Use of FKBP11 protein or its encoding gene in the preparation of drugs for treating laryngeal squamous cell carcinoma

Abstract

The present invention discloses the application of FKBP11 protein or its encoding gene in the preparation of drugs for treating laryngeal squamous cell carcinoma, belonging to the field of biomedicine. Through the predictive analysis of tumor bioinformatics of the present invention, it is found that the expression of FKBP11 in head and neck squamous cell carcinoma tissues is significantly higher than that in adjacent normal tissues. A lentiviral vector interfering with the FKBP11 gene was constructed by using RNA interference technology, and this lentiviral vector was transfected into laryngeal squamous cell carcinoma cell lines. It was confirmed by in vitro cell experiments that interfering with the FKBP11 gene has the effect of inhibiting the proliferation and metastasis of laryngeal squamous cell carcinoma cell lines. Furthermore, through a functional rescue experiment, it was found that FKBP11 can promote the proliferation and migration of laryngeal cancer cells, inhibit the apoptosis of laryngeal squamous cell carcinoma cells, and promote the G1 / S phase progression of cells by targeting and regulating CDH2, playing a promoting role in the occurrence and development of laryngeal squamous cell carcinoma.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to the use of FKBP11 protein or its coding gene in the preparation of drugs for treating laryngeal squamous cell carcinoma. Background Art

[0002] Laryngeal cancer is a common head and neck malignant tumor. According to histological classification, more than 95% of laryngeal cancers are laryngeal squamous cell carcinoma (LSCC for short hereinafter). The larynx is an organ with functions of pronunciation and swallowing. Suffering from malignant tumors not only causes death but also disability, seriously affecting the quality of life. With the development of diagnosis and treatment technologies, the 5-year survival rate of most cancers has increased. Unfortunately, laryngeal cancer is an exception. Data in the United States show that since the 1990s, since concurrent chemoradiotherapy has been used as the preferred treatment option for laryngeal cancer to preserve the larynx, the 5-year survival rate has instead decreased. Patients with recurrence after failure of concurrent chemoradiotherapy can only choose total laryngectomy, losing the pronunciation function while the survival rate decreases, and the quality of life drops severely. Recurrence and metastasis are the main causes of death, but the mechanism of invasion and metastasis of laryngeal cancer has not been clarified yet, lacking effective treatment targets. Therefore, exploring new molecular mechanisms of laryngeal cancer recurrence and metastasis and screening new treatment targets are of great significance for improving the survival rate of laryngeal cancer and the quality of life. Summary of the Invention

[0003] The purpose of the present invention is to provide the use of FKBP11 protein or its coding gene in the preparation of drugs for treating laryngeal squamous cell carcinoma, so as to solve the problems existing in the above-mentioned prior art. The present invention screens out a new molecular marker related to the treatment of laryngeal squamous cell carcinoma, providing a new treatment target for the treatment of laryngeal squamous cell carcinoma.

[0004] To achieve the above purpose, the present invention provides the following solutions:

[0005] The present invention provides the use of FKBP11 protein or the gene encoding this protein (GenBank gene serial number: NM_016594) in the preparation of drugs for treating laryngeal squamous cell carcinoma.

[0006] Preferably, by interfering with the expression of FKBP11 protein or the gene encoding this protein, the proliferation and migration of laryngeal squamous cell carcinoma cells are inhibited.

[0007] The present invention also discloses a drug for treating laryngeal squamous cell carcinoma, including FKBP11 protein, or the gene encoding this protein, or a vector containing this gene; and a pharmaceutically acceptable pharmaceutical carrier.

[0008] Preferably, the vector is a plasmid or a virus.

[0009] Preferably, the virus is a lentiviral vector that interferes with the FKBP11 gene.

