Pathogenic protein and encoding gene of pathogen of soft rot disease of pleurotus eryngii

Abstract

The application discloses a pathogenic protein of a soft rot pathogen of Pleurotus eryngii and an encoding gene thereof. The application provides a protein obtained from a Beijing E. coli, which is named as protein 1408 and is a protein shown in sequence 1 in a sequence list. A DNA molecule encoding the protein 1408 is also called as gene 1408. The application also protects the application of the protein 1408, which is as follows: regulating the pathogenicity of the Beijing E. coli; regulating the polysaccharide content of the Beijing E. coli. The inventors of the application first report the soft rot of the Pleurotus eryngii in Beijing and find the Beijing E. coli causing the pathogenicity. After the gene 1408 in the Beijing E. coli is knocked out, the content of the exocellular polysaccharide is reduced and the pathogenicity is reduced. The application has great application value for the pathogenic mechanism research of the Beijing E. coli and the prevention and control of the soft rot.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a pathogenic protein and its encoding gene of a pathogen causing soft rot in Pleurotus eryngii. Background Technology

[0002] Pleurotus eryngii, also known as king oyster mushroom, has a unique flavor and is rich in nutrients. It has high edible, medicinal, economic and ecological value and is one of the main edible fungi varieties cultivated in factories in my country. In recent years, bacterial soft-rot disease of Pleurotus eryngii has occurred in South Korea and in Beijing, Fujian and Hebei, China, seriously affecting the yield and quality of fruiting bodies (Kim M, Ryu J & Lee Y (2007) First report of Pantoea sp. induced soft rot disease of Pleurotus eryngii in Korea. Plant Disease 91(1):109; Ma Y, Liu Y, Wang S, Zhang D, Zhao S & Xu F (2014) Occurrence of Pantoea beijingensis on Pleurotus eryngii in China. Journal of Plant Pathology 96(2):433. Zhang Ruiying, Hu Dandan, Gu Jingang, Zuo Xuemei & Hu Qingxiu (2013) Isolation and identification of pathogens causing bacterial soft rot of Pleurotus eryngii. Journal of Edible Fungi 20:43-49). With the rapid development of large-scale, year-round production of Erycibe and Pleurotus eryngii, soft rot disease has become increasingly serious, directly affecting the economic benefits and enthusiasm of growers.

[0003] Soft rot of *Pleurotus eryngii* is a newly emerging disease that has emerged in recent years, and the pathogenic genes of the causative agent have not yet been elucidated. Identifying the pathogenic genes of the causative agent of soft rot of *Pleurotus eryngii* is an important prerequisite for understanding the host's disease resistance mechanism and a crucial means of breeding host-resistant strains, which is of great significance for achieving sustainable agricultural development. Summary of the Invention

[0004] The purpose of this invention is to provide a pathogenic protein and its encoding gene of the pathogen causing soft rot in Pleurotus ostreatus.

[0005] This invention provides a protein obtained from Erwinia beijingensis, named protein 1408, which is as follows (a1) or (a2) or (a3) ​​or (a4):

[0006] (a1) The protein shown in sequence 1 of the sequence listing;

[0007] (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0008] (a3) Proteins related to the pathogenicity of Erwinia pingeri obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1).

[0009] (a4) is a protein derived from Erwinia pingiensis, which shares more than 98% identity with (a1) and is associated with the pathogenicity of Erwinia pingiensis.

[0010] The term "identity" used here refers to sequence similarity to a natural amino acid sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0011] The aforementioned 98% or higher degree of identity can specifically mean 99% or higher degree of identity.

[0012] The specific labels are shown in Table 1.

[0013] Table 1: Label Sequence

[0014] Label residues sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL HA 9 YPYDVPDYA

[0015] This invention also protects nucleic acid molecules encoding protein 1408.

[0016] The nucleic acid molecule shown can be a DNA molecule or an RNA molecule.

[0017] The DNA molecule encoding protein 1408 is also known as gene 1408.

[0018] Gene 1408 can be one of the following (b1), (b2), (b3), or (b4):

[0019] (b1) A DNA molecule with a coding sequence as shown in Sequence 2 of the sequence listing;

[0020] (b2) The DNA molecule shown in sequence 3 of the sequence listing;

[0021] (b3) A DNA molecule derived from Erwinia pekinensis and having more than 95% identity with (b1) or (b2) and encoding the protein thereon;

[0022] (b4) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) or (b2) under stringent conditions and encodes the protein.

[0023] The term "identity" used here refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0024] The aforementioned 95% or higher degree of identity can specifically be 96% or higher degree of identity, 97% or higher degree of identity, 98% or higher degree of identity, or 99% or higher degree of identity.

[0025] The stringent conditions can be hybridization and washing of the membrane at 65°C in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.

[0026] Expression cassettes, recombinant vectors, or recombinant microorganisms containing gene 1408 are all within the scope of protection of this invention.

[0027] The present invention also protects the application of protein 1408 as follows: regulating the pathogenicity of Erwinia pekinensis.

[0028] The regulation is positive, meaning that a high content of protein 1408 results in strong pathogenicity of Erwinia pekinensis.

[0029] The regulation is positive, meaning that a low protein 1408 content results in weak pathogenicity of Erwinia pekinensis.

[0030] This invention also protects the application of protein 1408 as follows: regulating the polysaccharide content of Erwinia pekinensis.

[0031] The regulation is positive, meaning that the protein 1408 content is high and the polysaccharide content of Erwinia pekinensis is high.

[0032] The regulation is positive, meaning that the content of protein 1408 is low and the polysaccharide content of Erwinia pekinensis is low.

[0033] This invention also protects the application of substances that regulate gene 1408 expression, substances that regulate protein 1408 activity, or substances that regulate protein 1408 content in the prevention and control of diseases caused by Erwinia pekinensis.

[0034] The expression of the regulatory gene 1408 can be a negative regulatory gene 1408 expression.

[0035] The substance that regulates the expression of gene 1408 can specifically be a substance that inhibits the expression of gene 1408.

[0036] The substance that inhibits gene 1408 expression can be a recombinant plasmid that knocks out gene 1408 through homologous recombination.

[0037] Specifically, the recombinant plasmid is shown in sequence 4 of the sequence listing.

[0038] The activity of the regulatory protein 1408 can be a negative regulation of the protein 1408 activity.

[0039] The substances that regulate the activity of protein 1408 can specifically be substances that inhibit the activity of protein 1408.

[0040] The content of regulatory protein 1408 can be negatively regulated.

[0041] The substances that regulate the content of protein 1408 can specifically be substances that reduce the content of protein 1408.

[0042] This invention also protects the application of substances that regulate gene 1408 expression, protein 1408 activity, or protein 1408 content in regulating polysaccharide synthesis in Erwinia pekinensis.

[0043] The expression of the regulatory gene 1408 can be a negative regulatory gene 1408 expression.

