphone app combined with a DSN enzyme microfluidic chip was developed. The method involves designing reaction and colorimetric units on a microfluidic chip, utilizing a three-layer structure of glucose oxidase encapsulated by gold nanoparticles-L1-liposomes, and combining glucose, G-quadruplex/hemin, and TMB reactions. The grayscale value of the colorimetric area is captured by a smartphone for detection.
It achieves highly selective and sensitive miRNA-21 detection, simplifies the operation process, reduces sample volume requirements, and eliminates the need for a complicated nucleic acid extraction process, making it suitable for early disease screening.
Smart Images

Figure CN115855920B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioanalytical chemistry technology and relates to a highly selective and sensitive method for detecting miRNAs, specifically a method for colorimetric detection of miRNA-21 using a smartphone APP combined with a DSN enzyme microfluidic chip. Background Technology
[0002] Several methods for miRNA analysis have been reported, including reverse transcription polymerase chain reaction (RT-PCR), surface plasmon resonance (SPR) technology, Northern blotting, and microarray analysis. In recent years, biosensors, combining SPR, fluorescence, colorimetry, and electrochemical sensor technologies, have been considered powerful analytical tools, leading to the development of numerous biosensing techniques to provide economical, convenient, and sensitive miRNA detection. While these methods have achieved high-throughput miRNA detection, they still have limitations, such as complex procedures, low sensitivity, and insufficient specificity. Therefore, developing highly selective and sensitive miRNA detection methods is crucial. Signal amplification processes are generally divided into two types, which can be categorized into enzymatic signal amplification and non-enzymatic signal amplification based on the materials used in common biosensing platforms. Non-enzymatic signal amplification methods are characterized by low cost and high stability, such as liposomes. Firstly, liposomes possess excellent functionalization and biocompatibility, allowing them to serve as a substrate or signal source. Various biological receptors (such as proteins, peptides, nucleic acids, and antibodies) can be modified onto liposomes to specifically recognize analytes. Secondly, liposomes are a clinically mature nanoscale system, often used to deliver capsule drugs, genes, vaccines, and imaging agents.
[0003] The application of nanomaterials in biosensors based on microfluidic chips can significantly improve device performance. Microfluidic chips, also known as lab-on-a-chip (LOC) or miniature total analysis systems, offer advantages such as low reagent and sample consumption, real-time detection, miniaturized analysis platforms, and short detection times, making them of great significance in biosensor research. Summary of the Invention
[0004] Technical problem to be solved: In order to overcome the shortcomings of the existing technology and develop a miRNA detection and analysis method with high sensitivity and good selectivity, this invention provides a method for colorimetric detection of miRNA-21 by combining a smartphone APP with a DSN enzyme microfluidic chip.
[0005] Technical solution: A method for colorimetric detection of miRNA-21 using a smartphone app combined with a DSN enzyme microfluidic chip, the method comprising the following steps:
[0006] S1. Fabrication of microfluidic chips
[0007] After ultrasonically cleaning and drying the glass slide in deionized water, immerse it in a piranha solution. After treatment, remove it, rinse it with deionized water, dry it, and set it aside. Mix 3-aminopropyltriethoxysilane and anhydrous ethanol at a volume ratio of 1:50, immerse the prepared glass slide in it overnight, modify the surface of the glass slide with amino groups, remove it, rinse it with anhydrous ethanol, and dry it.
[0008] Preparation of S2 and Au nanoparticles
[0009] Au nanoparticles were prepared by sodium citrate reduction. Deionized water was added to a container and heated to boiling in an oil bath. Then, sodium citrate and citric acid were added in sequence. After stirring the reaction rapidly, EDTA and HAuCl4 were added. The solution changed from light yellow to gray-green and finally to wine red. The reaction was terminated by ice bath.
[0010] S3. Preparation of glucose oxidase encapsulated in liposomes
[0011] Liposomes were synthesized using DOPC as a raw material. After mixing it with cholesterol, chloroform was added and dissolved evenly. Nitrogen gas was then introduced and the mixture was dried overnight in a vacuum drying oven. Glucose oxidase was poured into a container with phospholipids on its surface. After shaking evenly, the mixture was allowed to hydrate naturally, allowing the phospholipids to self-assemble into liposomes. The reaction solution was then repeatedly squeezed more than 10 times in a liposome extruder to obtain DOPC liposomes of uniform size that encapsulate glucose oxidase.