[0010] The present invention discloses the following technical effects:

[0011] FKBP11 disclosed in the present invention, also known as FKBP19, belongs to the FK506 binding protein family. Through bioinformatics analysis, it is found that its expression in head and neck squamous cell carcinoma tissues is significantly higher than that in adjacent normal tissues; further, by constructing a lentiviral vector targeting the interference of FKBP11 and verifying its in vitro function, it is found that FKBP11 can promote the proliferation and migration of laryngeal cancer cells, inhibit the apoptosis of laryngeal cancer cells, and promote the G1 / S phase progression of cells by targeting the regulation of CDH2, playing a promoting role in the occurrence and development of laryngeal squamous cell carcinoma. It can be seen that the present invention screens a new therapeutic target for laryngeal squamous cell carcinoma, which is of great significance for the treatment of laryngeal squamous cell carcinoma and improving the survival rate and quality of life of patients with laryngeal squamous cell carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0013] Figure 1 Predictive analysis of tumor bioinformatics found that the expression of FKBP11 in head and neck squamous cell carcinoma tissues was significantly higher than that in adjacent normal tissues (p < 0.01);

[0014] Figure 2 Schematic diagram of RNA interference vector construction and positive clone identification;

[0015] Figure 3 Electrophoresis diagram of positive clone identification; 1 is the negative control; 2 is the empty vector control; 3 is the 250bp Marker, from top to bottom are 5kb, 3kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp, 100bp; 4 - 8 are monoclonal psc37209 - 1, 2, 3, 4, 5;

[0016] Figure 4 RT - PCR identification results and Western blot experimental results of laryngeal cancer cell line (AMC - HN - 8) with FKBP11 knockdown expression (shFKBP11) and its corresponding blank transfection control group (shCtrl);

[0017] Figure 5 Flow cytometry detection of the effect of FKBP11 gene knockdown on the cell cycle;

[0018] Figure 6 To detect the effect of FKBP11 gene knockdown on cell apoptosis;

[0019] Figure 7 To verify the effect of FKBP11 knockdown on the proliferation of laryngeal cancer cells in vitro by MTT assay (p < 0.05);

[0020] Figure 8 To verify the effect of FKBP11 knockdown on the migration of laryngeal cancer cells in vitro by cell scratch assay (p < 0.05);

[0021] Figure 9 To verify the effect of FKBP11 knockdown on the migration of laryngeal cancer cells in vitro by Transwell assay (p < 0.05);

[0022] Figure 10 To verify the difference in protein expression related to tumor - associated signaling pathways and find that FKBP11 knockdown can significantly down - regulate the expression of CDH2; A: Results of Western blot assay; B: Statistical chart of the results of Western blot assay;

[0023] Figure 11 Cell infection diagram for rescue experiment;

[0024] Figure 12 To detect the effect of interfering with FKBP11 expression and overexpressing CDH2 (OE) on the proliferation of tumor cells by MTT assay;

[0025] Figure 13 To detect the effect of interfering with FKBP11 expression and overexpressing CDH2 (OE) on the migration of tumor cells by Transwell migration assay; A: Statistical chart; B: Staining diagram. Detailed implementation manners

[0026] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0028] Unless otherwise noted, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention has been described only with reference to preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0029] Without departing from the scope or spirit of the present invention, various modifications and variations to the specific embodiments of the present invention specification will be apparent to those skilled in the art. Other embodiments derived from the specification of the present invention will be apparent to those skilled in the art. The specification and examples of this application are merely exemplary.

[0030] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0031] Example 1

[0032] 1. Biological analysis

[0033] First, using predictive analysis of tumor bioinformatics (http: / / ualcan.path.uab.edu / analysis.html), it was found that the expression of FKBP11 (FKBP prolylisomerase 11) in head and neck squamous cell carcinoma tissues was significantly higher than that in adjacent normal tissues (p < 0.01, Figure 1 ).

[0034] 2. Construction of the RNA interference lentiviral vector (shFKBP11) for the FKBP11 gene

[0035] 2.1 Design of RNA interference target and preparation of double-stranded DNA oligo

[0036] (1) Gene information

[0037] Table 1 Gene information

[0038]

[0039] (2) Design of RNA interference target

[0040] According to the design principle of RNA interference sequences, using the FKBP11 gene as a template, multiple 19 - 21 nt RNA interference target sequences were designed. After evaluation and determination by design software, the following sequences were selected as interference targets.

[0041] Table 2 Interference targets

[0042]

[0043] (3) Synthesis of DNA oligo sequences

[0044] Design shRNA interference sequences according to the selected target sequences, and add appropriate restriction enzyme digestion sites at both ends to complete the vector construction. In addition, add a TTTTT termination signal at the 3' end of the sense strand and a complementary sequence of the termination signal at the 5' end of the antisense strand. After the design is completed, send the single-stranded DNA oligo to Genomics BioSci & Tech Co., Ltd. for synthesis.