[0044] The substance that regulates the expression of gene 1408 can specifically be a substance that inhibits the expression of gene 1408.

[0045] The substance that inhibits gene 1408 expression can be a recombinant plasmid that knocks out gene 1408 through homologous recombination.

[0046] Specifically, the recombinant plasmid is shown in sequence 4 of the sequence listing.

[0047] The activity of the regulatory protein 1408 can be a negative regulation of the protein 1408 activity.

[0048] The substances that regulate the activity of protein 1408 can specifically be substances that inhibit the activity of protein 1408.

[0049] The content of regulatory protein 1408 can be negatively regulated.

[0050] The substances that regulate the content of protein 1408 can specifically be substances that reduce the content of protein 1408.

[0051] The regulation of polysaccharide synthesis in Erwinia pekinensis is to inhibit polysaccharide synthesis in Erwinia pekinensis.

[0052] This invention also provides a method for reducing the pathogenicity of *Erwinia pinghenia*, comprising the following steps: reducing the pathogenicity of *Erwinia pinghenia* by inhibiting the expression of a target gene (gene 1408), reducing the expression level of the target gene (gene 1408), reducing the content of a target protein (protein 1408), or reducing the activity of the target protein (protein 1408). Specifically, the inhibition of the target gene expression in *Erwinia pinghenia* can be achieved by introducing a substance that inhibits the expression of the target gene. Specifically, the substance that inhibits the expression of the target gene can be a recombinant plasmid that knocks out gene 1408 through homologous recombination. Specifically, the recombinant plasmid is shown in sequence 4 of the sequence listing.

[0053] This invention also provides a method for reducing the polysaccharide content of *Erwinia pinghenia*, comprising the following steps: reducing the polysaccharide content of *Erwinia pinghenia* by inhibiting the expression of a target gene (gene 1408), reducing the expression level of the target gene (gene 1408), reducing the content of a target protein (protein 1408), or reducing the activity of the target protein (protein 1408). Specifically, the inhibition of the target gene expression in *Erwinia pinghenia* can be achieved by introducing a substance that inhibits the expression of the target gene. Specifically, the substance that inhibits the expression of the target gene can be a recombinant plasmid that knocks out gene 1408 through homologous recombination. Specifically, the recombinant plasmid is shown in sequence 4 of the sequence listing.

[0054] The pathogenicity of any of the above-mentioned Erwinia pekinensis can be either the pathogenicity of Erwinia pekinensis to plants or the pathogenicity of Erwinia pekinensis to fungi.

[0055] The diseases caused by any of the above-mentioned Erwinia pekinensis can be bacterial soft rot.

[0056] The diseases caused by any of the above-mentioned Erwinia pekinensis can be plant diseases or fungal diseases.

[0057] Any of the fungi mentioned above can specifically be fungi of the Pleurotaceae family.

[0058] Any of the fungi mentioned above can specifically be fungi of the genus Pleurotus.

[0059] The fungus mentioned above can specifically be Pleurotus eryngii (King Oyster Mushroom).

[0060] All of the polysaccharides mentioned above are extracellular polysaccharides.

[0061] The inventors of this invention first reported soft rot of *Pleurotus eryngii* in the Beijing area and discovered the pathogenic bacterium *Erwinia beijingensis*. Using *Erwinia beijingensis* as the research subject, the inventors discovered the genomic island EGI1, and from EGI1, they identified a pathogenic gene, gene 1408. Knocking out gene 1408 in *Erwinia beijingensis* reduced the extracellular polysaccharide content and decreased pathogenicity.

[0062] This invention has significant application value for the study of the pathogenic mechanism of Erwinia pekinensis and the prevention and control of bacterial soft rot. Attached Figure Description

[0063] Figure 1 Electrophoresis image for identifying Erwinia pekinensis genome islands.

[0064] Figure 2 This is a graph showing the results of growth characteristic detection.

[0065] Figure 3 This is a graph showing the results of pathogenicity testing. Detailed Implementation

[0066] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0067] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0068] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0069] Liquid LB medium: Each liter contains 10g NaCl, 10g tryptone, 5g yeast extract, and the remainder is water. Add 1.5g agar to every 100ml of liquid LB medium to obtain solid LB medium.

[0070] Liquid TSB medium: Each liter contains 30g of TSB (trypticase soy broth) powder (commercially available from Oxoid Company), with the remainder being water. Add 1.5g of agar to every 100ml of liquid TSB medium to obtain solid TSB medium.

[0071] Add 200g of fresh king oyster mushroom fruiting bodies to 300ml of water, crush, let stand for 30 minutes, filter, and collect the filtrate; this is the king oyster mushroom juice concentrate. Mix 70ml of water with 30ml of the king oyster mushroom juice concentrate to obtain the liquid king oyster mushroom juice culture medium. Add 1.5g of agar to every 100ml of liquid king oyster mushroom juice culture medium to obtain the solid king oyster mushroom juice culture medium.

[0072] Example 1: Discovery of Gene 1408

[0073] I. Acquisition of Erwinia pingeri

[0074] The inventors of this invention reported for the first time the soft rot disease of Pleurotus eryngii occurring in the Beijing area, and identified the pathogen as a new species of Pantoea - Pantoea beijingensis (Liu Y, Wang S, Zhang D, Wei S, Zhao S, Chen S & Xu F (2013) Pantoea beijingensis sp. nov., isolated from the fruitingbody of Pleurotus eryngii. Antonie Van Leeuwenhoek 104:1039-1047.). Furthermore, through phylogenetic tree construction based on whole genome sequence and whole genome nucleic acid sequence identity analysis, the inventors renamed the pathogen Erwinia beijingensis (Liu Y, Zhao S, Song S, Gu T, Song Z, Xie J, Rong C, A re-evaluation of the taxonomy and classification of the Type III Secretion System in a pathogenic bacterium causing soft rot disease of Pleurotus eryngii, Feng Xu#, Hui Yan#, Current Microbiology, 2021, 78:179–189).

[0075] II. Identification of Erwinia pingeri genome islands

[0076] Genome islands are mobile genetic elements that are integrated into the bacterial chromosome through horizontal gene transfer. They are of great significance to bacterial virulence, evolution, and environmental adaptation. Due to their horizontal transfer characteristics, they also serve as carriers for the widespread dissemination of pathogenic and drug-resistant factors among bacteria. Depending on their function, genome islands can be classified as pathogenic islands, metabolic islands, etc.

[0077] A GC content scan of the entire Erwinia pekinensis genome revealed an average GC content of 50.2%. A 39kb fragment with a GC content of 40.7% was identified, significantly lower than the overall genome GC content. Further analysis showed the presence of 9bp positively repetitive sequences (AGAATAACG) at both ends of this 39kb fragment. The notable characteristics of a genomic island are "GC content differing from the whole genome and the presence of positively repetitive sequences at both ends," suggesting that this fragment represents a genomic island.

