A monoclonal antibody, test strip for detecting Schmallenberg virus, and preparation method thereof

Abstract

The present invention discloses a monoclonal antibody, a test strip for detecting Schmallenberg virus and a preparation method thereof, belonging to the field of virus detection. The monoclonal antibody includes monoclonal antibody 4D6 and monoclonal antibody 5D3. The monoclonal antibody 4D6 includes a heavy chain with an amino acid sequence shown in SEQ ID NO: 1 and a light chain with an amino acid sequence shown in SEQ ID NO: 2; the monoclonal antibody 5D3 includes a heavy chain with an amino acid sequence shown in SEQ ID NO: 5 and a light chain with an amino acid sequence shown in SEQ ID NO: 6. A test strip for detecting Schmallenberg virus in a sample is prepared by labeling a fluorescent microsphere solution with monoclonal antibody 4D6, coating a detection line with monoclonal antibody 5D3, and coating a quality control line with goat anti-mouse IgG. Through experimental verification, the test strip has high sensitivity, strong specificity, good stability, simple operation and low cost, and is suitable for rapid screening and diagnosis of a large number of samples on site for Schmallenberg disease.

Description

Technical Field

[0001] The present invention relates to the field of virus detection, and particularly to a monoclonal antibody, a test strip for detecting Schmallenberg virus, and a preparation method thereof. Background Art

[0002] Schmallenberg disease is an arboviral disease caused by SBV, which mainly infects ruminants such as cattle, sheep and goats. Initially, the disease was prevalent in the border areas between Germany and the Netherlands, and then quickly spread to Europe, triggering a large-scale animal epidemic among the ruminant populations on the continent. It took only one year from the initial discovery of the disease for it to spread widely in Europe. Since then, it has formed an epidemic state, recurring periodically to a greater extent every two to three years. If corresponding control measures are not taken, SBV will also reappear regularly in the future. Subsequently, this virus will pose a continuous threat to the ruminant population. Since China also imports ruminants and their products from European countries, international trade exchanges are relatively frequent. To prevent problems before they occur, it is necessary to establish relevant prevention and control technical means in the inspection of imported animals at ports.

[0003] Like other bunyaviruses, the SBV genome is single-stranded negative-sense RNA, containing three gene segments, S, M, and L, and encoding a total of six proteins. The nucleocapsid (N) protein and the small non-structural protein (NS) are encoded by the S gene; the envelope glycoproteins Gn, Gc, and the non-structural protein NSm are encoded by the M gene; the RNA-dependent RNA polymerase (RdRp) is encoded by the L gene. The S gene segment is relatively conserved and encodes two proteins, the nucleocapsid (N) protein and the small non-structural protein, in overlapping ORFs. The N protein is the most abundant protein in SBV virions and can trigger an immune response and produce high levels of antibodies in the early stage of infected animals. Currently, the detection methods for Schmallenberg virus include neutralization test, fluorescence quantitative RT-PCR, and loop-mediated isothermal amplification method, etc. The neutralization test takes too long for detection, consuming time and effort; fluorescence quantitative RT-PCR has relatively high requirements for personnel and equipment; the loop-mediated isothermal amplification method requires the design of specific primers, etc. Currently, they are not suitable for the screening of a large number of on-site samples of Schmallenberg virus at the grass-roots level. Therefore, it is very necessary to study a new method for rapid detection of Schmallenberg virus. Summary of the Invention

[0004] The object of the present invention is to provide a monoclonal antibody, a test strip for detecting Schmallenberg virus, and a preparation method thereof, so as to solve the problems existing in the above-mentioned prior art. Based on the monoclonal antibodies 4D6 and 5D3, a fluorescent microsphere test strip for on-site detection of Schmallenberg virus is prepared, which can realize the rapid screening and diagnosis of a large number of on-site samples of Schmallenberg virus.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a monoclonal antibody for detecting Schmallenberg virus, including monoclonal antibody 4D6 and monoclonal antibody 5D3. The heavy chain of the monoclonal antibody 4D6 includes an amino acid sequence shown in SEQ ID NO: 1, and the light chain includes an amino acid sequence shown in SEQ ID NO: 2; the heavy chain of the monoclonal antibody 5D3 includes an amino acid sequence shown in SEQ ID NO: 5, and the light chain includes an amino acid sequence shown in SEQ ID NO: 6.