[0012] S4, PDMS chip detection process for miRNA
[0013] The chip prepared in S1 was used to fabricate a channel-containing PDMS chip on its surface using photoresist technology. The Au nanoparticle solution prepared in S2 was slowly and uniformly injected into the miRNA detection module of the PDMS chip using a syringe under the impingement of a syringe pump, so that the Au nanoparticles were modified onto the surface of the PDMS chip. The L1 chain with surface-modified thiol groups, sequence SEQ ID NO.1, SH-TTTTTTTCAACATCAGTCTGATAAGCTA-Biotin, was slowly and uniformly injected into the miRNA detection module using a syringe under the impingement of a syringe pump. The reaction was carried out at room temperature, so that the L1 chain was modified onto the surface of the Au nanoparticles. Then, a liposome solution containing streptavidin was injected into the miRNA detection module, and the reaction was carried out at room temperature to form a three-layer modified structure of Au nanoparticles-DNA chain-liposomes.
[0014] S5, Smartphone Colorimetric Testing Process
[0015] miRNA-21, sequence SEQ ID NO.2, UAGCUUAUCAGACUGAUGUUGA, and DSN enzyme were drawn into a syringe and slowly and evenly injected into the miRNA detection module under the action of a syringe pump. The reaction at room temperature caused the liposomes encapsulating glucose oxidase to be released. At the same time, a solution containing TMB, Hemin, and G-quadruplex glucose was introduced into another channel. After the liquids in the two channels were mixed evenly, they were introduced into the colorimetric reaction module. The reaction was carried out at room temperature, and TMB gradually turned blue. A photo was taken with a smartphone and imported into ImageJ software to obtain the grayscale value of the colorimetric reaction module.
[0016] Preferably, sodium citrate and citric acid in S2 have the same concentration and a volume ratio of 3:1.
[0017] Preferably, the mass ratio of EDTA to HAuCl4 in S2 is 1:10.
[0018] Preferably, the mass ratio of DOPC to cholesterol in S3 is 5:1, and the volume ratio of glucose oxidase to liposomes is 4:1.
[0019] Preferably, the volume ratio of Au nanoparticles, DNA chains, and liposomes in S4 is 1:1:1.
[0020] Preferably, in S5, miRNA-21 is 100 nM 500 μL, DSN enzyme is 10 U 20 μL, and the molar concentration ratio of TMB, Hemin, G-quadruplex and glucose is 20:40:1:1000.
[0021] Preferably, the method targets a specific amount of miRNA-21 in a concentration range of 1 pM to 1 nM, R 2 =0.9907, detection limit is 0.27 pM.
[0022] The design concept of the method described in this invention is as follows: (1) Traditional microfluidic chips are often single analysis modules. This invention designs two modules, a reaction unit and a colorimetric unit, on the microfluidic chip, which helps to reduce experimental interference and improve the reaction rate; (2) This invention designs a novel method for detecting microRNA in a microfluidic chip, which converts the content of microRNA in the sample into the gray value of the image taken by the mobile phone, which is more convenient and efficient than the traditional method; (3) Compared with the traditional method, this method requires less sample and does not require a complicated nucleic acid extraction process.
[0023] The principle of the method described in this invention is as follows: The purpose of this invention is to develop a microfluidic platform for the detection of disease biomarkers. We selected microRNA-21, which is expressed at low levels in ordinary type 2 diabetes patients and at high levels in type 2 diabetes patients with coronary heart disease, as the analyte. To identify microRNA-21 in actual samples, a three-layer structure of gold nanoparticles-L1-liposomes encapsulating glucose oxidase was constructed in the reaction unit of a PDMS chip. When microRNA-21 is present, L1 pairs with its complementary bases, releasing the liposomes under the action of DSN enzyme. To convert the nucleic acid concentration into grayscale values, glucose, G-quadruplex / hemin, and TMB were added to the colorimetric unit of the PDMS. The liposomes ruptured under the action of the emulsifier Triton X-100, releasing glucose oxidase, which oxidized TMB and turned it blue. Finally, the colorimetric area of the chip was photographed with a smartphone, and the image was imported into ImageJ software to read the grayscale values.