[0078] PCR was used to verify whether the 39kb fragment could be excised from the chromosome. Four primers were designed: P1 and P4 were located flanking the 39kb orthogonal repeat sequence, and P2 and P3 were located inside the 39kb orthogonal repeat sequence. If the 39kb fragment did not excise: due to the presence of the fragment, P1 and P4 were separated by a large distance, and conventional PCR could not amplify a specific band; P1 / P2 and P3 / P4 amplified specific bands of 827bp and 744bp, respectively. If the 39kb fragment could excise: the distance between primers P1 and P4 would decrease due to the excision of the fragment, and therefore conventional PCR could amplify a specific 205bp band. Results are shown below. Figure 1 The results showed that P1 and P4 could amplify a 205 bp band, indicating that the large 39 kb fragment could be excised from the genome. This result was further verified by DNA sequencing, which confirmed that the sequences amplified by P1 / P4 were indeed the 39 kb fragment missing, with the sequences at both ends of the 39 kb fragment linked by attB sites.

[0079] The results showed that the 39kb fragment of Erwinia pekinensis was a genomic island, named genomic island EGI1.

[0080] P1: CTTGCGTAGTGGAAGTCT;

[0081] P2: TTTATCTCACGTATTGTTG;

[0082] P3:GCTGACGCCTTGTTTATC;

[0083] P4: GCCATCATCCGTTATTCT.

[0084] III. Quantitative PCR analysis of EGI1 excision frequency in genomic islands

[0085] The asmA gene fragment outside the genome island and the fragment amplified by P1 / P4 (i.e., the amplified fragment attB after genome island excision) were cloned into the pMD19T plasmid. The successfully constructed plasmids were named pMDasmA and pMDat. The plasmids were diluted to specific concentrations and used as templates for quantitative real-time PCR. Standard curves were plotted, and the standard curves for both fragments showed good linearity, with R... 2 Both were greater than 0.99, with amplification efficiencies of 91.59% and 90.69%, respectively.

[0086] Using overnight culture of *Erwinia pinghenia* as a template, quantitative real-time PCR amplification was performed. Based on the standard curve, the number of asmA cells was calculated to be 3.35E+10 (±6.73E+8), and the number of attB cells was 7.85E+7 (±5.21E+6). Therefore, the excision frequency of the genomic islands is 2.34 × 10⁻⁶. -3 That is, in every 1,000 bacteria cultured overnight, an average of 2.34 bacteria will undergo genome excision.

[0087] IV. Gene Transcription Analysis of EGI1, a Genome Island

[0088] Erwinia pingiensis was cultured in liquid TSB medium to the logarithmic phase (pre-infection), and 1×10⁻⁶ mol / L of the medium was added to the culture medium. 8 CFU of Erwinia pekinensis was sprayed onto 2cm fruiting bodies of Pleurotus eryngii. Five days after the onset of disease, bacterial mucus was collected from the surface of the Pleurotus eryngii (post-infection). Transcriptome sequencing was performed on the bacteria before and after infection, with three replicates for each. Differential gene analysis was performed using DEseq software.

[0089] This 39kb fragment contains 33 genes, including those related to polysaccharide and histidine synthesis. Eighteen genes showed significant expression differences before and after infection (log2FC>1, q-value<0.05). Among them, gene 1408 showed the most significant expression difference, with its expression level increasing 3.016 times after host infection, suggesting that this gene plays an important role in the pathogenicity of *Erwinia pingiensis*.

[0090] Example 2

[0091] In the genomic DNA of *Erwinia pinghenia*, gene 1408, as shown in sequence 2 of the sequence listing, encodes the protein shown in sequence 1 of the sequence listing. In the genomic DNA of *Erwinia pinghenia*, gene 1408 and its upstream and downstream segments are shown in sequence 3 of the sequence listing.

[0092] I. Construction of Suicide Plasmid

[0093] 1408upF: GTAAGTGAACTGCATGAATTCCCGGGAGAGCTCTAACGGATTATCCCCCGGCGGTGCCGAAATGGGATTA;

[0094] 1408upR: GTTTCATACAGTTGCGACCCCTCCTTTAATTGTCAATGGAATCAACTCAAGATCTTTTTGGGCTTCTAG;

[0095] 1408downF: CTAGAAGCCCAAAAAGATCTTGAGTTGATTCCATTGACAATTAAAGGAGGGGTCGCAACTGTAATGAAAC;

[0096] 1408downR: ATAGGGCCCGATCCCAAGCTTCTTCTAGAGGTACCCTACCGAAGAAATATTTCCTGATACAATTTATTCG.

[0097] 1. Using Erwinia pingeri genomic DNA as a template, PCR amplification was performed using primers consisting of 1408upF and 1408upR, and the amplification product (target fragment of 1059 bp, which is the upstream DNA fragment of the 1408 gene) was recovered.

[0098] 2. Using Erwinia pingsiensis genomic DNA as a template, PCR amplification was performed using primer pair consisting of 1408downF and 1408downR, and the amplification product (target fragment of 1057 bp, which is the downstream DNA fragment of the 1408 gene) was recovered.

[0099] 3. Take the pRE112 plasmid and digest it with restriction endonucleases kpnI and SacI to recover the large fragment of approximately 5748 bp. The pRE112 plasmid (vector pRE112) is a suicide plasmid, as described in the following literature: Edwards RA, Keller LH, Schifferli DM (1998), Improved allelic exchange vectors and their use to analyze 987P fimbria gene expression. Gene 207 (1998):149-157.

[0100] 4. The amplification products recovered in step 1, step 2, and step 3 were ligated using a seamless cloning kit (Beijing Sino-American Taihe Biotechnology Co., Ltd.) to obtain a recombinant plasmid, named suicide plasmid pRE1408M. Sequencing revealed that the suicide plasmid pRE1408M is shown in sequence 4 of the sequence listing.

[0101] II. Construction of the 1408 mutant (Δ1408 mutant)

[0102] 1. The suicide plasmid pRE1408M was introduced into Escherichia coli WM3064 and screened on solid LB agar plates containing 50 μg / ml diaminopimelic acid (DAP) and 50 μg / ml chloramphenicol (Cm) to obtain recombinant bacteria.

[0103] Escherichia coli WM3064 (auxotrophic, requiring diaminopimelic acid to grow), also known as E. coli WM3064, is described in the following literature: Construction and preliminary functional study of Aeromonas villus subtilis asfR gene knockout strain, Chang Huimin, Ma Xiang, Li Hong, Tang Yanqiong, Wang Dan, Tang Hongqian, Liu Zhu, 2021, Genomics and Applied Biology.