[0007] Preferably, the nucleotide sequences encoding the heavy chain and light chain of the monoclonal antibody 4D6 are shown in SEQ ID NO: 3 and SEQ ID NO: 4 respectively; the nucleotide sequences encoding the heavy chain and light chain of the monoclonal antibody 5D3 are shown in SEQ ID NO: 7 and SEQ ID NO: 8 respectively.

[0008] The heavy chain amino acid sequence (SEQ ID NO: 1) of the monoclonal antibody 4D6:

[0009]

[0010] The heavy chain nucleotide sequence of the monoclonal antibody 4D6 (the bold sequences are CDR1, CDR2, and CDR3 in sequence, SEQ ID NO: 3):

[0011]

[0012] The light chain amino acid sequence (SEQ ID NO: 2) of the monoclonal antibody 4D6:

[0013]

[0014] The light chain nucleotide sequence of the monoclonal antibody 4D6 (the bold sequences are CDR1, CDR2, and CDR3 in sequence, SEQ ID NO: 4):

[0015]

[0016] The heavy chain amino acid sequence (SEQ ID NO: 5) of the monoclonal antibody 5D3:

[0017]

[0018] The heavy chain nucleotide sequence of the monoclonal antibody 5D3 (the bold sequences are CDR1, CDR2, and CDR3 in sequence, SEQ ID NO: 7):

[0019]

[0020] The light chain amino acid sequence of the monoclonal antibody 5D3 (SEQ ID NO: 6):

[0021]

[0022] The light chain nucleotide sequence of the monoclonal antibody 5D3 (the bold sequences are CDR1, CDR2, and CDR3 in sequence, SEQ ID NO: 8):

[0023]

[0024] The present invention also provides a product for detecting Schmallenberg virus, including the monoclonal antibody described above.

[0025] Preferably, the product includes a test strip.

[0026] Preferably, the test strip includes a PVC bottom plate, and a water absorption pad, a nitrocellulose membrane, a conjugate pad, and a sample pad connected to the PVC bottom plate in sequence; a test line and a quality control line are provided on the nitrocellulose membrane, the test line is coated with the monoclonal antibody 5D3, and the quality control line is coated with a rabbit polyclonal antibody; the conjugate pad contains the monoclonal antibody 4D6.

[0027] The present invention also provides a preparation method of a test strip for detecting Schmallenberg virus, including the following steps:

[0028] (1) Fluorescent microsphere labeling of the monoclonal antibody 4D6

[0029] After activating the fluorescent microspheres, resuspend the fluorescent microspheres with a sodium tetraborate buffer solution; add the monoclonal antibody 4D6 to the fluorescent microspheres containing the sodium tetraborate solution for coupling reaction to obtain the fluorescent microsphere-labeled monoclonal antibody 4D6.

[0030] (2) Preparation of the fluorescent microsphere test strip

[0031] Coat the rabbit polyclonal antibody and the monoclonal antibody 5D3 on the nitrocellulose membrane, use the rabbit polyclonal antibody as the quality control line, and use the monoclonal antibody 5D3 as the test line, and dry;

[0032] Spray the fluorescent microsphere-labeled monoclonal antibody 4D6 on the conjugate pad, and dry;

[0033] The water-absorbing pad, nitrocellulose membrane, conjugate pad and sample pad are sequentially connected and fixed to the PVC bottom plate, and assembled to obtain a test strip for detecting Schmallenberg virus.

[0034] Preferably, in step (1), the fluorescent microspheres containing sodium tetraborate solution and the monoclonal antibody 4D6 are mixed in a ratio of (50 - 100) μL: 100 μg, and the coupling reaction is carried out for 2 - 3 h.