[0045] Table 3

[0046]

[0047] Note: CCGG: AgeI restriction enzyme digestion site; AATTC: EcoRI restriction enzyme digestion site; G: Complementary sequence of the EcoRI restriction enzyme digestion site.

[0048] (4) Preparation of double-stranded DNA oligo

[0049] Dissolve the synthesized single-stranded DNA oligo dry powder in annealing buffer (final concentration 20 μM), and incubate in a 90 °C water bath for 15 min. After naturally cooling to room temperature, double-stranded DNA with sticky ends is formed.

[0050] 2.2 Preparation of linearized vector

[0051] Prepare a 50 μL reaction system according to the NEB instruction manual, and use AgeI and EcoRI to double-digest the GV115 vector to linearize it.

[0052] Table 4

[0053]

[0054]

[0055] React at 37 °C (optimal temperature) for 1 h, and then recover the target fragment by gel extraction.

[0056] 2.3 Construction of RNA interference lentiviral vector

[0057] (1) Ligation

[0058] Prepare a 20 μL reaction system according to the Fermentas T4 DNA Ligase instruction manual, and ligate the double-stranded DNA oligo with the linearized vector.

[0059] Table 5

[0060]

[0061] React at 16°C for 1 h - 3 h. Name the ligation product psc37209, and then carry out the transformation experiment.

[0062] (2) Transformation

[0063] Transform the ligation product into Escherichia coli competent cells. The operation steps are as follows:

[0064] 1) Add 10 μL of the ligation product psc37209 to 100 μL of Escherichia coli competent cells and incubate on ice for 30 min.

[0065] 2) Heat shock at 42°C for 90 sec and then incubate on ice for 2 min.

[0066] 3) Add 500 μL of antibiotic-free LB liquid medium and shake culture at 37°C with 200 rpm for 1 h.

[0067] 4) Take 150 μL of the bacterial solution and evenly spread it on the LB solid medium containing Amp, and culture it overnight in a 37°C incubator.

[0068] 2.4 PCR Identification of Positive Clones

[0069] The schematic diagram of RNA interference vector construction and positive clone identification is as Figure 2 shown. The specific positive clone identification conditions are as follows:

[0070] Table 6

[0071]

[0072] Prepare a 20 μL PCR reaction system according to Table 7. Pick a single colony with a sterile pipette tip as the template and carry out PCR amplification. The reaction conditions are: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, 72°C for 30 s, for 22 cycles; 72°C for 5 min. After PCR, take 5 μL of the product and detect the band by 1% agarose gel electrophoresis.

[0073] Table 7

[0074]

[0075] The results are as Figure 3 shown. The size of the PCR fragment of the positive clone ligated with the shRNA fragment is: 380 bp; the size of the PCR fragment of the empty vector clone without the shRNA fragment ligated is: 307 bp. Thus, it is judged that psc37209-1,2,3,4,5 are positive clones. Preserve the clones with correct identification results and carry out sequencing.

[0076] 2.5 Analysis of the Sequencing Results of Positive Clones

[0077] Positive clones were sequenced using the identification primer - F, and clones with sequencing results identical to the target sequence were selected for the next experiment. The sequencing results of psc37209 are shown as SEQ ID NO: 1 below:

[0078] TTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCTTGGTAGATGGACGTATTATCTCGAGATAATACGTCCATCTACCAAGTTTTTGAATTCTCGACCTCGAGACAAATGGCAGTATTCATCCACGAATTCGGATCCATTAGGCGGCCGCGTGGATAACCGTATTACCGCCATGCATTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGG。

[0079] Note: The inserted fragment of the shRNA interference sequence is marked in bold and italic, and the AgeI restriction site is disrupted.

[0080] The bacterial solution with correct sequencing was transferred to 150 mL of LB liquid medium containing Amp antibiotic and cultured overnight at 37 °C with shaking in a shaker. Plasmids were extracted according to the instructions of the EndoFree Maxi Plasmid Kit, and the plasmids with qualified quality control entered the downstream process.

[0081] 3. Construction of a laryngeal squamous cell carcinoma cell line (AMC - HN - 8) with knockdown expression of FKBP11 (shFKBP11)

[0082] 3.1 Culture of laryngeal squamous cell carcinoma cell line (AMC - HN - 8, gifted by Asan Medical Center, UIsan University, Korea)

[0083] 3.1.1 Cell resuscitation

[0084] 1) The cryopreservation tube was placed inside a PE glove and quickly thawed by shaking in a 37 °C water bath.