[0104] 2. The bacterial culture of Erwinia pekinensis in the logarithmic phase (OD) 600nm The value is approximately 0.8) and the bacterial culture (OD) of the recombinant bacteria obtained in step 1 during the logarithmic phase. 600nm The bacterial cells were mixed at a volume ratio of 3:1 (value approximately 0.8), then washed with liquid LB medium, resuspended in liquid LB medium, and then dropped onto a filter membrane placed on the surface of a solid LB medium plate. The mixture was then incubated at 28°C for 18 hours.

[0105] 3. After completing step 2, scrape off the colonies on the filter membrane, culture them in liquid LB medium at 28°C with shaking for 90 minutes, then centrifuge and collect the bacterial cells.

[0106] 4. Spread the bacterial cells obtained in step 3 onto a solid LB medium plate containing 50 μg / ml chloramphenicol and incubate statically.

[0107] 5. Transfer the single colonies grown on the plates from step 4 to solid LB agar plates containing 80 g / L sucrose and incubate statically. Spread the colonies grown on the plates onto LB plates and resistance plates respectively, and screen for colonies that can grow on LB plates but not on resistance plates. LB plates are solid LB agar plates. Resistance plates are solid LB agar plates containing 50 μg / ml chloramphenicol.

[0108] 6. The single colonies screened in step 5 were identified by PCR to obtain the target recombinant bacteria, namely the Δ1408 mutant strain. The Δ1408 mutant strain has been sequenced for verification. The sequencing verification results show that, compared with the genomic DNA of Erwinia pingiensis, the only difference in the genomic DNA of the Δ1408 mutant strain is the deletion of the DNA molecule shown in sequence 2 of the sequence listing.

[0109] PCR identification used primer pairs consisting of primers 1408-1132F and 1408-1132R, or primers 1408YZ3F and 1408YZ3R. The target sequence of primers 1408-1132F and 1408-1132R is located in gene 1408. Using *Erwinia pinghenia* as a template, approximately 1.1 kb of band was amplified, but no amplification was achieved with the target recombinant bacteria. Primers 1408YZ3F and 1408YZ3R are located upstream and downstream of gene 1408, respectively. Using *Erwinia pinghenia* as a template, approximately 3.4 kb of band was amplified, and using the target recombinant bacteria as a template, approximately 2.3 kb of band was amplified. A single colony is considered a target recombinant bacterium if it meets both of the following conditions: the primer pair consisting of primers 1408-1132F and 1408-1132R does not show an amplification band; the primer pair consisting of primers 1408YZ3F and 1408YZ3R shows a band of approximately 2.3 kb.

[0110] 1408-1132F:ATGAAACCAACAAAAATAAAGG;

[0111] 1408-1132R: AGCGCAGTGTAATATCTTCA.

[0112] 1408YZ3F: ACGCAAAATATTTTAATGTAAGGC;

[0113] 1408YZ3R:GCCGAATTATAGCTTCTACT.

[0114] III. Growth Characteristic Detection

[0115] Test bacteria: Erwinia pekinensis or Δ1408 mutant strain.

[0116] The test strain was inoculated onto a solid king oyster mushroom juice culture medium and incubated at 28°C.

[0117] See photos after 2 days of cultivation Figure 2 (A is the Δ1408 mutant strain, and B is Erwinia pingiensis). It can be clearly seen that Erwinia pingiensis produces mucus, while the Δ1408 mutant strain does not produce mucus.

[0118] After 24 hours of cultivation, the extracellular polysaccharide content was detected. The detection method was as follows: bacterial cells were collected, precipitated overnight with 4 volumes of ice-cold ethanol, then centrifuged to separate the precipitate, dried, and weighed. The precipitate was then dissolved in water, and the polysaccharide content was determined using the sulfuric acid-phenol method. The extracellular polysaccharide content of *Erwinia pingiensis* was 7.91 ± 0.47 mg / L, and the extracellular polysaccharide content of the Δ1408 mutant strain was 4.28 ± 0.12 mg / L. The results indicate that the protein encoded by the 1408 gene has a function related to polysaccharide synthesis.

[0119] IV. Pathogenicity Detection

[0120] Test bacteria: Erwinia pekinensis or Δ1408 mutant strain.

[0121] Preparation of test bacterial suspension: The test bacteria were inoculated into liquid TSB medium and cultured at 28°C and 200 rpm until the logarithmic phase. The bacterial cells were then collected and suspended in liquid TSB medium to obtain the test bacterial suspension.

[0122] The test bacterial solution prepared by Erwinia pekinensis was sprayed onto the surface of small fruiting bodies of Pleurotus eryngii, each approximately 2 cm in length (the inoculum amount per Pleurotus eryngii was 1×10⁻⁶). 8 CFU (Cellular Fumes), as the WT group. The test bacterial suspension prepared from the Δ1408 mutant strain was sprayed onto the surface of small fruiting bodies of *Pleurotus eryngii* approximately 2 cm in length (inoculation amount per *Pleurotus eryngii* was 1 × 10⁻⁶ CFU). 8 CFU (Chemical Fumarate) was used as the Δ1408 group. Liquid TSB medium was sprayed onto the surface of small fruiting bodies of Pleurotus eryngii with a length of approximately 2 cm, serving as the CK group. Observation and photography were continuously conducted.

[0123] See the photo taken 2 days after inoculation with the test bacteria. Figure 3 A. Photograph taken 4 days after inoculation with the test bacteria. Figure 3 Two days after inoculation with *Erwinia pinghenia* (2 dpi), yellow mucus and purulent symptoms appeared on the surface of the fruiting bodies, with an average of 87% ± 19% of the area affected per fruiting body. Two days after inoculation with the Δ1408 mutant strain, yellow spots appeared on the surface of the fruiting bodies without purulent symptoms, showing weaker disease development compared to the wild-type inoculated fruiting bodies, with 30% ± 17% of the area affected per fruiting body. Four days after inoculation with *Erwinia pinghenia*, the yellow rotten areas on the surface of the fruiting bodies deepened in color and produced mucus, with 95% ± 8% of the area affected per fruiting body. Four days after inoculation with the Δ1408 mutant strain, 40% ± 20% of the area affected per fruiting body, with the soft rotten areas being light yellow and without mucus. The CK group showed no disease phenotype.