[0035] Preferably, in step (1), the fluorescent microspheres are activated with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide. The fluorescent microspheres, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide are mixed in a volume ratio of 10: (1 - 3): (1 - 3), and the fluorescent microspheres are activated for 30 min.

[0036] Preferably, in step (2), the conjugate pad is treated as follows before use: soaked in a solution containing 3% sucrose, 2% trehalose, 0.2% Tween 20 and 0.3% S9 for 30 min, and then placed in an incubator at 37 °C to dry.

[0037] The sample pad is treated as follows before use: soaked in a solution containing 20 mmol / L Tris-HCl pH 8.5, 0.5% BSA, 0.3% PVP, 0.2% Tween 20 for 30 min, and then placed in an incubator at 37 °C to dry.

[0038] The present invention also provides the application of the monoclonal antibody in the preparation of a product for detecting Schmallenberg virus.

[0039] The present invention discloses the following technical effects:

[0040] In the present invention, the monoclonal antibody 4D6 against the N protein of Schmallenberg virus is used to label the fluorescent microsphere solution, the monoclonal antibody 5D3 against the N protein of Schmallenberg is used to coat the test line (T), and the rabbit polyclonal antibody is used to coat the quality control line (C) to prepare a test strip for detecting Schmallenberg virus in samples. The experimental verification results show that the sensitivity of the test strip reaches 10 TCID 50 / mL, and there is no cross-reaction with Akabane virus, bovine infectious rhinotracheitis virus, bluetongue virus, orf virus, bovine viral diarrhea virus and bovine nodular skin disease virus, indicating that the test strip has high sensitivity, strong specificity, good stability, simple operation and low cost. The present invention discloses a fluorescent microsphere test strip with simple operation, rapid detection, and can be used for on-site detection of Schmallenberg virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0042] Figure 1 It is a graph of the sensitivity results of the test strip; 1 represents 1:100; 2 represents 1:200; 3 represents 1:400; 4 represents 1:800; 5 represents 1:1600; 6 represents 1:3200; 7 represents 1:6400; 8 represents 1:12800; 9 represents 1:25600; 10 represents the negative control.

[0043] Figure 2 It is a graph of the quantitative analysis results of the test strip; 1 represents 1:6400; 2 represents 1:3200; 3 represents 1:1600; 4 represents 1:800; 5 represents 1:400; 6 represents 1:200; 7 represents 1:100.

[0044] Figure 3 It is the specific detection result of the test strip; 1. Schmallenberg virus; 2. Akabane virus; 3. Bovine infectious rhinotracheitis virus; 4. Bluetongue virus; 5. Contagious ecthyma virus; 6. Bovine viral diarrhea virus; 7. Bovine nodular skin virus; 8. Negative control.

[0045] Figure 4 It is the stability detection result of the test strip; 1 - 13 represent different batches of test strips. Detailed implementation manners

[0046] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0047] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0048] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention has been described only in terms of preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0049] Without departing from the scope or spirit of the present invention, various modifications and variations can be made to the specific embodiments of the description of the present invention, which will be apparent to those skilled in the art. Other embodiments obtained from the description of the present invention will be apparent to those skilled in the art. The description and examples of this application are merely exemplary.

[0050] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0051] Example 1 Preparation of a Fluorescent Microsphere Antigen Detection Strip for Schmallenberg Virus

[0052] 1. Experimental Materials

[0053] The inactivated SBV virus solution was provided by the Friedrich-Loeffler-Institut FLI in Germany, and the monoclonal antibody pairs 4D6 and 5D3 against SBV N protein and the rabbit polyclonal antibody against SBV N protein were prepared by the Institute of Animal Inspection and Quarantine, Chinese Academy of Inspection and Quarantine.