[0085] 2) Add 4 mL of culture medium (by volume, 10 parts of fetal bovine serum + 1 part of penicillin-streptomycin + 1 part of L-glutamine + 88 parts of RPMI 1640 medium) into a 15 mL centrifuge tube in advance. Transfer the thawed liquid into the centrifuge tube. After centrifuging at 1000 rpm for 5 min, pour out the supernatant. Add culture medium, blow it into a single cell suspension, and seed it into a culture dish at a ratio of 1:2 or 1:3. Then culture it in an incubator at 37 °C containing 5% CO2.

[0086] 3) The culture medium needs to be changed the next day.

[0087] 3.1.2 Daily culture and subculture of cells

[0088] 1) Gently shake and then pour out the culture medium, and wash it 1 - 2 times with sterile PBS.

[0089] 2) Add trypsin digestion solution from the non-cell adherent surface, and it should submerge the cells.

[0090] 3) Digestion: Place it in a 37 °C incubator for digestion. The time depends on the freshness of trypsin, usually about 5 min. Observe under a microscope to avoid over-digestion.

[0091] 4) Add culture medium to terminate digestion, transfer it into a centrifuge tube after repeated pipetting.

[0092] 5) Centrifuge at 1000 rpm for 5 min. Too high a rotation speed is likely to damage the cells.

[0093] 6) Discard the supernatant, add a small amount of culture medium, blow it into a single cell suspension and seed it into a culture flask, and then culture it in an incubator at 37 °C containing 5% CO2.

[0094] 7) Subculture at a ratio of 1:2 or 1:3 by volume.

[0095] 8) Change the culture medium every 2 - 3 days.

[0096] 3.1.3 Cryopreservation of cells

[0097] 1) The cryopreservation solution needs to be prepared and used immediately, and pre-cool it at 4 °C for 40 - 60 min for standby.

[0098] 2) Digest adherent cells in the logarithmic growth phase (grown to 80 - 90%) into a single cell suspension. After centrifugation, discard the supernatant, add the cryopreservation solution and gently pipette. Generally, 25T culture flasks can be frozen into 2 tubes, 1 - 1.2 ml per tube. Then place it at 4 °C and -20 °C for half an hour each, and then transfer it to -80 °C overnight and then store it in a liquid nitrogen tank.

[0099] 3.1.4 Construction of laryngeal squamous cell carcinoma cell line with reduced expression of FKBP11 (shFKBP11)

[0100] The successfully constructed lentiviral vector (shFKBP11) for RNA interference of the positive FKBP11 gene in Example 1 was transfected into the above-cultured laryngeal squamous cell line (AMC-HN-8) to obtain a laryngeal squamous cell line with reduced expression of FKBP11 (shFKBP11). Using the laryngeal squamous cell line transfected with the lentiviral vector (shCtrl) as a control, RT-qPCR detection and Western blot experiments were performed.

[0101] The primers for RT-PCR detection were:

[0102] Internal reference gene GAPDH-F: 5’-TGACTTCAACAGCGACACCCA-3’;

[0103] Internal reference gene GAPDH-R: 5’-CACCCTGTTGCTGTAGCCAAA-3’;

[0104] Target gene FKBP11-F: 5’-GGAGACACGCTTCACATACAC-3’;

[0105] Target gene FKBP11-R: 5’-AATCCCCGTTTTCCATAGGC-3’.

[0106] The detection system was: (1) MicroRNA PCR: SYBRpremix ex taq 6.0 μL; upstream primer and downstream primer (5 μM) 0.5 μL each; template 1.0 μL; enzyme-free water 4.0 μL.

[0107] (2) RNA PCR: SYBRpremix ex taq 6.0 μL; primer mix (5 μM) 0.3 μL; template 0.6 μL; enzyme-free water 5.1 μL.

[0108] The detection procedure was: 95°C for 30 s; 95°C for 5 s, 60°C for 30 s, 40 cycles; 95°C for 15 s, 60°C for 30 s, 95°C for 15 s.

[0109] The results showed that compared with the negative control group (shCtrl), the expression of FKBP11 in the shFKBP11 group was significantly decreased, confirming that the AMC-HN-8 cell line with low expression of FKBP11 had been successfully constructed ( Figure 4 ).