[0124] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Beijing Academy of Agricultural and Forestry Sciences <120> Pathogenic protein and its encoding gene of the pathogen causing soft rot in king oyster mushroom <130> GNCYX211586 <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 377 <212> PRT <213> Erwinia beijingensis <400> 1 Met Lys Pro Thr Lys Ile Lys Val Thr Leu Thr Lys Asn Lys Ile Phe 1 5 10 15 Ile Phe Asp Ala Tyr Leu Ser Phe Leu Leu Trp Thr Cys Val Val Leu 20 25 30 Leu Phe Pro Leu Ile Ala Leu Ile Lys Glu Lys Val Met Pro Arg Tyr 35 40 45 Phe Phe Leu Asp Ala Asn Thr Ile Glu Asn Phe Met Leu Arg Lys Thr 50 55 60 Pro Leu Thr Pro Gly Asp Ser Tyr Ala Ser Thr Ala Ala Phe Tyr Asn 65 70 75 80 Phe Phe Gly Val Glu Arg Asp Ser Phe Phe Phe Pro Leu Ile Ala Ser 85 90 95 Val Ile Ile Ile Tyr Phe Phe Phe Ile Val Met Lys Arg Ala Met Pro 100 105 110 Gly Lys Leu Ser Leu Ile Glu Phe Gly Thr Tyr Leu Tyr Tyr Ile Leu 115 120 125 Leu Ala Ile Val Tyr Met Ser Leu Leu Ser Lys Asp Phe Ile Val Met 130 135 140 Leu Ile Leu Leu Pro Phe Met Phe Phe Ala Lys Lys Gly Ile Pro Gly 145 150 155 160 Leu Leu Val Trp Ser Leu Phe Ala Cys Phe Tyr Ala Val Tyr Phe Arg 165 170 175 Ser Tyr Trp Phe Leu Ile Leu Ala Ile Phe Trp Gly Phe Tyr Phe Ile 180 185 190 Phe Arg Phe Val Ser Lys Pro Gln Thr Ile Phe Leu Leu Val Phe Leu 195 200 205 Gly Leu Phe Val Leu Ala Ile Val Phe Asn Ile Val Met Gly Val Asp 210 215 220 Val Asp Asn Phe Arg Thr Ile Val Asn Asp Val Arg Leu Asp Ala Asn 225 230 235 240 Gln Gln Gly Ala Asp Ser Met Ile Thr Ser Ile Ile Pro Gly Gly Gly 245 250 255 Phe Ile Ile Gly Trp Ile Asn Val Ser Leu Thr Trp Leu Phe Leu Met 260 265 270 Leu Pro Val Pro Leu Ile Leu Ala Leu Ser Pro Tyr Tyr Met Val Ile 275 280 285 Ser Phe Phe Leu Ile Phe Leu Tyr Tyr Lys Phe Trp Gln Ala Thr Lys 290 295 300 Thr Glu Leu Thr Tyr Arg Arg Asp Pro Val Leu Lys Ala Val Ile Cys 305 310 315 320 Leu Ile Val Ala Phe Thr Ala Ile Gln Ser Val Phe Glu Pro Asp Tyr 325 330 335 Gly Ser Tyr Val Arg His Leu Ala Pro Phe Tyr Pro Leu Phe Phe Tyr 340 345 350 Ala Val Phe Ser Thr Thr Trp Leu Arg Glu Arg Ala Asp Ile Gln Asp 355 360 365 Asp Glu Asn Glu Asp Ile Thr Leu Arg 370 375 <210> 2 <211> 1134 <212> Ms <213> Erwinia beijingensis <400> 2 atgaaaccaa caaaaataaa ggtaacttta acaaaaaaca aaatattcat tttcgatgcg 60 tatttgtcat ttcttttatg gacctgtgtg gttttattat tccctttgat agcacttata 120 aaaagaaag taatgcctcg ttatttttt ctagatgcta atactattga aaattttatg 180 ttacgtaaaa ctccacttac gcccggagat tcttacgcaa gtactgcagc attttataat 240 ttctttggtg tagagcgaga ttcattcttt tttccactta ttgcatcagt aattattatt 300 tattttttct ttatcgtaat gaagcgggca atgccaggta agctatcatt aattgagttt 360 gggacttatc tttatatat ccttttggca attgtgtata tgtctttact cattaaagat 420 tttatagtga tgctaatatt actaccattt atgttttttg ctaaaaaaagg gatacctggc 480 ctactagttt ggtcattatt tgcgtgtttc tatgcggttt attttagaag ttatggttc 540 cttattttgg ctatattttg gggtttttt tttatattta gatttgtaag caagccaa 600 acaattttt tattggtctt tttagggttg tttgttttag ctattgtatt aatatagta 660 atgggagtag atgtcgataa cttccgaacc attgttaatg atgtccgcct tgatgcaaac 720 cagcaggcg ctgactcaat gatcactagc attackacctg gcggaggatt cattataggc 780 tggataaatg ttcattaac atggctttt ctaatgttgc cagtcccgtt aattttagct 840 ttatccccat atatatggt catttcgtt ttttgattt ttttatta taagttttgg 900 caggcgacaa aaacagaact tacatataga agagatcctg ttctaaagc agtaatttgc 960 ttaatagttg cttttacagc gattcaagt gttttgagc cggattatgg aagctatgtt 1020 cgccaccttg caccatttta tccattattttttgctg ttttccac aacatggttg 1080 agggagagag ctgatattca ggatgatgaa atgagata ttacactgcg ctga 1134 <210> 3 <211> 3449 <212> DNA <213> Erwinia beijingsis <400> 3 acgcaaaata ttttaatgta aggcaagaat acaaccactt gtaaaaatga ggcggtttaa 60 agcatgagta atgccggaag gaaatatt tatatcatta acggattatc ccccggcggt 120 gccgaaatgg gattagaat gctaatagac tatggctat tcaaaatgt agacttggaa 180 attatatgtt tagtcggtg cgaaagcgat ttagaaaaac ggattgagag aaaagtgcct ggatgtata cttatctctc agacaagccc gttagtaaca actatctttt acaatacacc atcaatttca ttaagatagt tcgtgaaaaa aaacccgaga father ttcactgtct caatcagtac tggtcgcaag acttgcaaag tttttttcta aatttaagtt aattacattt 480. 480. 480. 480. 480. 480. 480. 480. 480 atcactgata tattttggtg tgattcgaat gctacagaaa aagcattaat tgcaaggaat aaaggtgtta atgagaaact acttcctctc ttttatatgc cagaaaaaa ctataaaaaa agtgattata gaatcggtag ttctattaag ttaatggcgg ttggtagt agcaccacaa aaaaattatg cagagttaat cgaagtaatt aaattattac actctagggg aaatgaata acgctcagta tttttggaga tggtgaacaa cgtacatttc tagagcagaa agtaaatgag ttagaactat gcgaattat taattaga ggatttgtcc aggattggat aaagtacgct atacactatg atgcgtatat tttaatgagt gattttgaag ggttgagtat agctactttg gaggcaatga gtgtgggtct cccttgtata gtaaaacctg ttggaact taaaaattat 960 atataaata atagcactgg tttaatagtc atagtataa atcaggcttc agatgcaatt 1020 gaaagattaa aaatgaaaa agcattggct acccaccctcg gagctcgtgc agtggaatat 1080 gtgaaggaaa atcattcaga atctattttc agacatcatt ttctagaagc ccaaaagat 1140 cttgagttga ttccattatg aaaaccaaaaaaaggt aactttaaaaaaaaaaaa 1200 tattcatttt cgatgcgtat tgtcattc ttttatggac ctgtgtggtt ttattattcc 1260 ctttgatagc acttataaaa gagaagtaa tgcctcgtta ttttttcta gatgctata 1320 ctattgaaaa ttttatgtta cgtaaaactc cacttacgcc cggattct tacgcaagta 1380 ctgcagcatt ttataatttc ttgtgtag agcgagattc attcttttt ccacttattg 1440 catcagtaat tattattat ttttcttta tcgtaatgaa gcgggcaatg ccaggtaagc 1500 tatcattaat tgagttggg acttatcttt attatatcct tttggcaatt gtgtatatgt 1560 ctttactcag taaagatttt atagtgatgc taatattact accatttg tttttgcta 1620 aaaaagggat acctggccta ctagttttggt cattattgc gtgtttctat gcggttttatt 1680 ttagaagtta ttggttcctt atttggct tattttgggg tttttttt atatttagat 1740 ttgtaagcaa gccacaaca atttttt tggtctttt agggttgttt gtttagctta 1800 ttgtattca tatagtaatg ggtagatg