[0024] Beneficial Effects: The method described in this invention designs a smartphone imaging system based on a microfluidic chip for detecting miRNA-21, which has advantages such as a wide linear range, simple operation, and short detection time. In addition, liposome-encapsulated glucose oxidase provides high sensitivity for this strategy. Compared with other colorimetric methods, this method provides a wider linear range and can directly detect the target analyte in serum. Furthermore, the method and the prepared chip can be used for early screening of patients with type 2 diabetes or type 2 diabetes with coronary heart disease. Attached Figure Description
[0025] Figure 1 TEM images of gold nanoparticles (left) and liposomes (right) encapsulating glucose oxidase via a liposome extruder in Example 1;
[0026] Figure 2 SEM images of (a) the chip glass substrate, (b) the chip glass substrate modified with amino groups, and (c) the chip glass substrate modified with amino groups and gold nanoparticles in Example 1;
[0027] Figure 3 The agarose gel electrophoresis images in Example 1 are: (1) DNA marker, (2) DNA 1, (3) DNA 2, (4) DNA 1 + DNA 2, and (5) DNA 1 + DNA 2 + DSN enzyme.
[0028] Figure 4 The UV signal detection results are for the optimized reaction conditions (a) reaction time, (b) pH, (c) reaction temperature and (d) enzyme concentration in Example 1.
[0029] Figure 5The grayscale changes and their correction curves corresponding to different miRNA-21 concentrations in the chip colorimetric cell in Example 1 are shown.
[0030] Figure 6 In Example 1, (a) the selectivity of miRNA-21 was analyzed using this method, and (b) blood samples from three healthy individuals and three patients with type 2 diabetes were tested using this method and qRT-PCR technology.
[0031] Figure 7 (a) Schematic diagram of the mechanism of microfluidic chip-based colorimetric biosensor for sensitive detection of miRNA-21, (b) Schematic diagram of the reaction chamber mechanism for miRNA-21 detection using microfluidic colorimetric chip, and (c) Schematic diagram of the mechanism of microfluidic colorimetric chip for smartphone imaging. Detailed Implementation
[0032] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Any modifications and substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the present invention are within the scope of the present invention.
[0033] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.
[0034] The abbreviations and Chinese names of the components involved in this invention are as follows: EDTA: disodium ethylenediaminetetraacetate; DOPC: dioleoyl lecithin; CHCl3: chloroform; AuNPs: gold nanoparticles; PDMS: polydimethylsiloxane; TMB: 3,3',5,5'-tetramethylbenzidine; Hemin: heme chloride; DSN: thermostable nuclease; APTES: 3-aminopropyltriethoxysilane; GO X : Glucose oxidase; Triton X-100: Polyethylene glycol octylphenyl ether.
[0035] Example 1
[0036] A method for colorimetric detection of miRNA-21 using a smartphone app combined with a DSN enzyme microfluidic chip, the method comprising the following steps:
[0037] (1) Fabrication of microfluidic chips:
[0038] Place the glass slide in a beaker (containing deionized water), and sonicate it in an ultrasonic cleaner for 10 minutes. After sonication, discard the water and place the beaker in a drying oven to dry the glass slide. Figure 2(a) shows the results of scanning electron microscopy, revealing the morphological features on the unmodified glass substrate. A piranha solution was prepared in a clean beaker. First, 9 mL of H₂O₂ was added, and 21 mL of concentrated H₂SO₄ was slowly added dropwise while stirring continuously. Then, the dried slide was immersed in the piranha solution for 2 h. The slide was then removed, rinsed with deionized water, and dried for later use. 600 μL of 3-aminopropyltriethoxysilane (APTES) was added to a 50 mL centrifuge tube, and the volume was adjusted to 30 mL with anhydrous ethanol. The prepared APTES solution was then vortexed for 10 min. Finally, the dried slide (treated with the piranha solution) was immersed in the APTES solution to modify the slide surface with amino groups. The slide was then sealed with raw rubber tape and stored overnight. After treatment, the slide was rinsed with anhydrous ethanol and dried in a forced-air drying oven. Figure 2 (b) shows the results of scanning electron microscopy analysis, demonstrating the changes in the morphology of the glass substrate after treatment with the piranha solution.