[0110] 4. In vitro cell function verification

[0111] 4.1 Cell cycle experiment

[0112] 1) When the laryngeal squamous cell carcinoma cell line with reduced expression of FKBP11 and the control laryngeal squamous cell carcinoma cell line adhered and the coverage rate was about 80%, they were digested with trypsin, resuspended in a conventional culture medium to form a cell suspension, and the cells were collected in a 5 mL centrifuge tube. Three replicate wells were set for each group (the number of cells ≥ 10 6 / treatment).

[0113] 2) Centrifuge at 1300 rmp for 5 min, discard the supernatant, and wash the cell pellet once with DPBS pre-cooled at 4°C (pH = 7.2 - 7.4).

[0114] 3) Centrifuge at 1300 rmp for 5 min

[0115] 4) Preparation of cell staining solution: 40×PI stock solution (2 mg / mL): 100×RNase stock solution (10 mg / mL): 1×DPBS: 25×Triton X-100 = 25:10:1000:40;

[0116] 5) Cell staining: According to the cell amount, add 1 mL of cell staining solution to resuspend, so that the cell passing rate during machine operation is 300 - 800 Cell / s.

[0117] 6) Detect with a flow cytometer and perform data analysis (analyze using ModFit software).

[0118] As Figure 5 shown, the cell cycle experiment shows that: compared with the control group, the number of cells in the S phase in the shFKBP11 group decreased (P < 0.05), the number of cells in the G1 phase increased (P < 0.05), and the number of cells in the G2 / M phase increased (P < 0.05).

[0119] 4.2 Cell apoptosis experiment

[0120] 1) For the laryngeal squamous cell carcinoma cell line with reduced expression of FKBP11 and the control laryngeal squamous cell carcinoma cell line to be cultured, when the cells grew to a coverage rate of about 70% in a 6-well plate.

[0121] 2) Digest with trypsin, resuspend in a conventional culture medium to form a cell suspension, collect the cells together with the supernatant in the same 5 mL centrifuge tube. Three replicate wells were set for each group (the number of cells ≥ 5×105 / treatment).

[0122] 3) Centrifuge at 1300 rmp for 5 min, discard the supernatant, and wash the cell pellet with D-Hanks pre-cooled at 4°C (pH = 7.2 - 7.4).

[0123] 4) Wash the cell pellet once with 1×binding buffer, centrifuge at 1300 rmp for 3 min, and collect the cells.

[0124] 5) Resuspend the cell pellet with 200 μL of 1× binding buffer.

[0125] 6) Add 10 μL of Annexin V-APC staining and incubate in the dark at room temperature for 10 - 15 min.

[0126] 7) Depending on the cell amount, supplement with 400 - 800 μL of 1× binding buffer and detect using a flow cytometer.

[0127] As Figure 6 shown, the cell apoptosis experiment showed that: compared with the shCtrl group, the number of apoptotic cells in the shFKBP11 group increased (P < 0.05).

[0128] 4.3 MTT assay

[0129] 1) Trypsinize the cells of each experimental group in the logarithmic growth phase, resuspend them with conventional culture medium to form a cell suspension, and count.

[0130] 2) Seed the cells at a density of 1500 cells / well (96-well plate), with 3 - 5 replicates for each group.

[0131] 3) After the cells have completely settled, observe the cell density of each experimental group under a microscope.

[0132] 4) Starting from the second day after seeding, add 20 μL of 5 mg / mL MTT to each well 4 h before the end of the culture, without changing the medium.

[0133] 5) After 4 h, completely aspirate the culture medium, being careful not to aspirate the formazan particles at the bottom of the well plate, and add 100 μL of DMSO to dissolve the formazan particles.

[0134] 6) Shake on an oscillator for 2 - 5 min and measure the OD value using an ELISA reader at 490 / 570 nm.

[0135] As Figure 7 shown, the MTT assay showed that: compared with the shCtrl group, the cell proliferation in the shFKBP11 group was slowed down (p < 0.05).

[0136] 4.4 Scratch assay

[0137] 1) Trypsinize the cells of each experimental group in the logarithmic growth phase, resuspend them with conventional culture medium to form a cell suspension, and count.