[0054] The inactivated Akabane virus, Bovine infectious rhinotracheitis virus, Bluetongue virus, Orf virus, Bovine viral diarrhea virus, and Bovine nodular skin disease virus solutions were preserved by the Institute of Animal Inspection and Quarantine, Chinese Academy of Inspection and Quarantine.

[0055] Preparation of the above-mentioned monoclonal antibody against SBV N protein:

[0056] (1) According to the N gene sequence (accession number JX853181.1) in GenBank, a pair of specific primers for amplifying the full length of the SBV N gene was designed: F: GAATTCATGTCAAGCCAATTCATT; R: CTCGAGTTAGATGTTGATACCGAATTGC. After synthesis by a biosynthetic company, it was ligated into the pET-28a expression vector and transformed into competent Escherichia coli BL21(DE3).

[0057] (2) It was induced to express with 0.5 mmol / L isopropyl β-D-thiogalactoside (IPTG) and purified by Ni-NTA column.

[0058] (3) The purified SBV N protein was mixed and emulsified with an equal amount of Freund's complete adjuvant and used to immunize female BALB / c mice aged 6 - 8 weeks. When the serum antibody titer reached the requirement, the mice to be fused were given an additional intraperitoneal immunization. Three days later, the spleens of the mice were collected for cell fusion. The fused cells were resuspended in HAT medium and plated in a 96-well cell culture plate, and were also cultured in a 50 mL / L CO₂, 37 °C cell culture incubator. Around 5 days later, half of the HAT medium was replaced with HT medium, and after 10 days, it was changed to HT medium. When the cell clones grew to 1 / 5 - 1 / 2 of the bottom area of the cell culture wells in the cell plate, the cell culture supernatant was aspirated to detect the antibody, and a hybridoma cell line secreting monoclonal antibody against SBV N protein was obtained.

[0059] (4) Take 5×10 6 The above-mentioned hybridoma cells were injected intraperitoneally. Ten days later, ascites was collected by peritoneal puncture from the mice. After being placed at 37 °C for half an hour, it was then placed at 4 °C overnight. The next day, blood clots were removed by centrifugation. Three volumes of phosphate buffer were added to the ascites, and centrifuged at 13000 rpm for 30 minutes. The supernatant was filtered through a 0.25 μm filter membrane and purified by protein G column.

[0060] Monoclonal antibodies 4D6 and 5D3 against SBV N protein were obtained through result identification, and the ascites titers both reached above 1:160000. The subtype identifications were IgG1 / κ and IgG2b / κ types respectively.

[0061] 2. Preparation of 4D6 antibody-labeled fluorescent microspheres

[0062] (1) Take 200 μL of microspheres (purchased from Bangs Biological Company) and wash the microspheres with 1 mL of 20 mmol / L pH6 MES buffer to remove the microsphere preservation solution. Centrifuge at 14000 rmp for 20 min and discard the supernatant;

[0063] (2) Resuspend the microspheres with 1 mL of 20 mmol / L pH6 2-(N-morpholino)ethanesulfonic acid (MES) buffer and quickly mix them evenly with the assistance of an ultrasonic crusher; 20 μL of 2 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and 20 μL of 4 mg / mL N-hydroxysuccinimide (NHS) were added respectively to activate the microspheres for 30 min. Centrifuge at 14000 rmp for 20 min and discard the supernatant. Add 200 μL of 20 mmol / L sodium borate buffer to resuspend.

[0064] (3) Take 100 μL of the fluorescent microspheres containing sodium tetraborate solution, add 100 μg of monoclonal antibody 4D6 and 400 μL of sodium tetraborate solution to conjugate the antibody for 2 h; block with 100 μL of 1 M glycine for 15 min, then block with 10% BSA for 15 min, and centrifuge at 14000 rmp for 30 min; resuspend with 500 μL of a solution containing 20 mmol / L Tris-HCl pH 8.5, 0.5% BSA, 5% sucrose solution and 5% trehalose solution.