[0039] (2) Preparation of Au nanoparticles:
[0040] Gold (Au) nanoparticles were prepared using the classic sodium citrate reduction method. 144 mL of deionized water was added to a 250 mL three-necked flask and transferred to an oil bath. The mixture was heated to 100 °C. Then, 3.5 mL of 60 mM sodium citrate and 1.5 mL of 60 mM citric acid were added sequentially, and the mixture was stirred rapidly for 30 min. After the reaction was complete, 0.1 mL of 30 mM EDTA and 1 mL of 25 mM HAuCl4 were added. After 60 s, the solution color changed from pale yellow to grayish-green and then to wine red. Finally, the three-necked flask was placed in an ice-water bath to prevent further growth of the gold nanoparticles. Figure 1 The image on the left shows a transmission electron microscope (TEM) image of the prepared gold nanoparticles, which are approximately 13 nm in size.
[0041] (3) Preparation of glucose oxidase encapsulated in liposomes:
[0042] Liposomes were synthesized using DOPC as a raw material. 10 mg of DOPC and 2 mg of cholesterol were weighed into a 10 mL beaker. 1 mL of chloroform was added to dissolve the DOPC evenly. Nitrogen gas was then introduced to dry the solvent in the nitrogen stream, followed by overnight drying in a vacuum oven. 2 mL of a mixture of EXO-III and THT was heated to 37 °C and poured into a beaker with phospholipids on its surface. After shaking evenly, the mixture was allowed to hydrate naturally for 30 min, forming liposomes through self-assembly. The liquid was then added to a liposome extruder (100 nm polycarbonate membrane) and repeatedly extruded more than 10 times to obtain uniformly sized DOPC liposomes encapsulated with EXO-III and THT. Figure 1The image on the right is a transmission electron microscope image of the prepared liposomes, which are approximately 80-100 nm in size.
[0043] (4) Polydimethylsiloxane (PDMS) chip detection process for miRNA:
[0044] A channeled PDMS chip was fabricated using a glass slide with amino groups on its surface via photoresist technology. 500 μL of a prepared gold nanoparticle solution was slowly and uniformly injected into the PDMS chip using a syringe under the influence of a syringe pump. This allowed the miRNA detection module within the chip to be electrostatically adsorbed and form coordination bonds (the positively charged gold nanoparticles interact with the amino groups to form Au-S bonds), thus modifying the surface of the PDMS chip with gold nanoparticles. Figure 2 (c) shows the results of scanning electron microscopy, confirming that gold nanoparticles were successfully modified onto the glass substrate of the PDMS chip. 500 μL of a 100 nM L1 chain with surface-modified thiol groups was slowly injected into the miRNA detection module using a syringe under the influence of a syringe pump. The reaction was carried out at room temperature for 36 h, allowing the L1 chain to be modified onto the surface of the gold nanoparticles. Liposomes encapsulating glucose oxidase and containing biotin on their surface were prepared using a liposome extrusion method. Then, 500 μL of a liposome solution containing 100 μM streptavidin was drawn into a syringe and slowly injected into the miRNA detection module under the influence of a syringe pump. The reaction was carried out at room temperature for 24 h, ultimately forming a three-layer modified structure of gold nanoparticles-DNA chain-liposomes. 1 mL of pH 7.0 PBS buffer was slowly passed into the PDMS chip to wash away any liposomes not bound to the PDMS chip substrate. To demonstrate the feasibility of the nucleic acid detection method, agarose gel electrophoresis analysis was performed, and the results are shown below. Figure 3 As shown, the first band is the DNA marker; the second band is the target analyte microRNA-21; the third band is the single-stranded DNA L1 connecting the glass substrate and the liposome; the fourth band is the result of co-incubation of microRNA-21 and L1 strands, where microRNA-21 and L1 strands successfully combined to form a double strand; the fifth band is the result of co-incubation of microRNA-21, L1 strand, and DSN enzyme, where L1 strand was cleaved by DSN enzyme, and the double-stranded structure was destroyed.