[0138] 2) Seed the cells at a density of 50000 cells / well. The next day, the cells reach a confluence of over 90%. Culture in a 37°C, 5% CO₂ incubator, with 3 replicates for each group, and the culture system is 100 μL / well.

[0139] 3) On the second day, change to a low-concentration serum medium (containing 0.5% FBS). Use a scratch instrument to align it with the central part at the lower end of the 96-well plate and gently push upward to form a scratch.

[0140] 4) Gently rinse 2 - 3 times with serum-free medium, add low-concentration serum medium (0.5% FBS), and take a photo at 0 h.

[0141] 5) Culture in an incubator at 37°C and 5% CO₂. Select an appropriate time to scan the plate with Celigo according to the degree of healing.

[0142] 6) Analyze the migration area with Celigo.

[0143] As Figure 8 shown, the scratch assay showed that: compared with the control group, the cell migration rate in the shFKBP11 group decreased (p < 0.05).

[0144] 4.5 Transwell Migration Assay

[0145] Use the Transwell kit to conduct the experiment. The operation steps are as follows:

[0146] 1) Take out the kit, place the required number of chambers in a new 24-well plate, add 100 μL of serum-free medium to the upper chamber, and place it in an incubator at 37°C for 1 h.

[0147] 2) Prepare a serum-free cell suspension, count it, and the concentration is 5×10 4 / well.

[0148] 3) Carefully remove the medium in the upper chamber and add 100 μL of cell suspension. Add 600 μL of 30% FBS medium to the lower chamber.

[0149] 4) Culture in an incubator at 37°C for 16 h. Take out the chamber, invert the chamber on a blotting paper to remove the medium, gently remove the non-migrated cells in the chamber with a cotton swab, and fix the chamber in 4% paraformaldehyde fixative for half an hour.

[0150] 5) After fixation, take out the chamber, blot dry the fixative on the surface of the chamber with a blotting paper. Drop 1 - 2 drops of staining solution onto the lower surface of the membrane to stain the migrated cells for 1 - 3 min, then soak and rinse the chamber several times and air dry it.

[0151] 6) Take a photo under a microscope, conduct data analysis, and compare the differences in cell migration ability between the experimental group and the control group: calculate the number of migrated cells (Migratory cells per field) and standard deviation for each group, and obtain the p-value by T-Test analysis to determine whether there is a significant difference (p < 0.05 indicates a significant difference, otherwise there is no significant difference).

[0152] AsFigure 9 As shown, the Transwell migration assay showed that compared with the control group, the Transwell migration rate of the shFKBP11 group decreased (p < 0.05).

[0153] Through the above cell cycle assay, apoptosis assay, MTT assay, scratch assay, and Transwell migration assay, it was confirmed that interfering with the target gene FKBP11 inhibited the proliferation and metastasis of laryngeal cancer cells AMC-HN-8.

[0154] To further investigate the mechanism by which FKBP11 inhibits the proliferation and metastasis of laryngeal cancer cells AMC-HN-8, we compared the protein expression differences related to multiple tumor-related signaling pathways between the FKBP11 low-expression group (KD) and the control group (NC) of AMC-HN8 cells by Western blot assay, and found that the expression of CDH2 in the FKBP11 low-expression group was significantly downregulated compared with the negative control group, as Figure 10 shown.

[0155] Subsequently, a functional rescue experiment was conducted:

[0156] (1) Obtain the CDH2 gene sequence

[0157] Using the primers CDH2(44595-1)-P1: 5’-AGGTCGACTCTAGAGGATCCCGCCACCATGTGCCGGATAGCGGGAGCGCTGC-3’; CDH2(44595-1)-P2: 5’-CACACATTCCACAGGCTAGCTCAGTCATCACCTCCACCATACATG-3’, the amplification reaction system: ddH2O 32.5 μL, 5×PS Buffer 10 μL, dNTP Mix (2.5 mM each) 4 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, template (10 ng / μL) 1 μL, and PrimeSTAR HS DNA polymerase 0.5 μL; reaction conditions: 98℃ for 5 min; 98℃ for 10 s, 55℃ for 10 s, 72℃ for 90 s, 30 cycles; 72℃ for 8 min; hold at 4℃; perform PCR amplification to obtain the CDH2 gene sequence.