tcgaatactt ccgaaccatt gttaatgatg 1860 tccgccttga tgcaaccag cagggcgctg actcaatgat cactagcatt attackggcg 1920 gaggattcat tataggctgg aataatgttt cattaacatg gctttttcta atgttgccag 1980 tcccgttaat tttagcttta tccccatatt atatggtcat tcgtttttt ttgatttttt 2040 tatatata gttttggcag gcgacaaaaa cagaacttac atatagaga gatcctgttc 2100 taaaagcagt aatttgctta atagttgctt ttacagcgat tcaaagtgtt ttgagccgg 2160 attatggaag ctatgttcgc caccttgcac cattttatcc attatttt tatgctgttt 2220 tttccacac atggttgagg gagagagctg atattcagga tgatgaaaat gaagatatta 2280 cactgcgctg agacattaa aggaggggtc gcaactgtaa tgaacaat tattgcggca 2340 caaattaact ctcctgaatg tgagaaagtg atatgtctta ttccagatag tcaacgtgaa 2400 gagttgaatg aaattagtga aaaaaatata agtacatttc atcgtacagg ccgtaatatt 2460 ttttcattgc ttaatctaac tgtgaagttc ttctttctcc tgctacggga aaaaccggat 2520 gtggtacatt tgcatagcac attttcaggt ttctttgcga gattagtact tattttatta 2580 atgcctataa gacgccctaa ggtaatttat tgtccacatg ccttttcttt tttaatggaa 2640 aattcggcaa ttaaacaaag aatttatatt tatatcgaac gcttttctc tctggtaacc 2700 gacagtatta tttgtgttag tgattatgag cgtatgaaag cgattaattg cggtcttaaa 2760 gaaactaaat tgatcgtgat ccataatggt gttcctcctc atgccagcga acatgctaaa 2820 catcaacgag ttaaccttaa cttactttt gttggcagac tagattttca gaagggttat 2880 gatgtgctta ttgaggcaat gcgtcagatt catgacccta caattcattt aactatcgtt 2940 ggcgatagcg ttacgaaaga aacgcaaaaa atactattgg acaatgtgac ttatactgga 3000 tggttgaaat cagcagagtt ggagtctcac tttaaaatt cagatgccct gattattccc 3060 agccgatggg aaggttttgc gatggtaccc ttagaagcga tgagctattc attaccgatt 3120 gtctctagtg attcgacttc tttacccgaa gtcgttaaag atggggaaac aggattttta 3180 tttgaaaatg gtaatgcaga tgaattacga gagaaaatat tatcacttaa gaatattgac 3240 ttaaaagtta tgggagcgaa tggtaaccga ttatttaggg acaaattcac gtcagagtct 3300 atgatcgaga agacgaataa attgtatcag gaaatatttc ttcggtagca ctgaattagt 3360 gataacacgg atgttattct ggattttctc cataaattat tttggcgggt gttgattatg 3420 agtggtatta gtagaagcta taattcggc 3449 <210> 4 <211> 7864 <212> DNA <213> Artificial Sequence <400> 4 cgcgtttccg agaaccgcgc gaacgacatg gagcggcacg cgggcgtgga aagcctggtc 60 ggctggatcg gcacgatgcg tccggcgtag aggatctgaa gatccagcag ttcaacctgt 120 tgatagtacg tactaagctc tcatgtttca cgtactaagc tctcatgttt aacgtactaa 180 gctctcatgt ttaacgaact aaaccctcat ggctaacgta ctaagctctc atggctaacg 240 tactaagctc tcatgtttca cgtactaagc tctcatgttt gaacaataaa attaatataa 300 atcagcaact taaatagcct ctaaggtttt aagttttata agaaaaaaaa gaatatataa 360 ggctttaaa gcttttaagg tttaacggtt gtggacaaca agccagggat gtaacgcact 420 gagaagccct tagagcctct caaagcaatt ttcagtgaca caggaacact taacggctga 480 catgggaatt ctgatccttt ttaacccatc acatatacct gccgttcact attatttagt 540 gaaatgagat attatgatat tttctgaatt gtgattaaaa aggcaacttt atgcccatgc 600 aacagaaact ataaaaata cagagaatga aaagaaacag atagattttt tagttcttta 660 ggcccgtagt ctgcaaatcc tttatgatt ttctatcaaa caaaagagga aatagacca 720 gttgcaatcc aaacgagagt ctaatagaat gaggtcgaaa agtaaatcgc gcgggtttgt 780 tactgataaa gcaggcaaga cctaaaatgt gtaaagggca aagtgtatac tttggcgtca 840 ccccttacat atttaggtc ttttttatt gtgcgtaact aacttgccat cttcaaacag 900 gagggctgga agaagcagac cgctaacaca gtacataaaa aaggagacat gaacgatgaa 960 catcaaaaag tttgcaaaac aagcaacagt attaaccttt actaccgcac tgctggcagg 1020 aggcgcaact caagcgtttg cgaaagaaac gaaccaaaag ccatataagg aaacatacgg 1080 cattcccat attacacgcc atgatatgct gcaaatccct gaacagcaaa aaaatgaaaa 1140 atatcaagtt cctgagttcg attcgtccac attaaaaat atctcttctg caaaaggcct 1200 ggacgtttgg gacagctggc cattacaaaa cgctgacggc actgtcgcaa actatcacgg 1260 ctaccacatc gtctttgcat tagccggaga tcctaaaaat gcggatgaca catcgattta 1320 catgttctat caaaaagtcg gcgaaacttc tattgacagc tggaaaaacg ctggccgcgt 1380 ctttaaagac agcgacaaat tcgatgcaaa tgattctatc ctaaaagacc aaacacaaga 1440 atggtcaggt tcagccacat ttacatctga cggaaaaatc cgtttattct acactgattt 1500 ctccggtaaa cattacggca aaaacact gacaactgca caagttaacg tatcagcatc 1560 agacagctct ttgaacatca acggtgtaga ggattataaa tcaatctttg acggtgacgg 1620 aaaaacgtat caaaatgtac agcagttcat cgatgaaggc aactacagct caggcgacaa 1680 ccatacgctg agagatcctc actacgtaga agtaaaggc cacaatact actatttga agcaaacact ggaactgaag atggctacca aggcgaaga tctttattta acaaagcata ctatggcaaa agcacatcat tcttccgtca agaaagtcaa aaacttctgc aaagcgataa aaaacgcacg gctgagttag caaacggcgc tctcggtatg attgagctaa acgatgatta cacactgaaa aaagtgatga aaccgctgat tgcatctaac acagtaacag atgaaattga acgcgcgac gtctttaaaa tgacggca atggtatctg ttcactgact cccgcggatc aaaaatgacg attgacggca ttacgtctaa cgatatttac atgcttggtt atgtttctaa ttctttaact ggcccataca agccgctgaa caaaactggc cttgtgttaa aaatggatct tgatcctaac gatgtaacct ttacttactc acacttcgct gtacctcaag cgaaaggaa caatgtcgtg attack atatgacaaa cagaggattc attack aacaatcaac gtttgcgccc agcttcctgc tgaacatcaa aggcaagaaa acatctgttg tcaaagacag catccttga caggacaat taacagttaa caataaaaa cgcaaaaga aatgccgata tcctattggc attttctttt atttcttatc aacataaagg tgaatcccat atgaactata 2460 taaaagcagg caaatggcta accgtattcc taaccttttg gtaatgactc caacttattg 2520 atagtgtttt atgttcagat aatgcccgat gactttgtca tgcagctcca ccgattttga 2580 gaacgacagc gacttccgtc ccagccgtgc caggtgctgc ctcagattca ggttatgccg 2640 ctcaattcgc tgcgtatatc gcttgctgat tacgtgcagc tttcccttca ggcgggattc 2700 atacagcggc cagccatccg tcatccatat caccacgtca aagggtgaca gcaggctcat 2760 aagacgcccc agcgtcgcca tagtgcgttc accgaatacg tgcgcaacaa ccgtcttccg 2820 gagactgtca tacgcgtaaa acagccagcg ctggcgcgat ttagccccga catagcccca 2880 ctgttcgtcc atttccgcgc agacgatgac gtcactgccc ggctgtatgc gcgaggttac 2940 cgactgcggc ctgagttttt taagtgacgt aaaatcgtgt tgaggccaac gcccataatg 3000 cgggctgttg cccggcatcc aacgccattc atggccatat caatgatttt ctggtgcgta 3060 ccgggttgag aagcggtgta agtgaactgc atgaattccc gggagagctc taacggatta 3120 tcccccggcg