[0045] (5) Smartphone colorimetric testing process:
[0046] 500 μL of 100 nM miRNA-21 and 20 μL of 10 U DSN enzyme were drawn into a syringe and slowly injected into the miRNA detection module under the action of a syringe pump. The mixture was reacted at room temperature for 90 min to release the liposomes encapsulating glucose oxidase. The liposome solution was then injected into the colorimetric reaction chamber under the same pump. Simultaneously, a total volume of 500 μL containing 10 μM TMB, 10 μM Hemin, 10 μM G-quadruplex, and 500 mM glucose was introduced into another channel. The liquids from both channels were mixed uniformly and then injected into the colorimetric reaction module. After reacting at room temperature for 1 h, TMB gradually turned blue. A photo was taken with a smartphone and imported into ImageJ software to obtain the grayscale value of the colorimetric reaction module. Before taking the photo, the intensity of the absorption peaks of the reaction solutions under different optimized conditions was measured using a UV spectrophotometer. Figure 4 (a) The UV absorption curves of the test proved that the process was carried out smoothly, and 20 min was finally selected as the optimal reaction time. Figure 4 (b) The UV absorption image shows that pH has a great influence on the experimental reaction system. This scheme proves that the oxidation process of TMB needs to be carried out under acidic conditions. Finally, the reaction was carried out under the condition of pH 3.5. Figure 4 (c) The UV absorption image shows that 40 °C is the optimal reaction temperature, and the color change of the solution is most obvious. pH has a significant impact on the experimental reaction system, and this scheme proves that the oxidation process of TMB needs to be carried out under acidic conditions. Figure 4 (d) The UV absorption image shows that the change in DSN enzyme color is directly proportional to the change in enzyme concentration. The change in UV absorption is greatest when the DSN enzyme concentration increases from 25 U / ml to 50 U / ml. Therefore, an enzyme concentration of 50 U / ml is selected as the optimal reaction condition. Figure 5 The image shows the analytical performance study for miRNA-21 detection. After obtaining the optimal reaction conditions, we further investigated the selectivity and sensitivity of this strategy for miRNA-21 detection. Figure 5 As shown in the figure, the grayscale value corresponding to different concentrations of miRNA-21 changes with the concentration of the analyte, from... Figure 5 The illustration shows that the relevant grayscale values corresponding to different concentrations of miRNA-21 exhibit a linear dynamic range from 1 pM to 1 nM with good linearity (R² = 0.9907). Figure 5 The illustration shows that the limit of detection (LOD) of this detection method is approximately 0.27 pM. Under the optimal conditions explored above, we conduct a selective study of this strategy. Figure 6As shown in (a), analysis was performed in the presence of four interfering miRNAs: mis-1 (one and two bases mismatched), mis-2, miRNA-155, and miRNA-141. The results showed that these interfering miRNAs had minimal impact, and the signals they generated had little interference with the proposed strategy. This indicates that the analytical method has good recognition ability for the target miRNA-21. When the concentration of miRNA-21 was 10 times that of other miRNA chains, the absorbance of 1 nM Let-7a was 2–3 times that of Let-7b. These results demonstrate that the proposed strategy has good selectivity for miRNA-21.
[0047] To assess the practical diagnostic significance of the established nucleic acid analysis method, we tested three serum samples from healthy individuals and three serum samples from gastric cancer patients obtained from a local hospital. The results are as follows: Figure 6 As shown in (b), the expression of miRNA-21 was decreased in serum samples 1 and 2 of patients with type 2 diabetes; and increased in serum sample 3. The increased expression of miRNA-21 in serum caused by type 2 diabetes may be a symptom of type 2 diabetes patients with coronary heart disease.
[0048] Example 2
[0049] To evaluate the matrix effect of this strategy on actual samples, the method described in Example 1 was used to detect miRNA-21 in serum, and the miRNA-21 in the serum samples was spiked. The experimental data were measured using grayscale values to obtain the concentration of miRNA-21 in serum. As shown in Table 1, a good RR% (97.81–103.90%) and RSD% were obtained, ranging from 1.21% to 4.27%.