[0158] The amplified sequence and the CV224 vector were digested with BamHI / NheI respectively, reacted at 37 °C for 30 min and then ligated to construct a recombinant plasmid. 10 μL of the recombinant plasmid was transferred into 100 μL of competent cells, placed on ice for 30 min, heat-shocked at 42 °C for 90 s, incubated in a water bath for 2 min, 500 μL of LB medium was added, and the mixture was cultured with shaking at 37 °C for 1 h. An appropriate amount of the bacterial solution was evenly spread on a plate containing antibiotics and cultured upside down in a constant temperature incubator for 16 h. Colony PCR was used for identification to screen positive clone transformants. Identification primers: F: 5’-CATCACTCGGCTTAATGGTG-3’; R: 5’-ACCTTGAAGCGCATGAACTCC-3’; The identification result showed that the size of the PCR product of the positive transformant was 1217 bp.

[0159] The identified positive clone transformants were inoculated into LB liquid medium containing antibiotics and cultured at 37 °C for 16 h. An appropriate amount of the bacterial solution was taken for sequencing, and the sequencing results were compared and analyzed with the target gene. The comparison results are as follows (SEQ ID NO: 2):

[0160]

[0161] At the bold and italic marked positions: the ccc was synonymous mutated to ccg, and the cgt was synonymous mutated to cgc.

[0162] (2) Extract the plasmid, transfect 293T cells by the conventional method, and detect the virus titer. The results showed that the virus titer of LV-CD H2(44595-1) was 2E+8 TU / ml.

[0163] (3) Group the cells infected with the lentivirus prepared above. This experiment was divided into three groups of cells: 1. NC+NC group, as the control (green fluorescence) + control (red fluorescence); 2. KD+NC group, as FKBP11 knockdown (green fluorescence) + control (red fluorescence); 3. KD+OE group, as FKBP11 knockdown (green fluorescence) + CDH2 overexpression (red fluorescence).

[0164] Take out the frozen cells, thaw them in a 37°C water bath, and then culture them in a 37°C, 5% CO2 incubator until the confluence reaches 80%. Digest the cells with trypsin and make a cell suspension of 3-5×10 4 cells / mL. Take 1 mL and inoculate it into a 12-well plate, and continue to culture to ensure that the plating amount at the time of infection reaches about 20%.

[0165] Replace the infection medium, add the virus for infection; after 16 h of infection, replace it with the conventional medium and continue to culture; after 72 h of infection, observe that the cell state is good and the infection rate reaches more than 70%, and perform fluorescence photography (see Figure 11 ), and then the next experiment can be carried out.

[0166] The results of MTT detection are as Figure 12 shown, indicating that interfering with the expression of FKBP11 leads to a slowdown in the proliferation of AMC-HN-8 cells (p﹤0.05); after overexpressing CDH2 (OE), the proliferation of AMC-HN-8 cells increases (p﹤0.05). The results of the Transwell migration experiment are as Figure 13 shown, showing that interfering with the expression of FKBP11 leads to a decrease in the migration rate of AMC-HN-8 cells (p﹤0.05); after overexpressing CDH2 (OE), the migration rate of AMC-HN-8 cells increases (p﹤0.05).

[0167] It can be seen from the results of the above examples that FKBP11 can promote the proliferation and migration of laryngeal cancer cells, inhibit the apoptosis of laryngeal cancer cells, and promote the G1 / S phase progression of cells by targeting the regulation of CDH2, and plays a promoting role in the occurrence and development of laryngeal squamous cell carcinoma. FKBP11 can be used as a biomarker for the diagnosis and treatment of laryngeal squamous cell carcinoma.

[0168] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a lentiviral vector interfering with the expression of FKBP11 gene in the preparation of a drug for treating laryngeal squamous cell carcinoma, characterized in that, The lentiviral vector inhibits the proliferation and migration of laryngeal squamous cell carcinoma cells by interfering with the expression of the FKBP11 gene; the lentiviral vector contains nucleotides that interfere with the expression of the FKBP11 gene, and the nucleotides are composed of the nucleotides shown by psc37209-1 and the nucleotides shown by psc37209-2. The nucleotide sequence of psc37209-1 is: 5’-CCGGCTTGGTAGATGGACGTATTATCTCGAGATAATACGTCCATCTACCAAGTTTTTG-3’; the nucleotide sequence of psc37209-2 is 5’-AATTCAAAAACTTGGTAGATGGACGTATTATCTCGAGATAATACGTCCATCTACCAAG-3’.

Images