gtgccgaaat gggattagaa atgctaatag actatgggct attcaaaaat 3180 gtagacttgg aaattatatg tttaagtcgg tgcgaagcg atttagaaaa acggattgg 3240 agaaaagtgc ctggatgtat aacttactc tcagacaagc ccgttagtaa caactactt 3300 ttacaataca ccatcaattt cattaagata gttcgtgaaa aaaaacccga gataata 3360 tcttcactgt ctcaatcagt actgtcgca agacttgcaa agttttttc taaatttaag 3420 ttattacat ttgacaata cacggagttt CAAAAAAA agtattaggta tttaatgaag 3480 tatactgatt ttcactga tatattttgg tgtgattcga atgctacaga aaagcatta 3540 attgcaagga ataaagtgt taatgagaaa ctacttccctc tctttatat gccagaaaaa 3600 aacttaaaa aaagtgatta tagatcggt agttctatta agttaatggc gggttggtaga 3660 ttagcaccac aaaaaaatta tgcagagtta atcgagta ttaattatt acacctctagg 3720 ggaatgaata taacgctcag tattttgga gatggtgaac aacgtacatt tctagagcag 3780 aaagtaatg agttagact atgcgaattt attaattag aaggattgt ccaggattgg 3840 ataaagtacg ctatacacta tgatgcgtat atttaatga gtgattttga agggttgagt 3900 atagctactt tggaggcaat gagtgtgggt ctcccttgta tagtaaaacc tgttggagaa 3960 cttaaaaatt atattataaa tatagcact gttttaatag tcaatagtat aaatcaggct 4020 tcagatgcaa ttgaaagatt aaaaaatgaa aaagcattgg ctacccacct cggagctcgt 4080 gcagtggaat atgtgaagga aaatcattca gaatctattt tcagacatca ttttctagaa 4140 gcccaaaaag atcttgagtt gattccattg acaattaaag gaggggtcgc aactgtaatg 4200 aaaaatta ttgcggcaca aattaactct cctgaatgtg agaaagtgat atgtcttatt 4260 ccagatagtc aacgtgaaga gttgaatgaa attagtgaaa aaatataag tacatttcat 4320 cgtacaggcc gtaatatttt ttcattgctt aatctaactg tgaagttctt cttctcctg 4380 ctacgggaaa aaccggatgt ggtacatttg catagcacat tttcaggttt ctttgcgaga 4440 ttagtactta ttttattaat gcctataaga cgccctaagg taatttattg tccacatgcc 4500 ttttcttttt taatggaaaa ttcggcaatt aaacaaagaa tttatatta tatcgaacgc 4560 tttttctctc tggtaaccga cagtattatt tgtgttagtg attatgagcg tatgaaagcg 4620 attaattgcg gtcttaaaga aactaaattg atcgtgatcc ataatggtgt tcctcctcat 4680 gccagcgaac atgctaaaca tcaacgagtt aaccttaact tactttttgt tggcagacta 4740 gattttcaga agggttatga tgtgcttatt gaggcaatgc gtcagattca tgaccctaca 4800 attcatttaa ctatcgttgg cgatagcgtt acgaaagaaa cgcaaaaaat actattggac 4860 aatgtgactt atactggatg gttgaaatca gcagagttgg agtctcactt tataaattca 4920 gatgccctga ttattcccag ccgatgggaa ggttttgcga tggtaccctt agaagcgatg 4980 agctattcat taccgattgt ctctagtgat tcgacttctt tacccgaagt cgttaaagat 5040 ggggaaacag gatttttatt tgaaaatggt aatgcagatg aattacgaga gaaaatatta 5100 tcacttaaga atattgactt aaaagttatg ggagcgaatg gtaaccgatt atttagggac 5160 aaattcacgt cagagtctat gatcgagaag acgaataaat tgtatcagga aatatttctt 5220 cggtagggta cctctagaag aagcttggga tcgggcccta tcacttattc aggcgtagca 5280 accaggcgtt taagggcacc aataactgcc ttaaaaaaaat tacgccccgc cctgccactc 5340 atcgcagtac tgttgtaatt cattaagcat tctgccgaca tggaagccat cacagacggc 5400 atgatgaacc tgaatcgcca gcggcatcag caccttgtcg ccttgcgtat aatatttgcc 5460 catggtgaaa acggggcga agaagttgtc catattggcc acgtttaaat caaaactggt 5520 gaaactcacc cagggattgg ctgagacgaa aaacatattc tcaataaacc ctttagggaa 5580 ataggccagg ttttcaccgt aacacgccac atcttgcgaa tatatgtgta gaaactgccg 5640 gaaatcgtcg tggtattcac tccagagcga tgaaaacgtt tcagtttgct catggaaaac 5700 ggtgtaacaa gggtgaacac tatcccatat caccagctca ccgtctttca ttgccatacg 5760 gaattccgga tgagcattca tcaggcgggc aagaatgtga ataaggccg gataaaactt 5820 gtgcttattt ttctttacgg tctttaaaaa ggccgtaata tccagctgaa cggtctggtt 5880 ataggtacat tgagcaactg actgaaatgc ctcaaaatgt tctttacgat gccattggga 5940 tatatcaacg gtggtatatc cagtgatttt tttctccatt ttagcttcct tagctcctga 6000 aaatctcgat aactcaaaaa atacgcccgg tagtgatctt atttcattat ggtgaaagtt 6060 ggaacctctt acgtgccgat caacgtctca ttttcgccaa aagttggccc agggcttccc 6120 ggtatcaaca gggacaccag gatttattta ttctgcgaag tgatcttccg tcacaggtat 6180 tagggcccga tcctttttgt ccggtgttgg gttgaaggtg aagccggtcg gggccgcagc 6240 gggggccggc ttttcagcct tgcccccctg cttcggccgc cgtggctccg gcgtcttggg 6300 tgccggcgcg ggttccgcag ccttggcctg cggtgcgggc acatcggcgg gcttggcctt 6360 gatgtgccgc ctggcgtgcg agcggaacgt ctcgtaggag aacttgacct tccccgtttc 6420 ccgcatgtgc tcccaaatgg tgacgagcgc atagccggac gctaacgccg cctcgacatc 6480 cgccctcacc gccaggaacg caaccgcagc ctcatcacgc cggcgcttct tggccgcgcg 6540 ggattcaacc cactcggcca gctcgtcggt gtagctcttt ggcatcgtct ctcgcctgtc 6600 ccctcagttc agtaatttcc tgcatttgcc tgtttccagt cggtagatat tccacaaaac 6660 agcagggaag cagcgctttt ccgctgcata accctgcttc ggggtcatta tagcgatttt 6720 ttcggtatat ccatcctttt tcgcacgata tacaggattt tgccaaaggg ttcgtgtaga 6780 ctttccttgg tgtatccaac ggcgtcagcc gggcaggata ggtgaagtag gcccacccgc 6840 gagcgggtgt tccttcttca ctgtccctta ttcgcacctg gcggtgctca acgggaatcc 6900 tgctctgcga ggctggccgg ctaccgccgg cgtaacagat gagggcaagc ggatggctga 6960 tgaaaccaag ccaaccagga agggcagccc acctatcaag gtgtactgcc ttccagacga 7020 acgaagagcg attgaggaaa aggcggcggc ggccggcatg agcctgtcgg cctacctgct 7080 ggccgtcggc cagggctaca aaatcacggg cgtcgtggac tatgagcacg tccgcgagct 7140 ggcccgcatc aatggcgacc tgggccgcct gggcggcctg ctgaaactct ggctcaccga 7200 cgacccgcgc acggcgcggt tcggtgatgc cacgatcctc gccctgctgg cgaagatcga 7260 agagaagcag gacgagcttg gcaaggtcat gatgggcgtg gtccgcccga gggcagagcc 7320 atgactttt tagccgctaa aacggccggg gggtgcgcgt gattgccaag cacgtcccca 7380 tgcgctccat caagaagagc gacttcgcgg agctggtgaa gtacatcacc gacgagcaag 7440 gcaagaccga gcgcctgggt cacgtgcgcg tcacgaactg cgaggcaaac accctgcccg 7500 ctgtcatggc cgaggtgatg gcgacccagc acggcaacac ccgttccgag gccgacaaga 7560 cctatcacct gctggttagc ttccgcgcgg gagagaagcc cgacgcggag acgttgcgcg 7620 cgattgagga ccgcatctgc gctgggcttg gcttcgccga gcatcagcgc gtcagtgccg 7680 tgcatcacga caccgacaac ctgcacatcc atatcgccat caacaagatt cacccgaccc 7740 gaaacaccat ccatgagccg tatcgggcct accgcgccct cgctgacctc tgcgcgacgc 7800 tcgaacggga ctacgggctt gagcgtgaca atcacgaaac gcggcagcgc gtttccgaga 7860 accg 7864