[0050] Table 1. Spike recovery rate of miRNA-21 in actual samples
[0051]
Claims
1. A method for colorimetric detection of miRNA-21 using a smartphone app combined with a DSN enzyme microfluidic chip, characterized in that, The method includes the following steps: S1. Fabrication of microfluidic chips After ultrasonically cleaning and drying the glass slide in deionized water, immerse it in a piranha solution. After treatment, remove it, rinse it with deionized water, dry it, and set it aside. Mix 3-aminopropyltriethoxysilane and anhydrous ethanol at a volume ratio of 1:50, immerse the prepared glass slide in it overnight, modify the surface of the glass slide with amino groups, remove it, rinse it with anhydrous ethanol, and dry it. Preparation of S2 and Au nanoparticles Au nanoparticles were prepared by sodium citrate reduction. Deionized water was added to a container and heated to boiling in an oil bath. Then, sodium citrate and citric acid were added in sequence. After stirring the reaction rapidly, EDTA and HAuCl4 were added. The solution changed from light yellow to gray-green and finally to wine red. The reaction was terminated by ice bath. S3. Preparation of glucose oxidase encapsulated in liposomes Liposomes were synthesized using DOPC as a raw material. After mixing it with cholesterol, chloroform was added and dissolved evenly. Nitrogen gas was then introduced and the mixture was dried overnight in a vacuum drying oven. Glucose oxidase was poured into a container with phospholipids on its surface. After shaking evenly, the mixture was allowed to hydrate naturally, allowing the phospholipids to self-assemble into liposomes. The reaction solution was then repeatedly squeezed more than 10 times in a liposome extruder to obtain DOPC liposomes of uniform size that encapsulate glucose oxidase. S4, PDMS chip detection process for miRNA The chip prepared in S1 was used to fabricate a channel-containing PDMS chip on its surface using photoresist technology. The Au nanoparticle solution prepared in S2 was slowly and uniformly injected into the miRNA detection module of the PDMS chip using a syringe under the impingement of a syringe pump, so that the Au nanoparticles were modified onto the surface of the PDMS chip. The L1 chain with surface-modified thiol groups, sequence SEQ ID NO.1, was slowly and uniformly injected into the miRNA detection module using a syringe under the impingement of a syringe pump, and the reaction was carried out at room temperature to modify the surface of the Au nanoparticles with the L1 chain. Then, a liposome solution containing streptavidin was injected into the miRNA detection module, and the reaction was carried out at room temperature to form a three-layer modified structure of Au nanoparticles-DNA chain-liposomes. S5, Smartphone Colorimetric Testing Process miRNA-21 (SEQ ID NO.2) and DSN enzyme were drawn into a syringe and slowly and evenly injected into the miRNA detection module under the action of a syringe pump. The reaction at room temperature caused the liposomes encapsulating glucose oxidase to be released. At the same time, a solution containing TMB, Hemin, and G-quadruplex glucose was introduced into another channel. After the liquids in the two channels were mixed evenly, they were introduced into the colorimetric reaction module. The reaction was carried out at room temperature, and TMB gradually turned blue. A photo was taken with a smartphone and imported into ImageJ software to obtain the grayscale value of the colorimetric reaction module.
2. The method for colorimetric detection of miRNA-21 using a smartphone APP combined with a DSN enzyme microfluidic chip according to claim 1, characterized in that, In S2, sodium citrate and citric acid have the same concentration and a volume ratio of 3:
1.
3. The method for colorimetric detection of miRNA-21 using a smartphone APP combined with a DSN enzyme microfluidic chip according to claim 1, characterized in that, The mass ratio of EDTA to HAuCl4 in S2 is 1:
10.
4. The method for colorimetric detection of miRNA-21 using a smartphone APP combined with a DSN enzyme microfluidic chip according to claim 1, characterized in that, In S3, the mass ratio of DOPC to cholesterol is 5:1, and the volume ratio of glucose oxidase to liposomes is 4:
1.
5. The method for colorimetric detection of miRNA-21 using a smartphone APP combined with a DSN enzyme microfluidic chip according to claim 1, characterized in that, The volume ratio of Au nanoparticles, DNA chains, and liposomes in S4 is 1:1:
1.
6. The method for colorimetric detection of miRNA-21 using a smartphone APP combined with a DSN enzyme microfluidic chip according to claim 1, characterized in that, In S5, miRNA-21 was 100 nM in 500 μL, DSN enzyme was 10 U in 20 μL, and the molar concentration ratio of TMB, Hemin, G-quadruplex and glucose in the same volume was 20:40:1:1000.
7. The method for colorimetric detection of miRNA-21 using a smartphone APP combined with a DSN enzyme microfluidic chip according to claim 1, characterized in that, The method is designed to detect a specific amount of miRNA-21 in a concentration range of 1 pM to 1 nM. 2 =0.9907, detection limit is 0.27 pM.
Citation Information
Patent Citations
Real time nucleic acid detection in vivo using protein complementation
CN101365805A
Paper-based microfluidic chip with result visualization function and preparation method thereof
CN107597217A