[0065] 3. Preparation of the fluorescent microsphere test strip

[0066] (1) Treatment of the conjugate pad: Soak the conjugate pad with a solution containing 3% sucrose, 2% trehalose, 0.2% Tween 20 and 0.3% S9 for 30 min, and dry it in an incubator at 37 °C for later use.

[0067] (2) Treatment of the sample pad: Soak the sample pad with a solution containing 20 mmol / L Tris-HCl pH 8.5, 0.5% BSA, 0.3% PVP and 0.2% Tween 20 for 30 min, and dry it in an incubator at 37 °C for later use.

[0068] (3) Assembly of the test strip: Dilute the monoclonal antibody 5D3 against SBV N protein and the rabbit polyclonal antibody against SBV N protein with PBS buffer containing 2% sucrose and 0.01 mmol / L to a concentration of 1 mg / mL, and spray them onto the nitrocellulose membrane (NC membrane) at a speed of 30 mm / s using a three-channel spraying system (XYZ3050TM) as the test line (T line) and the control line (C line) respectively. After diluting the antibody labeled with the above fluorescent microspheres 20-fold, spray it onto the conjugate pad at a rate of 9 μL / cm, and dry it in an oven at 37 °C for 2 h for later use. Stick the NC membrane, the sample pad, the conjugate pad and the absorbent paper onto the PVC bottom plate. Then cut the assembled strip into a test strip with a width of 3 mm and a length of 6 cm using a BIO-DOT cutter, place it in a card slot, add a desiccant and seal it with a sealed bag, and store it at room temperature in the dark.

[0069] (4) Result determination: One method is to perform qualitative and quantitative analysis (T / C signal-to-noise ratio) on the sample using a fluorescence reader (JN615 purchased from Shanghai Jiening Biotechnology Co., Ltd.). Another method is to observe the result with a flashlight (UltraFire BG-42-A) with an excitation light source of 365 nm. If both the T line and the C line show red bands, it is determined as positive; if the C line shows a red band and the T line has no band, it is determined as negative; if the C line has no band, regardless of whether the T line has a band or not, the test strip is determined to be invalid.

[0070] Example 2 Detection of the sensitivity of the test strip

[0071] Using a solution containing 0.6% Tris-base, 0.5% casein, 0.5% polyvinylpyrrolidone, and 0.5% Tween 20, Schmalenberg virus (SBV) was diluted according to the two-fold dilution method at ratios of 1:100, 1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, 1:12800, and 1:25600. 75 μL of the virus diluent at each dilution was added dropwise onto the sample pad and reacted for 10 - 15 min. The sensitivity of the test strip for detecting SBV was observed using a flashlight with an excitation light source of 365 nm.

[0072] The results showed that at a dilution of 1:12800, which is 10 TCID 50 / mL, the T line of the test strip still showed color ( Figure 1 ). When detecting the Schmalenberg virus solution diluted by the two-fold dilution method using a fluorescence reader, the T / C signal-to-noise ratio showed a good linear relationship ( Figure 2 ).

[0073] Example 3 Specificity Detection of the Test Strip

[0074] 75 μL of inactivated Schmalenberg virus, Akabane virus, bovine infectious rhinotracheitis virus, bluetongue virus, orf virus, bovine viral diarrhea virus, and bovine nodular skin disease virus solutions were added dropwise onto the sample pad and reacted for 10 - 15 min. A flashlight with an excitation light source of 365 nm was used to observe for cross-reactions.

[0075] The results showed that in addition to the C and T lines of the Schmalenberg virus solution showing color, only the C line of the other virus solutions showed color, and the T line did not show color. This indicates that the test strip has strong specificity ( Figure 3 ).

[0076] Example 4 Stability Detection of the Test Strip

[0077] The assembled test strips of different batches were placed in an aluminum foil bag and sealed, and stored at 37°C for 1 month. Then, SBV and the sample diluent were detected.

[0078] The results showed that both the C and T lines of the SBV sample showed color, and only the C line of the sample diluent showed color. This indicates that the test strip has good stability ( Figure 4 ).