Claims

1. Application of substances that negatively regulate the expression of nucleic acid molecules encoding proteins or substances that negatively regulate the content of proteins in the prevention and control of diseases caused by Erwinia pekinensis; The protein in question is the protein shown in sequence 1 of the sequence listing.

2. Application of substances that negatively regulate the expression of nucleic acid molecules encoding proteins or substances that negatively regulate the content of proteins in reducing polysaccharide synthesis in Erwinia pekinensis; The protein in question is the protein shown in sequence 1 of the sequence listing.

3. The application according to claim 1 or 2, characterized in that: The nucleic acid molecule is as follows (b1) or (b2) or (b3): (b1) A DNA molecule with the sequence shown in Sequence 2 of the sequence listing; (b2) The DNA molecule shown in sequence 3 of the sequence listing; (b3) A DNA molecule derived from Erwinia pekinensis and having more than 95% identity with (b1) or (b2) and encoding the protein thereon.

4. The application according to claim 1 or 2, characterized in that: The substance that negatively regulates the expression of nucleic acid molecules encoding proteins is a substance that inhibits the expression of the nucleic acid molecules; The substance that negatively regulates protein content is a substance that reduces the protein content.

5. A method for reducing the pathogenicity of Erwinia pekinensis, comprising the following steps: reducing the pathogenicity of Erwinia pekinensis by inhibiting the expression of the gene encoding the protein of claim 1 in Erwinia pekinensis, or reducing the expression level of the gene encoding the protein of claim 1 in Erwinia pekinensis, or reducing the content of the protein of claim 1 in Erwinia pekinensis.

6. A method for reducing the polysaccharide content of Erwinia pekinensis, comprising the following steps: reducing the polysaccharide content of Erwinia pekinensis by inhibiting the expression of the gene encoding the protein of claim 1 in Erwinia pekinensis, or by reducing the expression level of the gene encoding the protein of claim 1 in Erwinia pekinensis, or by reducing the content of the protein of claim 1 in Erwinia pekinensis.

Images