[0079] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. Monoclonal antibody for detecting Schmallenberg virus, characterized in that, Comprising monoclonal antibody 4D6 and monoclonal antibody 5D3, wherein the monoclonal antibody 4D6 comprises a heavy chain with an amino acid sequence as shown in SEQ ID NO: 1 and a light chain with an amino acid sequence as shown in SEQ ID NO: 2; the monoclonal antibody 5D3 comprises a heavy chain with an amino acid sequence as shown in SEQ ID NO: 5 and a light chain with an amino acid sequence as shown in SEQ ID NO:

6.

2. The monoclonal antibody according to claim 1, wherein The nucleotide sequences encoding the heavy chain and light chain of monoclonal antibody 4D6 are respectively as shown in SEQ ID NO: 3 and SEQ ID NO: 4; the nucleotide sequences encoding the heavy chain and light chain of monoclonal antibody 5D3 are respectively as shown in SEQ ID NO: 7 and SEQ ID NO:

8.

3. A product for detecting Schmallenberg virus, characterized in that, Comprising the monoclonal antibody according to claim 1 or 2.

4. The product according to claim 3, wherein The product comprises a test strip.

5. The product according to claim 4, characterized in that, The test strip comprises a PVC base plate, and a water absorption pad, a nitrocellulose membrane, a conjugate pad and a sample pad which are sequentially connected and fixed on the PVC base plate; a detection line and a quality control line are arranged on the nitrocellulose membrane, the detection line is coated with monoclonal antibody 5D3, and the quality control line is coated with rabbit polyclonal antibody; the conjugate pad contains monoclonal antibody 4D6.

6. A method for preparing a test strip for detecting Schmallenberg virus, characterized in that, Comprising the following steps: (1) Fluorescent microsphere labeling of monoclonal antibody 4D6 After activating the fluorescent microspheres, resuspend the fluorescent microspheres with sodium tetraborate buffer solution; add the monoclonal antibody 4D6 described in claim 1 to the fluorescent microspheres containing sodium tetraborate solution for coupling reaction to obtain fluorescent microsphere-labeled monoclonal antibody 4D6; (2) Preparation of fluorescent microsphere test strip Coat the rabbit polyclonal antibody and the monoclonal antibody 5D3 described in claim 1 on the nitrocellulose membrane, use the rabbit polyclonal antibody as the quality control line, use the monoclonal antibody 5D3 as the detection line, and dry; Spray the fluorescent microsphere-labeled monoclonal antibody 4D6 on the conjugate pad and dry; Connect and fix the water absorption pad, the nitrocellulose membrane, the conjugate pad and the sample pad to the PVC base plate in sequence, and assemble to obtain a test strip for detecting Schmallenberg virus.

7. The preparation method according to claim 6, characterized in that, In step (1), the fluorescent microspheres containing sodium tetraborate solution and the monoclonal antibody 4D6 are mixed in a ratio of (50 - 100) μL: 100 μg, and the coupling reaction is carried out for 2 - 3 h.

8. The preparation method according to claim 6, characterized in that, In step (1), activate the fluorescent microspheres with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide, and the fluorescent microspheres, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide are mixed in a volume ratio of 10: (1 - 3): (1 - 3) to activate the fluorescent microspheres for 30 min.

9. The preparation method according to claim 6, wherein In step (2), the following treatment is carried out on the conjugate pad before use: soak it in a solution containing 3% sucrose, 2% trehalose, 0.2% Tween 20 and 0.3% S9 for 30 min, and place it in an incubator at 37 °C to dry. The sample pad is processed as follows before use: soak it in a solution containing 20 mmol / L Tris-HCl pH 8.5, 0.5% BSA, 0.3% PVP, and 0.2% Tween 20 for 30 min, and then place it in an incubator at 37°C to dry.

10. The monoclonal antibody according to claim 1 or 2 is used in the preparation of a product for detecting Schmallenberg virus.

Images